Full data view for gene ZIC2

Information The variants shown are described using the NM_007129.3 transcript reference sequence.

58 entries on 1 page. Showing entries 1 - 58.



AscendingDNA change (cDNA)     

RNA change     




Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

?/. - c.-64C>G r.(?) p.(=) - Unknown - VUS g.100634255C>G g.99982001C>G - - ZIC2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.90_92dup r.(?) p.(Ala33dup) - Unknown - likely benign g.100634408_100634410dup g.99982154_99982156dup ZIC2(NM_007129.4):c.90_92dupGGC (p.A33dup) - ZIC2_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.90_92dup r.(?) p.(Ala33dup) - Unknown - VUS g.100634408_100634410dup g.99982154_99982156dup ZIC2(NM_007129.4):c.90_92dupGGC (p.A33dup) - ZIC2_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.213G>A r.(?) p.(Pro71=) - Unknown - likely benign g.100634531G>A g.99982277G>A ZIC2(NM_007129.4):c.213G>A (p.P71=) - ZIC2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.213G>A r.(?) p.(Pro71=) - Unknown - benign g.100634531G>A g.99982277G>A ZIC2(NM_007129.4):c.213G>A (p.P71=) - ZIC2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.397G>A r.(?) p.(Gly133Ser) - Unknown - likely benign g.100634715G>A g.99982461G>A ZIC2(NM_007129.4):c.397G>A (p.G133S) - ZIC2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.459G>T r.(?) p.(Ala153=) - Unknown - likely benign g.100634777G>T - ZIC2(NM_007129.4):c.459G>T (p.A153=) - ZIC2_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.479del r.(?) p.(Pro160ArgfsTer58) - Unknown - pathogenic g.100634797del g.99982543del - - ZIC2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.489A>G r.(?) p.(Pro163=) - Unknown - benign g.100634807A>G g.99982553A>G ZIC2(NM_007129.4):c.489A>G (p.P163=) - ZIC2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.552del r.(?) p.(Gly185AlafsTer33) - Unknown - likely pathogenic g.100634870del g.99982616del - - ZIC2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.581A>G r.(?) p.(Tyr194Cys) - Unknown - VUS g.100634899A>G g.99982645A>G - - ZIC2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.593C>T r.(?) p.(Ala198Val) - Unknown - VUS g.100634911C>T g.99982657C>T ZIC2(NM_007129.4):c.593C>T (p.A198V) - ZIC2_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.652A>G r.(?) p.(Asn218Asp) - Unknown - VUS g.100634970A>G g.99982716A>G ZIC2(NM_007129.3):c.652A>G (p.(Asn218Asp)) - ZIC2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.694C>A r.(?) p.(His232Asn) - Unknown - VUS g.100635012C>A g.99982758C>A ZIC2(NM_007129.4):c.694C>A (p.H232N) - ZIC2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.698A>C r.(?) p.(His233Pro) - Unknown - VUS g.100635016A>C g.99982762A>C ZIC2(NM_007129.3):c.698A>C (p.(His233Pro)) - ZIC2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.701A>C r.(?) p.(His234Pro) - Unknown - VUS g.100635019A>C g.99982765A>C ZIC2(NM_007129.3):c.701A>C (p.(His234Pro)) - ZIC2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.704A>C r.(?) p.(His235Pro) - Unknown - VUS g.100635022A>C g.99982768A>C ZIC2(NM_007129.3):c.704A>C (p.(His235Pro)) - ZIC2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.707A>C r.(?) p.(His236Pro) - Unknown - VUS g.100635025A>C g.99982771A>C ZIC2(NM_007129.3):c.707A>C (p.(His236Pro)) - ZIC2_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.707_718del r.(?) p.(His236_His239del) - Unknown - likely benign g.100635025_100635036del g.99982771_99982782del ZIC2(NM_007129.4):c.707_718delACCACCACCACC (p.H236_H239del) - ZIC2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.710A>C r.(?) p.(His237Pro) - Unknown - VUS g.100635028A>C g.99982774A>C ZIC2(NM_007129.3):c.710A>C (p.(His237Pro)) - ZIC2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.710_718del r.(?) p.(His237_His239del) - Unknown - VUS g.100635028_100635036del g.99982774_99982782del ZIC2(NM_007129.4):c.710_718delACCACCACC (p.H237_H239del) - ZIC2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.710_718del r.(?) p.(His237_His239del) - Unknown - VUS g.100635028_100635036del g.99982774_99982782del ZIC2(NM_007129.4):c.710_718delACCACCACC (p.H237_H239del) - ZIC2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.713A>C r.(?) p.(His238Pro) - Unknown - VUS g.100635031A>C g.99982777A>C ZIC2(NM_007129.3):c.713A>C (p.(His238Pro)) - ZIC2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.713_718del r.(?) p.(His238_His239del) - Unknown - likely benign g.100635031_100635036del g.99982777_99982782del ZIC2(NM_007129.4):c.713_718delACCACC (p.H238_H239del) - ZIC2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.716A>C r.(?) p.(His239Pro) - Unknown - VUS g.100635034A>C g.99982780A>C ZIC2(NM_007129.3):c.716A>C (p.(His239Pro)) - ZIC2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.716_718del r.(?) p.(His239del) - Unknown - benign g.100635034_100635036del g.99982780_99982782del ZIC2(NM_007129.4):c.716_718delACC (p.H239del) - ZIC2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.716_718del r.(?) p.(His239del) - Unknown - likely benign g.100635034_100635036del g.99982780_99982782del ZIC2(NM_007129.4):c.716_718delACC (p.H239del) - ZIC2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.716_718del r.(?) p.(His239del) - Unknown - likely benign g.100635034_100635036del g.99982780_99982782del ZIC2(NM_007129.4):c.716_718delACC (p.H239del) - ZIC2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.716_718dup r.(?) p.(His239dup) - Unknown - benign g.100635034_100635036dup g.99982780_99982782dup ZIC2(NM_007129.4):c.716_718dupACC (p.H239dup) - ZIC2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.716_718dup r.(?) p.(His239dup) - Unknown - VUS g.100635034_100635036dup g.99982780_99982782dup ZIC2(NM_007129.4):c.716_718dupACC (p.H239dup) - ZIC2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.857A>G r.(?) p.(His286Arg) - Unknown - likely pathogenic g.100635175A>G g.99982921A>G - - ZIC2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.879C>T r.(?) p.(Gly293=) - Unknown - likely benign g.100635197C>T g.99982943C>T ZIC2(NM_007129.4):c.879C>T (p.G293=) - ZIC2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.885G>A r.(?) p.(Pro295=) - Unknown - likely benign g.100635203G>A g.99982949G>A ZIC2(NM_007129.4):c.885G>A (p.P295=) - ZIC2_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1004G>T r.(?) p.(Cys335Phe) - Unknown - likely pathogenic g.100635322G>T - ZIC2(NM_007129.4):c.1004G>T (p.C335F) - chr13_002350 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1025A>G r.(?) p.(Lys342Arg) - Unknown - likely pathogenic g.100635343A>G g.99983089A>G - - ZIC2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1059C>T r.(?) p.(=) - Unknown - VUS g.100635377C>T g.99983123C>T - - ZIC2_000004 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1075+213G>A r.(=) p.(=) - Both (homozygous) - VUS g.100635606G>A g.99983352G>A - - ZIC2_000001 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1076-98T>C r.(=) p.(=) - Unknown - VUS g.100637102T>C g.99984848T>C - - ZIC2_000002 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1076-98T>C r.(=) p.(=) - Both (homozygous) - VUS g.100637102T>C g.99984848T>C - - ZIC2_000002 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
+/. - c.1090C>T r.(?) p.(Gln364Ter) - Unknown - pathogenic g.100637214C>T g.99984960C>T - - ZIC2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1239+18G>A r.(=) p.(=) - Unknown - benign g.100637381G>A g.99985127G>A - - ZIC2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1329del r.(?) p.(Ser444AlafsTer111) - Unknown - pathogenic g.100637666del g.99985412del - - ZIC2_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1336G>A r.(?) p.(Glu446Lys) - Unknown - VUS g.100637673G>A g.99985419G>A - - ZIC2_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1373C>T r.(?) p.(Ala458Val) - Unknown - likely benign g.100637710C>T g.99985456C>T ZIC2(NM_007129.4):c.1373C>T (p.A458V) - ZIC2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1377_1382dup r.(?) p.(Ala469_Ala470dup) - Unknown - likely benign g.100637714_100637719dup g.99985460_99985465dup ZIC2(NM_007129.4):c.1377_1382dupAGCGGC (p.A469_A470dup) - ZIC2_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1377_1388del r.(?) p.(Ala467_Ala470del) - Unknown - likely benign g.100637714_100637725del g.99985460_99985471del ZIC2(NM_007129.4):c.1377_1388delAGCGGCGGCGGC (p.A467_A470del) - ZIC2_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1377_1406del r.(?) p.(Ala461_Ala470del) - Unknown - VUS g.100637714_100637743del g.99985460_99985489del ZIC2(NM_007129.4):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC (p.A461_A470del) - ZIC2_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1377_1406dup r.(?) p.(Ala461_Ala470dup) - Unknown - pathogenic g.100637714_100637743dup g.99985460_99985489dup - - ZIC2_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1383_1391del r.(?) p.(Ala468_Ala470del) - Unknown - VUS g.100637720_100637728del - ZIC2(NM_007129.4):c.1383_1391delGGCGGCGGC (p.A468_A470del) - ZIC2_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1389_1391del r.(?) p.(Ala470del) - Unknown - likely benign g.100637726_100637728del g.99985472_99985474del ZIC2(NM_007129.4):c.1389_1391delGGC (p.A470del) - ZIC2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.1397_1411del r.(?) p.(Ala466_Ala470del) - Unknown - likely pathogenic g.100637734_100637748del g.99985480_99985494del ZIC2(NM_007129.4):c.1397_1411delCGGCGGCGGCCGCGG (p.A466_A470del) - ZIC2_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1401_1406dup r.(?) p.(Ala469_Ala470dup) - Unknown - likely benign g.100637738_100637743dup g.99985484_99985489dup ZIC2(NM_007129.4):c.1401_1406dupGGCGGC (p.A469_A470dup) - ZIC2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1448G>A r.(?) p.(Gly483Asp) - Unknown - VUS g.100637785G>A g.99985531G>A - - ZIC2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1480_1527del r.(?) p.(Gly494_Ser509del) - Unknown - likely benign g.100637817_100637864del g.99985563_99985610del ZIC2(NM_007129.3):c.1468_1515del (p.(Ser493_Gly508del)) - ZIC2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1497C>T r.(?) p.(Gly499=) - Unknown - likely benign g.100637834C>T g.99985580C>T ZIC2(NM_007129.4):c.1497C>T (p.G499=) - ZIC2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1501_1524del r.(?) p.(Gly501_Gly508del) - Unknown - likely benign g.100637838_100637861del g.99985584_99985607del ZIC2(NM_007129.3):c.1486_1509del (p.(Gly499_Gly506del)) - ZIC2_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1505_1516del r.(?) p.(Ala502_Gly505del) - Unknown - VUS g.100637842_100637853del g.99985588_99985599del ZIC2(NM_007129.4):c.1505_1516delCGGGCGGCGGGG (p.A502_G505del) - ZIC2_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1508_1520del r.(?) p.(Gly503AlafsTer48) - Unknown - pathogenic g.100637845_100637857del g.99985591_99985603del - - ZIC2_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -