Unique variants in gene TP53

Information The variants shown are described using the NM_000546.5 transcript reference sequence.

197 entries on 2 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-/. 1 - c.-16132C>A benign r.(?) p.(=) g.7606798G>T - WRAP53(NM_018081.2):c.1641G>T (p.L547=) - EFNB3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-16057C>T likely benign r.(?) p.(=) g.7606723G>A - WRAP53(NM_018081.2):c.1566G>A (p.A522=) - WRAP53_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-16056G>A likely benign r.(?) p.(=) g.7606722C>T - WRAP53(NM_018081.2):c.1565C>T (p.A522V) - EFNB3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 2 - c.-16056G>C benign r.(?) p.(=) g.7606722C>G - WRAP53(NM_018081.2):c.1565C>G (p.A522G) - WRAP53_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
-?/., ?/. 2 - c.-16028G>C likely benign, VUS r.(?) p.(=) g.7606694C>G - WRAP53(NM_018081.2):c.1537C>G (p.R513G) - WRAP53_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 1 - c.-15984A>G likely benign r.(?) p.(=) g.7606650T>C - WRAP53(NM_018081.2):c.1493T>C (p.L498P) - WRAP53_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.-15973T>C benign r.(?) p.(=) g.7606639A>G - WRAP53(NM_018081.2):c.1482A>G (p.E494=) - EFNB3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-15938G>A VUS r.(?) p.(=) g.7606604C>T - WRAP53(NM_018081.2):c.1447C>T (p.R483C) - EFNB3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-15691C>T VUS r.(?) p.(=) g.7606357G>A - WRAP53(NM_018081.2):c.1315G>A (p.V439M) - WRAP53_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-15684A>G likely benign r.(?) p.(=) g.7606350T>C - - - WRAP53_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.-15453C>T benign r.(?) p.(=) g.7606119G>A - WRAP53(NM_018081.2):c.1223G>A (p.G408D) - EFNB3_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.-15199G>A likely pathogenic r.(?) p.(=) g.7605865C>T - - - WRAP53_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.-14422G>A benign r.(?) p.(=) g.7605088C>T - WRAP53(NM_018081.2):c.936C>T (p.C312=) - WRAP53_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-14415C>T VUS r.(?) p.(=) g.7605081G>A - WRAP53(NM_018081.2):c.929G>A (p.R310Q) - EFNB3_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-14405G>A VUS r.(?) p.(=) g.7605071C>T - WRAP53(NM_018081.2):c.919C>T (p.R307W) - EFNB3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-14299G>A likely benign r.(?) p.(=) g.7604965C>T - WRAP53(NM_018081.2):c.823-10C>T - WRAP53_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-14207C>T likely benign r.(?) p.(=) g.7604873G>A - WRAP53(NM_018081.2):c.822+6G>A - EFNB3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-14126G>A likely benign r.(?) p.(=) g.7604792C>T - WRAP53(NM_018081.2):c.747C>T (p.S249=) - EFNB3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-13475G>A VUS r.(?) p.(=) g.7604141C>T - WRAP53(NM_018081.2):c.725C>T (p.T242I) - EFNB3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-13474T>C VUS r.(?) p.(=) g.7604140A>G - WRAP53(NM_018081.2):c.724A>G (p.T242A) - EFNB3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-1931C>G VUS r.(?) p.(=) g.7592597G>C - WRAP53(NM_018081.2):c.487G>C (p.E163Q) - TP53_010170 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.-1894G>A benign r.(?) p.(=) g.7592560C>T - - - WRAP53_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-1746G>A likely benign r.(?) p.(=) g.7592412C>T - WRAP53(NM_018081.2):c.431+15C>T - TP53_010169 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-1695G>T likely benign r.(?) p.(=) g.7592361C>A - WRAP53(NM_018081.2):c.395C>A (p.T132N) - TP53_010168 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.-1502G>C benign r.(?) p.(=) g.7592168C>G - - - WRAP53_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-1487C>T likely benign r.(?) p.(=) g.7592153G>A - WRAP53(NM_018081.2):c.187G>A (p.V63M) - WRAP53_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-1331G>A likely benign r.(?) p.(=) g.7591997C>T - - - WRAP53_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 _1_1i c.(?_-202)_(-29+1_-28-1)del pathogenic r.0? p.0? g.(7579941_7590694)_(7590868_?)del - c.(?_-17900)_(?_1-1)del - TP53_010145 - PubMed: Fostira 2020 - - Germline - - - - - Florentia Fostira
+/+ 1 1i_6i c.(-29+1_-28-1)_(672+1_673-1)dup kConFab: LGR r.spl? p.? g.(7577609_7578176)_(7579941_7590694)dup - P53 dup exons 2_6 - TP53_010009 - kConFab variant classification: LGR - - Unknown - 1/1658 - - - kConFab - Heather Thorne
-?/. 1 - c.6G>A likely benign r.(?) p.(=) g.7579907C>T - TP53(NM_000546.5):c.6G>A (p.=) - TP53_010167 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 4 2 c.9G>T VUS r.(?) p.(Glu3Asp) g.7579904C>A g.7676586C>A - - TP53_010123 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - - Germline - 1/7051 cases breast cancer, 1/11241 controls, 1/12479 controls - - - Yukihide Momozawa
-/. 3 2 c.27C>T benign r.(?) p.(=) g.7579886G>A g.7676568G>A - - TP53_010122 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs757282628 Germline - 1/7051 cases breast cancer, 3/11241 controls, 3/12454 controls - - - Yukihide Momozawa
?/. 2 2 c.28G>A VUS r.(?) p.(Val10Ile) g.7579885C>T g.7676567C>T - - TP53_010121 not in 7051 cases breast cancer PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs535274413 Germline - 1/11241 controls, 2/12454 controls - - - Yukihide Momozawa
-/. 5 2 c.31G>C benign r.(?) p.(Glu11Gln) g.7579882C>G g.7676564C>G - - TP53_010120 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs201382018 Germline - 95/7051 cases breast cancer, 172/11214 controls, 184/12451 controls, 1/53 cases, 1 more item - - - Yukihide Momozawa
+/. 1 - c.69_74+1del pathogenic r.(?) p.(Trp23Tyrfs*19) g.7579840_7579846del g.7676520_7676526del TP53(NM_000546.5):c.69_74+1delGAAACTG - TP53_010055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.74+38C>G benign r.(=) p.(=) g.7579801G>C g.7676483G>C - - TP53_010063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 3 c.90C>T benign r.(?) p.(=) g.7579882C>G - - - TP53_010119 not in 7051 cases breast cancer PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs370992294 Germline - 1/11241 controls - - - Yukihide Momozawa
-/. 6 3 c.91G>A benign r.(?) p.(Val31Ile) g.7579705C>T g.7676387C>T - - TP53_010118 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs201753350 Germline - 91/7051 cases breast cancer, 138/11241 controls, 1/12490 controls, 146/12490 controls, 2 more items - - - Yukihide Momozawa
+?/. 1 - c.96+1G>A likely pathogenic r.spl p.? g.7579699C>T g.7676381C>T - - TP53_010124 - - - - Unknown - - - - - IMGAG
-/. 2 - c.96+41_97-54del benign r.(?) p.(=) g.7579669_7579684del g.7676351_7676366del, g.7676326_7676341del 1 more item - TP53_010054, TP53_010053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_NKI
-?/. 2 - c.97-52G>A likely benign r.(=) p.(=) g.7579642C>T g.7676324C>T TP53(NM_000546.5):c.97-52G>A - TP53_010062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_NKI
-/. 3 - c.97-29C>A benign r.(=) p.(=) g.7579619G>T g.7676301G>T TP53(NM_000546.5):c.97-29C>A - TP53_010061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_Rotterdam, VKGL-NL_NKI
-/. 1 - c.97-6C>T benign r.(=) p.(=) g.7579596G>A - TP53(NM_001126114.2):c.97-6C>T - TP53_010052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.99C>T likely benign r.(?) p.(=) g.7579588G>A g.7676270G>A TP53(NM_001126114.2):c.99C>T (p.S33=) - TP53_010051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/., -?/. 11 4 c.108G>A benign, likely benign r.(?) p.(=) g.7579579C>T g.7676261C>T TP53(NM_000546.5):c.108G>A (p.P36=, p.(=), p.=), TP53(NM_001126114.2):c.108G>A (p.P36=) - TP53_010050 VKGL data sharing initiative Nederland PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs1800370 CLASSIFICATION record, Germline - 36/7051 cases breast cancer, 85/11241 controls, 2/12490 controls, 88/12490 controls, 1/11241 controls - - - VKGL-NL_Rotterdam, VKGL-NL_Leiden, Yukihide Momozawa, VKGL-NL_VUmc, VKGL-NL_NKI, VKGL-NL_Groningen, VKGL-NL_Nijmegen
?/. 2 4 c.129G>C VUS r.(?) p.(Leu43Phe) g.7579558C>G g.7676240C>G - - TP53_010117 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs754332870 Germline - 4/7051 cases breast cancer, 1/11241 controls - - - Yukihide Momozawa
./. 1 - c.139C>T - r.(?) p.(Pro47Ser) g.7579548G>A g.7676230G>A - - TP53_010024 - Thibodeau lab (Mayo Clinic) - - Germline - - - - - Melissa DeRycke
-/. 3 4 c.141G>A benign r.(?) p.(=) g.7579546C>T g.7676228C>T - - TP53_010116 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs201741778 Germline - 3/7051 cases breast cancer, 1/11241 controls, 1/12490 controls - - - Yukihide Momozawa
?/. 5 4 c.145G>C VUS r.(?) p.(Asp49His) g.7579542C>G g.7676224C>G - - TP53_010115 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs587780728 Germline - 36/7051 cases breast cancer, 49/11241 controls, 68/12490 controls, 1/53 cases, 1/11241 controls - - - Yukihide Momozawa
./. 1 - c.173C>G - r.(?) p.(Pro58Arg) g.7579514G>C g.7676196G>C - - TP53_010023 - Thibodeau lab (Mayo Clinic) - - Germline - - - - - Melissa DeRycke
?/. 1 - c.182A>C VUS r.(?) p.(Asp61Ala) g.7579505T>G g.7676187T>G - - TP53_010114 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - - Germline - 1/12490 controls - - - Yukihide Momozawa
+?/. 11 4 c.186del pathogenic r.(?) p.(Ala63Leufs*60) g.7579501del g.7676183del 186delA, 186delA (E62del) - TP53_010141 - - - - Somatic - - - - - Anja Bukovac
?/. 2 4 c.190C>A VUS r.(?) p.(Pro64Thr) g.7579497G>T g.7676179G>T - - TP53_010113 not in 7051 cases breast cancer PubMed: Momozawa 2018, Journal: Momozawa 2018 - - Germline - 2/11241 controls, 2/12490 controls - - - Yukihide Momozawa
?/. 2 4 c.190C>G VUS r.(?) p.(Pro64Ala) g.7579497G>C g.7676179G>C - - TP53_010140 - - - - Somatic - - - - - Anja Bukovac
+?/. 1 4 c.202_203insT pathogenic r.(?) p.(Glu68Valfs*81) g.7579484_7579485insA g.7676166_7676167insA - - TP53_010139 - - - - Somatic - - - - - Anja Bukovac
+?/. 2 4 c.208dup pathogenic r.(?) p.(Ala70Glyfs*79) g.7579479dup g.7676161dup 209insG - TP53_010144 - - - - Somatic - - - - - Anja Bukovac
?/. 1 4 c.209dup pathogenic r.(?) p.(Pro71Serfs*78) g.7579478dup g.7676160dup 7676159_7676160insG - TP53_010143 - - - - Somatic - - - - - Anja Bukovac
-?/. 1 4 c.213C>A VUS r.(=) p.(Pro71=) g.7579474G>T g.7676156G>T - - TP53_010136 - - - - Somatic - - Anja Bukovac - - Anja Bukovac
?/. 2 4 c.214C>G VUS r.(?) p.(Pro72Ala) g.7579473G>C g.7676155G>C - - TP53_010112 not in 11241 controls PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs587782769 Germline - 2/7051 cases breast cancer, 3/12490 controls - - - Yukihide Momozawa
-/., +?/. 20 4 c.215C>G benign, pathogenic r.(?) p.(Pro72Arg) g.7579472G>C g.7676154G>C TP53(NM_000546.5):c.215C>G (p.P72R), TP53(NM_001126114.2):c.215C>G (p.P72R) - TP53_010049 VKGL data sharing initiative Nederland PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs1042522 CLASSIFICATION record, Germline, Somatic - 1210/7051 cases breast cancer, 2070/11241 controls, 5013/12488 controls, 5837/12488 controls, 4 more items - - - VKGL-NL_Rotterdam, Yukihide Momozawa, Anja Bukovac, Maximiliano Zeballos, VKGL-NL_Nijmegen, VKGL-NL_NKI, VKGL-NL_Groningen, Carlos Vaccaro
+?/. 9 4 c.215G>C pathogenic r.(?) p.(Pro72Arg) g.7579472G>C g.7676154G>C - - TP53_010135 - - - - Somatic - - - - - Anja Bukovac
+/. 1 - c.216dup pathogenic r.(?) p.(Val73Argfs*76) g.7579476dup - TP53(NM_000546.5):c.216dupC (p.V73Rfs*76) - TP53_010048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/., ?/., -?/. 5 4 c.217G>A pathogenic, VUS, likely benign r.(?) p.(Val73Met) g.7579470C>T g.7676152C>T - - TP53_010060 VKGL data sharing initiative Nederland PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs587782423 Somatic, Germline, CLASSIFICATION record - 2/12490 controls - - - Anja Bukovac, Yukihide Momozawa, VKGL-NL
+?/. 1 4 c.229C>T pathogenic r.(?) p.(Pro77Ser) g.7579458G>A g.7676140G>A - - TP53_010134 - - - - Somatic - - - - - Anja Bukovac
+?/. 1 4 c.243dup pathogenic r.(?) p.(Pro82Thrfs*67) g.7579444dup g.7676126dup 243_244insA - TP53_010133 - - - - Somatic - - - - - Anja Bukovac
./., +?/. 2 4 c.245C>T pathogenic r.(?) p.(Pro82Leu) g.7579442G>A g.7676124G>A - - TP53_010022 - Thibodeau lab (Mayo Clinic) - - Germline, Somatic - - - - - Melissa DeRycke, Anja Bukovac
-/. 1 - c.246G>A benign r.(?) p.(=) g.7579441C>T g.7676123C>T - - TP53_010111 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs372397095 Germline - 1/12490 controls - - - Yukihide Momozawa
?/. 2 4 c.249G>A VUS r.(?) p.(=) g.7579438C>T g.7676120C>T - - TP53_010110 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs55754907 Germline - 1/7051 cases breast cancer, 2/11241 controls - - - Yukihide Momozawa
-?/. 1 - c.255T>C likely benign r.(?) p.(=) g.7579432A>G g.7676114A>G TP53(NM_000546.5):c.255T>C (p.P85=) - TP53_010047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.263C>A VUS r.(?) p.(Ala88Asp) g.7579424G>T g.7676106G>T - - TP53_010109 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - - Germline - 1/12490 controls - - - Yukihide Momozawa
+?/. 1 4 c.263C>G pathogenic r.(?) p.(Ala88Gly) g.7579424G>C g.7676106G>C - - TP53_010131 - - - - Somatic - - - - - Anja Bukovac
+?/. 2 4 c.271T>C pathogenic r.(?) p.(Trp91Arg) g.7579416A>G g.7676098A>G - - TP53_010130 - - - - Somatic - - - - - Anja Bukovac
?/. 1 4 c.276C>A VUS r.(?) p.(Pro92=) g.7579411G>T g.7676093G>T - - TP53_010129 - - - - Somatic - - - - - Anja Bukovac
+/. 1 - c.277del pathogenic r.(?) p.(Leu93Cysfs*30) g.7579413del g.7676092del TP53(NM_000546.5):c.277delC (p.L93Cfs*30) - TP53_010046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 2 4 c.300G>T pathogenic r.(?) p.(Gln100His) g.7579387C>A g.7676069C>A - - TP53_010128 - - - - Somatic - - - - - Anja Bukovac
?/. 1 4 c.305C>A VUS r.(?) p.(Thr102Asn) g.7579438C>T - - - TP53_010108 not in 11241 controls PubMed: Momozawa 2018, Journal: Momozawa 2018 - - Germline - 1/7051 cases breast cancer - - - Yukihide Momozawa
?/. 3 4 c.312G>A VUS r.(?) p.(Gln104=) g.7579375C>T g.7676057C>T - - TP53_010127 - - - - Somatic - - - - - Anja Bukovac
?/. 5 4 c.315C>T VUS r.(?) p.(Gly105=) g.7579372G>A g.7676054G>A - - TP53_010126 - - - - Somatic - - - - - Anja Bukovac
-/. 1 4 c.321C>T benign r.(?) p.(=) g.7579382G>T - - - TP53_010107 not in 7051 cases breast cancer PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs770776262 Germline - 1/11241 controls - - - Yukihide Momozawa
+?/. 2 4 c.322G>C pathogenic r.(?) p.(Gly108Arg) g.7579365C>G g.7676047C>G - - TP53_010125 - - - - Somatic - - - - - Anja Bukovac
+/. 1 - c.324_327dup pathogenic r.(?) p.(Arg110Phefs*40) g.7579360_7579363dup g.7676042_7676045dup 324_327dupTTTC - TP53_010150 - PubMed: Fostira 2020 - - Germline - - - - - Florentia Fostira
+/. 1 - c.328del pathogenic r.(?) p.(Arg110Valfs*13) g.7579360del - TP53(NM_000546.5):c.328delC (p.R110Vfs*13) - TP53_010166 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 2 4 c.329G>A VUS r.(?) p.(Arg110His) g.7579358C>T g.7676040C>T TP53(NM_000546.5):c.329G>A (p.R110H) - TP53_010045 not in 7051 cases breast cancer, VKGL data sharing initiative Nederland PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs11540654 Germline, CLASSIFICATION record - 1/11241 controls - - - Yukihide Momozawa, VKGL-NL
+/. 1 4 c.329G>T pathogenic r.(?) p.(Arg110Leu) g.7579358C>A g.7676040C>A - - TP53_010003 - PubMed: Monnerat 2007 - - Germline - - - - - James Whitworth
+/. 1 - c.336_351del pathogenic r.(?) p.(Phe113Glnfs*5) g.7579342_7579357del g.7676018_7676033del TP53(NM_000546.5):c.336_351delCTTCTTGCATTCTGGG (p.F113Qfs*5) - TP53_010044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.375G>A pathogenic r.spl p.(Ser33_Thr125del) g.7579312C>T g.7675994C>T - - TP53_010149 - PubMed: Fostira 2020 - - Germline - - - - - Florentia Fostira
-?/. 1 - c.375+16G>A likely benign r.(=) p.(=) g.7579296C>T - - - TP53_010165 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.376-2dup likely pathogenic r.spl? p.? g.7578556dup - TP53(NM_000546.5):c.376-2dupA - TP53_010164 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/+ 1 5 c.378C>A kConFab: P r.(?) p.(Tyr126*) g.7578552G>T g.7675234G>T P53 378 C>A (Y126X) - TP53_010007 - kConFab variant classification: P - - Unknown - 1/1658 - - - kConFab - Heather Thorne
+/. 1 - c.378C>G pathogenic r.(?) p.(Tyr126*) g.7578552G>C g.7675234G>C - - TP53_010106 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - - Germline - 1/12490 controls - - - Yukihide Momozawa
-?/. 1 - c.396G>A likely benign r.(?) p.(=) g.7578534C>T g.7675216C>T TP53(NM_000546.5):c.396G>A (p.K132=) - TP53_010042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 5 c.408A>G benign r.(?) p.(=) g.7579358C>T - - - TP53_010105 not in 11241 controls PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs758781593 Germline - 1/7051 cases breast cancer - - - Yukihide Momozawa
?/. 1 - c.412_435del VUS r.(?) p.(Ala138_Leu145del) g.7578498_7578521del g.7675177_7675200del TP53(NM_000546.5):c.412_435delGCCAAGACCTGCCCTGTGCAGCTG (p.A138_L145del) - TP53_010041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 5 c.437_445del likely pahtogenic r.[=,627_635del] p.[=,Trp146_Asp148del) g.7675297_7675305del - - - TP53_010017 - - - - Germline yes - - - - Trinidad Caldes
-?/. 1 - c.450A>G likely benign r.(?) p.(=) g.7578480T>C g.7675162T>C TP53(NM_000546.5):c.450A>G (p.T150=) - TP53_010040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 3 5 c.456G>A benign r.(?) p.(=) g.7578474C>T g.7675156C>T - - TP53_010104 - PubMed: Momozawa 2018, Journal: Momozawa 2018 - - Germline - 4/7051 cases breast cancer, 7/11241 controls, 4/12490 controls - - - Yukihide Momozawa
?/. 1 5 c.460G>A VUS r.(?) p.(Gly154Ser) g.7578474C>T - - - TP53_010103 not in 11241 controls PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs137852789 Germline - 1/7051 cases breast cancer - - - Yukihide Momozawa
?/. 1 5 c.465C>T VUS r.(?) p.(=) g.7578470C>T - - - TP53_010102 not in 7051 cases breast cancer PubMed: Momozawa 2018, Journal: Momozawa 2018 - - Germline - 1/11241 controls - - - Yukihide Momozawa
+/., ?/. 2 5 c.467G>A pathogenic, VUS r.(?) p.(Arg156His) g.7578465G>A, g.7578463C>T - - - TP53_010101 not in 11241 controls, VKGL data sharing initiative Nederland PubMed: Momozawa 2018, Journal: Momozawa 2018 - rs371524413 Germline, CLASSIFICATION record - 2/7051 cases breast cancer - - - Yukihide Momozawa, VKGL-NL
+?/. 1 - c.467G>C likely pathogenic r.(?) p.(Arg156Pro) g.7578463C>G - - - TP53_010163 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
Legend   « First ‹ Prev     1 2     Next › Last »