Unique variants in gene ZIC2

Information The variants shown are described using the NM_007129.3 transcript reference sequence.

45 entries on 1 page. Showing entries 1 - 45.




AscendingDNA change (cDNA)     


RNA change     



DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. 1 - c.-64C>G VUS r.(?) p.(=) - g.100634255C>G - - - ZIC2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.90_92dup likely benign r.(?) p.(Ala33dup) - g.100634408_100634410dup - ZIC2(NM_007129.4):c.90_92dupGGC (p.A33dup) - ZIC2_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/., -/. 2 - c.213G>A likely benign, benign r.(?) p.(=) - g.100634531G>A - ZIC2(NM_007129.4):c.213G>A (p.P71=) - ZIC2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
-?/. 1 - c.397G>A likely benign r.(?) p.(Gly133Ser) - g.100634715G>A - ZIC2(NM_007129.4):c.397G>A (p.G133S) - ZIC2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.479del pathogenic r.(?) p.(Pro160Argfs*58) - g.100634797del - - - ZIC2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.489A>G benign r.(?) p.(=) - g.100634807A>G - ZIC2(NM_007129.4):c.489A>G (p.P163=) - ZIC2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.552del likely pathogenic r.(?) p.(Gly185Alafs*33) - g.100634870del - - - ZIC2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.581A>G VUS r.(?) p.(Tyr194Cys) - g.100634899A>G - - - ZIC2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.593C>T VUS r.(?) p.(Ala198Val) - g.100634911C>T - ZIC2(NM_007129.4):c.593C>T (p.A198V) - ZIC2_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.652A>G VUS r.(?) p.(Asn218Asp) - g.100634970A>G - ZIC2(NM_007129.3):c.652A>G (p.(Asn218Asp)) - ZIC2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.694C>A VUS r.(?) p.(His232Asn) - g.100635012C>A - ZIC2(NM_007129.4):c.694C>A (p.H232N) - ZIC2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.698A>C VUS r.(?) p.(His233Pro) - g.100635016A>C - ZIC2(NM_007129.3):c.698A>C (p.(His233Pro)) - ZIC2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.701A>C VUS r.(?) p.(His234Pro) - g.100635019A>C - ZIC2(NM_007129.3):c.701A>C (p.(His234Pro)) - ZIC2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.704A>C VUS r.(?) p.(His235Pro) - g.100635022A>C - ZIC2(NM_007129.3):c.704A>C (p.(His235Pro)) - ZIC2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.707A>C VUS r.(?) p.(His236Pro) - g.100635025A>C - ZIC2(NM_007129.3):c.707A>C (p.(His236Pro)) - ZIC2_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.707_718del likely benign r.(?) p.(His236_His239del) - g.100635025_100635036del - ZIC2(NM_007129.4):c.707_718delACCACCACCACC (p.H236_H239del) - ZIC2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.710A>C VUS r.(?) p.(His237Pro) - g.100635028A>C - ZIC2(NM_007129.3):c.710A>C (p.(His237Pro)) - ZIC2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 2 - c.710_718del VUS r.(?) p.(His237_His239del) - g.100635028_100635036del - ZIC2(NM_007129.4):c.710_718delACCACCACC (p.H237_H239del) - ZIC2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Rotterdam
?/. 1 - c.713A>C VUS r.(?) p.(His238Pro) - g.100635031A>C - ZIC2(NM_007129.3):c.713A>C (p.(His238Pro)) - ZIC2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.713_718del likely benign r.(?) p.(His238_His239del) - g.100635031_100635036del - ZIC2(NM_007129.4):c.713_718delACCACC (p.H238_H239del) - ZIC2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.716A>C VUS r.(?) p.(His239Pro) - g.100635034A>C - ZIC2(NM_007129.3):c.716A>C (p.(His239Pro)) - ZIC2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/., -/. 2 - c.716_718del likely benign, benign r.(?) p.(His239del) - g.100635034_100635036del - ZIC2(NM_007129.4):c.716_718delACC (p.H239del) - ZIC2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
?/., -/. 2 - c.716_718dup VUS, benign r.(?) p.(His239dup) - g.100635034_100635036dup - ZIC2(NM_007129.4):c.716_718dupACC (p.H239dup) - ZIC2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_Utrecht
+?/. 1 - c.857A>G likely pathogenic r.(?) p.(His286Arg) - g.100635175A>G - - - ZIC2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.879C>T likely benign r.(?) p.(=) - g.100635197C>T - ZIC2(NM_007129.4):c.879C>T (p.G293=) - ZIC2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.1025A>G likely pathogenic r.(?) p.(Lys342Arg) - g.100635343A>G - - - ZIC2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1059C>T - - p.(=) - g.100635377C>T g.99983123C>T - - ZIC2_000004 - - - - Germline - - - - - Yu Sun
?/. 1 - c.1075+213G>A - - p.(=) - g.100635606G>A g.99983352G>A - - ZIC2_000001 - - - - Germline - - - - - Yu Sun
?/. 2 - c.1076-98T>C - - p.(=) - g.100637102T>C g.99984848T>C - - ZIC2_000002 - - - - Germline - - - - - Yu Sun
+/. 1 - c.1090C>T pathogenic r.(?) p.(Gln364*) - g.100637214C>T - - - ZIC2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.1239+18G>A benign r.(=) p.(=) - g.100637381G>A - - - ZIC2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.1329del pathogenic r.(?) p.(Ser444Alafs*111) - g.100637666del - - - ZIC2_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1336G>A VUS r.(?) p.(Glu446Lys) - g.100637673G>A - - - ZIC2_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1373C>T likely benign r.(?) p.(Ala458Val) - g.100637710C>T - ZIC2(NM_007129.4):c.1373C>T (p.A458V) - ZIC2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1377_1382dup likely benign r.(?) p.(Ala469_Ala470dup) - g.100637714_100637719dup - ZIC2(NM_007129.4):c.1377_1382dupAGCGGC (p.A469_A470dup) - ZIC2_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1377_1388del likely benign r.(?) p.(Ala467_Ala470del) - g.100637714_100637725del - ZIC2(NM_007129.4):c.1377_1388delAGCGGCGGCGGC (p.A467_A470del) - ZIC2_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1377_1406del VUS r.(?) p.(Ala461_Ala470del) - g.100637714_100637743del - ZIC2(NM_007129.4):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC (p.A461_A470del) - ZIC2_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.1377_1406dup pathogenic r.(?) p.(Ala461_Ala470dup) - g.100637714_100637743dup - - - ZIC2_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1389_1391del likely benign r.(?) p.(Ala470del) - g.100637726_100637728del - ZIC2(NM_007129.4):c.1389_1391delGGC (p.A470del) - ZIC2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1401_1406dup likely benign r.(?) p.(Ala469_Ala470dup) - g.100637738_100637743dup - ZIC2(NM_007129.4):c.1401_1406dupGGCGGC (p.A469_A470dup) - ZIC2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1448G>A VUS r.(?) p.(Gly483Asp) - g.100637785G>A - - - ZIC2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1480_1527del likely benign r.(?) p.(Gly494_Ser509del) - g.100637817_100637864del - ZIC2(NM_007129.3):c.1468_1515del (p.(Ser493_Gly508del)) - ZIC2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1497C>T likely benign r.(?) p.(=) - g.100637834C>T - ZIC2(NM_007129.4):c.1497C>T (p.G499=) - ZIC2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1501_1524del likely benign r.(?) p.(Gly501_Gly508del) - g.100637838_100637861del - ZIC2(NM_007129.3):c.1486_1509del (p.(Gly499_Gly506del)) - ZIC2_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.1508_1520del pathogenic r.(?) p.(Gly503Alafs*48) - g.100637845_100637857del - - - ZIC2_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL