Full data view for gene ADAMTS2

Ehlers Danlos Syndrome Variant Database


Information The variants shown are described using the NM_014244.4 transcript reference sequence.

94 entries on 1 page. Showing entries 1 - 94.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Predicted     

Type/DNA     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+/+ 1 c.2T>C r.(?) p.0? initiating methionine substitution Paternal (confirmed) - pathogenic g.178772328A>G - - - ADAMTS2_000008 - PubMed: Van Damme et al., 2016 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS - PubMed: Van Damme et al., 2016 - - - - - - 0 - - 1 Sofie Symoens
-?/. - c.65_70dup r.(?) p.(Leu22_Leu23dup) - - Unknown - likely benign g.178772280_178772285dup g.179345279_179345284dup ADAMTS2(NM_014244.4):c.65_70dupTGCTGC (p.L22_L23dup) - ADAMTS2_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.68T>C r.(?) p.(Leu23Pro) - - Unknown - likely benign g.178772262A>G g.179345261A>G ADAMTS2(NM_014244.4):c.68T>C (p.L23P) - ADAMTS2_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.68_70del r.(?) p.(Leu23del) - - Unknown - likely benign g.178772283_178772285del g.179345282_179345284del ADAMTS2(NM_014244.4):c.68_70delTGC (p.L23del) - ADAMTS2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.68_70dup r.(?) p.(Leu23dup) - - Unknown - benign g.178772283_178772285dup g.179345282_179345284dup ADAMTS2(NM_014244.4):c.68_70dupTGC (p.L23dup) - ADAMTS2_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.80_100dup r.(?) p.(Leu27_Pro33dup) - - Unknown - likely benign g.178772241_178772261dup g.179345240_179345260dup ADAMTS2(NM_014244.4):c.80_100dupTCCTGCCGCCGCCGCCGCCGC (p.L27_P33dup) - ADAMTS2_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/- 1 c.102_123dup r.(?) p.(Ala42Argfs*31) frameshift duplication Unknown - likely benign g.178772207_178772228dup - - - ADAMTS2_000018 - PubMed: Bo et al., 2020 - - Unknown - - - 0 - DNA SEQ-NG - - ? - PubMed: Bo et al., 2020 The patient was diagnosed with situs inversus totalis, and idiopathic thrombocytopenia purpura. The variant was described in the paper as an insertion at c.123_124, but is in fact a duplication of c.102_123. It was detected via exome sequencing, and thus the authors were uncertain if the patient had compound heterogeneity for another variant in ADAMTS2. The technique used was whole exome sequencing. - - - - - 0 - - 1 Raymond Dalgleish
-?/. - c.139+4G>A r.spl? p.? - - Unknown - likely benign g.178772187C>T g.179345186C>T ADAMTS2(NM_014244.4):c.139+4G>A - ADAMTS2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.220G>A r.(?) p.(Val74Met) - - Parent #1 - VUS g.178771082C>T g.179344081C>T - - ADAMTS2_000014 conflicting interpretations of pathogenicity; 19 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs2271211 Germline - 19/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 19 Mohammed Faruq
-/- 2 c.220G>A r.(?) p.(Val74Met) missense substitution Unknown - likely benign g.178771082C>T - - - ADAMTS2_000014 - PubMed: Chen et al., 2020 - rs2271211 Unknown - - - 0 - DNA SEQ-NG - - ? - PubMed: Chen et al., 2020 This deleterious SNP is highly associated with intracranial aneurysm. The technique used was whole exome sequencing. The technique used was whole genome sequencing. - - China Han Chinese - 0 - - 1 Raymond Dalgleish
-/. - c.321T>C r.(?) p.(Ser107=) - - Unknown - benign g.178770981A>G g.179343980A>G ADAMTS2(NM_014244.4):c.321T>C (p.S107=), ADAMTS2(NM_014244.5):c.321T>C (p.S107=) - ADAMTS2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.321T>C r.(?) p.(Ser107=) - - Unknown - benign g.178770981A>G g.179343980A>G ADAMTS2(NM_014244.4):c.321T>C (p.S107=), ADAMTS2(NM_014244.5):c.321T>C (p.S107=) - ADAMTS2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.405C>T r.(?) p.(Ala135=) - - Unknown - likely benign g.178770897G>A g.179343896G>A ADAMTS2(NM_014244.4):c.405C>T (p.A135=) - ADAMTS2_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.534+9G>C r.(=) p.(=) - - Unknown - benign g.178770759C>G g.179343758C>G ADAMTS2(NM_014244.4):c.534+9G>C, ADAMTS2(NM_014244.5):c.534+9G>C - ADAMTS2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.534+9G>C r.(=) p.(=) - - Unknown - benign g.178770759C>G g.179343758C>G ADAMTS2(NM_014244.4):c.534+9G>C, ADAMTS2(NM_014244.5):c.534+9G>C - ADAMTS2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/+ 3 c.535-?_688+?del r.? p.(Ala179Glyfs*17) deletion, exon deletion Maternal (confirmed) - pathogenic g.178699912_178700065del - - - ADAMTS2_000005 - PubMed: Colige et al., 2004 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS P8 PubMed: Colige et al., 2004 This patient was subsequently described by {PMID15389701:Malfait et al., 2004}.The exact boundaries of the maternal deletion were not determined. - - - white - 0 - - 1 Raymond Dalgleish
+/+ 03_05 c.535-?_975+?del r.? p.(Ala179_Lys325del) deletion, multi exon deletion Both (homozygous) - pathogenic g.178608073_178700065del - - - ADAMTS2_000003 - PubMed: Colige et al., 2004 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS P7 PubMed: Colige et al., 2004 This patient was subsequently described by {PMID15389701:Malfait et al., 2004}.The exact boundaries of the deletion variant were not determined. - - - white - 0 - - 1 Raymond Dalgleish
+/+ 4 c.669_670dup r.(?) p.(Pro224Argfs*24) frameshift duplication Both (homozygous) - pathogenic g.178699930_178699931dup - - - ADAMTS2_000010 - PubMed: Van Damme et al., 2016 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS - PubMed: Van Damme et al., 2016 - - - - - - 0 - - 1 Sofie Symoens
+/+ 3 c.673C>T r.(?) p.(Gln225*) nonsense substitution Both (homozygous) - pathogenic g.178699927G>A - - - ADAMTS2_000002 - PubMed: Colige et al., 1999 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS Patient 6 PubMed: Colige et al., 1999 - - - - Jewish-Ashkenazi - 0 - - 1 Raymond Dalgleish
+/+ 3 c.673C>T r.(?) p.(Gln225*) nonsense substitution Both (homozygous) - pathogenic g.178699927G>A - - - ADAMTS2_000002 - PubMed: Colige et al., 1999 - - Unknown - - - 0 - DNA SEQ - - EDS, EDSDERMS Patient 2 PubMed: Colige et al., 1999 This patient was previously described by {PMID1642226:Smith et al., 1992}. - - - - - 0 - - 1 Raymond Dalgleish
+/+ 3 c.673C>T r.(?) p.(Gln225*) nonsense substitution Both (homozygous) - pathogenic g.178699927G>A - - - ADAMTS2_000002 - PubMed: Colige et al., 1999 - - Unknown - - - 0 - DNA SEQ - - EDS, EDSDERMS Patient 3 PubMed: Colige et al., 1999 This patient was previously described by {PMID8215497:Petty et al., 1993}. - - - - - 0 - - 1 Raymond Dalgleish
+/+ 3 c.673C>T r.(?) p.(Gln225*) nonsense substitution Both (homozygous) - pathogenic g.178699927G>A - - - ADAMTS2_000002 - PubMed: Colige et al., 1999 - - Unknown - - - 0 - DNA SEQ - - EDS, EDSDERMS Patient 4 PubMed: Colige et al., 1999 This patient was previously described by {PMID8986271:Fujimoto et al., 1997}. - - Mexico Mexican - 0 - - 1 Raymond Dalgleish
+/+ 3 c.673C>T r.(?) p.(Gln225*) nonsense substitution Both (homozygous) - pathogenic g.178699927G>A - - - ADAMTS2_000002 - PubMed: Colige et al., 1999 - - Unknown - - - 0 - DNA SEQ - - EDS, EDSDERMS Patient 5 PubMed: Colige et al., 1999 This patient was previously described by {PMID7735500:Reardon et al., 1995}. - - United Kingdom (Great Britain) British - 0 - - 1 Raymond Dalgleish
+/+ 3 c.673C>T r.(?) p.(Gln225*) nonsense substitution Both (homozygous) - pathogenic g.178699927G>A - - - ADAMTS2_000002 - PubMed: Bar-Yosef et al., 2008 - - Unknown - - - 0 - DNA SEQ - - EDS, EDSDERMS - PubMed: Bar-Yosef et al., 2008 This variant is later described in {PMID29795570:Rivas et al., 2018} as a variant significantly enriched in the Ashkenazi Jewish population, with further detail. - - - Jewish-Ashkenazi - 0 - - 1 Raymond Dalgleish
-?/-? 3i c.688+25836T>C r.(?) - other/complex substitution Unknown - benign g.178674076A>G - - - ADAMTS2_000013 - PubMed: Matullo et al., 2013 - rs4701085 Unknown - - - 0 - DNA SEQ-NG - - ? - PubMed: Matullo et al., 2013 This variant is significantly associated with malignant pleural mesothelioma, a condition caused by exposure to asbestos with genetic components. The technique used was whole genome sequencing. - - Italy - - 0 - - 1 Raymond Dalgleish
-?/-? 3i c.688+28769dup r.(?) - splicing affected? duplication Unknown - benign g.178671143dup - - - ADAMTS2_000012 - PubMed: Iglesias et al., 2018 - - Unknown - - - 0 - DNA SEQ-NG - - ? - PubMed: Iglesias et al., 2018 This variant is associated with central corneal thickness, derived from a meta-analysis of GWAS. It has an average population frequency of 0.29 in Europeans and 0.11 in an Asian population. The technique used was whole genome sequencing. - - - - - 0 - - 1 Raymond Dalgleish
-/- 3i c.689-28692T>G r.(?) - other/complex substitution Unknown - likely benign g.178663408A>C - - - ADAMTS2_000016 - PubMed: Arning et al., 2012 - rs469568 Unknown - - - 0 - DNA SEQ-NG - - ? - PubMed: Arning et al., 2012 This SNP is highly associated with pediatric stroke. The technique used was whole genome sequencing. - - - - - 0 - - 1 Raymond Dalgleish
-?/. - c.689-18G>A r.(=) p.(=) - - Unknown - likely benign g.178634734C>T g.179207733C>T ADAMTS2(NM_014244.4):c.689-18G>A - ADAMTS2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.701A>G r.(?) p.(Asp234Gly) - - Unknown - benign g.178634704T>C g.179207703T>C ADAMTS2(NM_014244.4):c.701A>G (p.D234G) - ADAMTS2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.722G>A r.(?) p.(Arg241His) - - Unknown - benign g.178634683C>T g.179207682C>T ADAMTS2(NM_014244.4):c.722G>A (p.R241H), ADAMTS2(NM_014244.5):c.722G>A (p.R241H) - ADAMTS2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.722G>A r.(?) p.(Arg241His) - - Unknown - benign g.178634683C>T g.179207682C>T ADAMTS2(NM_014244.4):c.722G>A (p.R241H), ADAMTS2(NM_014244.5):c.722G>A (p.R241H) - ADAMTS2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.732C>T r.(?) p.(Gly244=) - - Unknown - likely benign g.178634673G>A - ADAMTS2(NM_014244.4):c.732C>T (p.G244=) - ADAMTS2_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.733G>A r.(?) p.(Val245Ile) - - Unknown - benign g.178634672C>T g.179207671C>T ADAMTS2(NM_014244.4):c.733G>A (p.V245I), ADAMTS2(NM_014244.5):c.733G>A (p.V245I) - ADAMTS2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.733G>A r.(?) p.(Val245Ile) - - Unknown - benign g.178634672C>T g.179207671C>T ADAMTS2(NM_014244.4):c.733G>A (p.V245I), ADAMTS2(NM_014244.5):c.733G>A (p.V245I) - ADAMTS2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.764G>A r.(?) p.(Arg255Gln) - - Unknown - likely benign g.178634641C>T g.179207640C>T ADAMTS2(NM_014244.4):c.764G>A (p.R255Q) - ADAMTS2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.773G>A r.(?) p.(Arg258His) - - Unknown - VUS g.178634632C>T g.179207631C>T ADAMTS2(NM_014244.4):c.773G>A (p.(Arg258His)) - ADAMTS2_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.786G>A r.(?) p.(Ala262=) - - Unknown - benign g.178634619C>T g.179207618C>T ADAMTS2(NM_014244.4):c.786G>A (p.A262=), ADAMTS2(NM_014244.5):c.786G>A (p.A262=) - ADAMTS2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.786G>A r.(?) p.(Ala262=) - - Unknown - benign g.178634619C>T g.179207618C>T ADAMTS2(NM_014244.4):c.786G>A (p.A262=), ADAMTS2(NM_014244.5):c.786G>A (p.A262=) - ADAMTS2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.798C>T r.(?) p.(Tyr266=) - - Unknown - likely benign g.178634607G>A g.179207606G>A ADAMTS2(NM_014244.4):c.798C>T (p.Y266=) - ADAMTS2_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.858C>T r.(?) p.(His286=) - - Unknown - benign g.178634547G>A g.179207546G>A ADAMTS2(NM_014244.4):c.858C>T (p.H286=) - ADAMTS2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/+ 4 c.884_887del r.(?) p.(Met295Thrfs*26) frameshift deletion Maternal (confirmed) - pathogenic g.178634518_178634521del - - - ADAMTS2_000009 - PubMed: Van Damme et al., 2016 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS - PubMed: Van Damme et al., 2016 - - - - - - 0 - - 1 Sofie Symoens
-?/. - c.891+9G>A r.(=) p.(=) - - Unknown - likely benign g.178634505C>T g.179207504C>T ADAMTS2(NM_014244.4):c.891+9G>A - ADAMTS2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.936C>T r.(?) p.(Asn312=) - - Unknown - benign g.178608112G>A g.179181111G>A ADAMTS2(NM_014244.4):c.936C>T (p.N312=) - ADAMTS2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.991G>A r.(?) p.(Glu331Lys) - - Unknown - VUS g.178585865C>T g.179158864C>T ADAMTS2(NM_014244.4):c.991G>A (p.E331K) - ADAMTS2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1083T>C r.(?) p.(Asp361=) - - Unknown - likely benign g.178585773A>G g.179158772A>G ADAMTS2(NM_014244.4):c.1083T>C (p.D361=) - ADAMTS2_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1087G>A r.(?) p.(Ala363Thr) - - Unknown - VUS g.178585769C>T g.179158768C>T ADAMTS2(NM_014244.4):c.1087G>A (p.A363T) - ADAMTS2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1122C>T r.(?) p.(Ser374=) - - Unknown - likely benign g.178585734G>A g.179158733G>A ADAMTS2(NM_014244.4):c.1122C>T (p.S374=) - ADAMTS2_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1194C>T r.(?) p.(Asp398=) - - Unknown - benign g.178581859G>A g.179154858G>A ADAMTS2(NM_014244.4):c.1194C>T (p.D398=), ADAMTS2(NM_014244.5):c.1194C>T (p.D398=) - ADAMTS2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1194C>T r.(?) p.(Asp398=) - - Unknown - benign g.178581859G>A g.179154858G>A ADAMTS2(NM_014244.4):c.1194C>T (p.D398=), ADAMTS2(NM_014244.5):c.1194C>T (p.D398=) - ADAMTS2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1238+18G>A r.(=) p.(=) - - Unknown - benign g.178581797C>T g.179154796C>T ADAMTS2(NM_014244.4):c.1238+18G>A, ADAMTS2(NM_014244.5):c.1238+18G>A - ADAMTS2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1238+18G>A r.(=) p.(=) - - Unknown - benign g.178581797C>T g.179154796C>T ADAMTS2(NM_014244.4):c.1238+18G>A, ADAMTS2(NM_014244.5):c.1238+18G>A - ADAMTS2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1281C>T r.(?) p.(Asp427=) - - Unknown - benign g.178581151G>A g.179154150G>A ADAMTS2(NM_014244.4):c.1281C>T (p.D427=) - ADAMTS2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1308G>A r.(?) p.(Ala436=) - - Unknown - likely benign g.178581124C>T g.179154123C>T ADAMTS2(NM_014244.4):c.1308G>A (p.A436=) - ADAMTS2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1458C>T r.(?) p.(Tyr486=) - - Unknown - benign g.178580549G>A g.179153548G>A ADAMTS2(NM_014244.4):c.1458C>T (p.Y486=) - ADAMTS2_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1488C>T r.(?) p.(Phe496=) - - Unknown - likely benign g.178580519G>A g.179153518G>A ADAMTS2(NM_014244.4):c.1488C>T (p.F496=) - ADAMTS2_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1488C>T r.(?) p.(Phe496=) - - Unknown - likely benign g.178580519G>A g.179153518G>A ADAMTS2(NM_014244.4):c.1488C>T (p.F496=) - ADAMTS2_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1515+18C>T r.(=) p.(=) - - Unknown - likely benign g.178580474G>A g.179153473G>A ADAMTS2(NM_014244.4):c.1515+18C>T - ADAMTS2_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1629+9G>A r.(=) p.(=) - - Unknown - benign g.178579134C>T g.179152133C>T ADAMTS2(NM_014244.4):c.1629+9G>A - ADAMTS2_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1630-18T>C r.(=) p.(=) - - Unknown - benign g.178567054A>G g.179140053A>G ADAMTS2(NM_014244.4):c.1630-18T>C, ADAMTS2(NM_014244.5):c.1630-18T>C - ADAMTS2_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1630-18T>C r.(=) p.(=) - - Unknown - benign g.178567054A>G g.179140053A>G ADAMTS2(NM_014244.4):c.1630-18T>C, ADAMTS2(NM_014244.5):c.1630-18T>C - ADAMTS2_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1803G>A r.(?) p.(Ser601=) - - Unknown - benign g.178564918C>T g.179137917C>T ADAMTS2(NM_014244.4):c.1803G>A (p.S601=) - ADAMTS2_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1908C>T r.(?) p.(His636=) - - Unknown - benign g.178564813G>A g.179137812G>A ADAMTS2(NM_014244.4):c.1908C>T (p.H636=) - ADAMTS2_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1993G>A r.(?) p.(Gly665Arg) - - Unknown - benign g.178563002C>T g.179136001C>T ADAMTS2(NM_014244.4):c.1993G>A (p.G665R) - ADAMTS2_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.2015G>T r.(?) p.(Arg672Leu) - - Parent #1 - VUS g.178562980C>A g.179135979C>A - - ADAMTS2_000055 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs200806292 Germline - 1/2794 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 1 Mohammed Faruq
-/. - c.2028C>T r.(?) p.(Asp676=) - - Unknown - benign g.178562967G>A g.179135966G>A ADAMTS2(NM_014244.4):c.2028C>T (p.D676=) - ADAMTS2_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/+ 14_16 c.2085+1422_2458-478delinsTCC r.? - deletion, multi exon delins Paternal (confirmed) - pathogenic g.178555597_178561488delinsGGA - - - ADAMTS2_000004 - PubMed: Colige et al., 2004 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS P8 PubMed: Colige et al., 2004 This patient was subsequently described by {PMID15389701:Malfait et al., 2004}.The exact boundaries of the maternal deletion were not determined. - - - white - 0 - - 1 Raymond Dalgleish
?/. 14 c.2208T>C r.? p.? silent - Unknown - VUS g.178559779A>G g.179132778A>G - - ADAMTS2_000080 - - - - Unknown - - - 0 - ? ? saliva sample - EDS - Invitae Diagnostic Testing - F - United States Hispanic, white - - - - 1 Annette Cherry
-?/. - c.2267T>C r.(?) p.(Val756Ala) - - Unknown - likely benign g.178559254A>G g.179132253A>G ADAMTS2(NM_014244.4):c.2267T>C (p.V756A) - ADAMTS2_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2272G>A r.(?) p.(Ala758Thr) - - Unknown - likely benign g.178559249C>T g.179132248C>T ADAMTS2(NM_014244.4):c.2272G>A (p.A758T) - ADAMTS2_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2291-8A>G r.(=) p.(=) - - Unknown - benign g.178557107T>C g.179130106T>C ADAMTS2(NM_014244.4):c.2291-8A>G - ADAMTS2_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/+ 16 c.2384G>A r.(?) p.(Trp795*) nonsense substitution Both (homozygous) - pathogenic g.178557006C>T - - - ADAMTS2_000001 - PubMed: Colige et al., 1999 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS Patient 1 PubMed: Colige et al., 1999 This patient was previously descibed by {PMID1303238:Nusgens et al., 1992} and subsequently by {PMID15389701:Malfait et al., 2004} and in {PMID17118335:De Coster et al., 2006} - - - white - 0 - - 1 Raymond Dalgleish
+/+ 17 c.2458-6_2458del r.spl - splicing affected, exon skipped deletion Both (homozygous) - pathogenic g.178555119_178555125del - - - ADAMTS2_000006 - PubMed: Solomons et al., 2013 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS - PubMed: Solomons et al., 2013 The parents of this patient are first cousins with no family history of the disease. - - Pakistan Pakistani - 0 - - 1 Raymond Dalgleish
-/. - c.2480G>A r.(?) p.(Arg827Gln) - - Unknown - benign g.178555097C>T g.179128096C>T ADAMTS2(NM_014244.4):c.2480G>A (p.R827Q) - ADAMTS2_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2480G>A r.(?) p.(Arg827Gln) - - Parent #1 - likely benign g.178555097C>T g.179128096C>T - - ADAMTS2_000070 28 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs35445112 Germline - 28/2794 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 28 Mohammed Faruq
-/. - c.2532C>T r.(?) p.(Asp844=) - - Unknown - benign g.178555045G>A g.179128044G>A ADAMTS2(NM_014244.4):c.2532C>T (p.D844=) - ADAMTS2_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2618-20G>A r.(=) p.(=) - - Unknown - likely benign g.178553151C>T g.179126150C>T ADAMTS2(NM_014244.4):c.2618-20G>A - ADAMTS2_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2705A>G r.(?) p.(Lys902Arg) - - Unknown - VUS g.178553044T>C g.179126043T>C ADAMTS2(NM_014244.4):c.2705A>G (p.K902R) - ADAMTS2_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.2730A>G r.(?) p.(Pro910=) - - Unknown - benign g.178553019T>C g.179126018T>C ADAMTS2(NM_014244.4):c.2730A>G (p.P910=) - ADAMTS2_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/+ 19 c.2751-2A>T r.spl - splicing affected? substitution Both (homozygous) - pathogenic g.178552183T>A - - - ADAMTS2_000011 - PubMed: Van Damme et al., 2016 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS - PubMed: Van Damme et al., 2016 - - - - - - 0 - - 1 Sofie Symoens
-?/. - c.2795G>A r.(?) p.(Arg932Gln) - - Unknown - likely benign g.178552137C>T g.179125136C>T ADAMTS2(NM_014244.4):c.2795G>A (p.R932Q) - ADAMTS2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2795G>A r.(?) p.(Arg932Gln) - - Unknown - likely benign g.178552137C>T g.179125136C>T ADAMTS2(NM_014244.4):c.2795G>A (p.R932Q) - ADAMTS2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 19 c.2927_2928del r.(?) p.(Pro976Argfs42*) frameshift deletion Both (homozygous) - pathogenic g.178552004_178552005del - - - ADAMTS2_000007 - PubMed: Van Damme et al., 2016 - - Unknown - - - 0 - DNA PCR, SEQ - - EDS, EDSDERMS - PubMed: Van Damme et al., 2016 - - - - - - 0 - - 1 Sofie Symoens
-?/. - c.2958+430A>G r.(=) p.(=) - - Unknown - likely benign g.178551544T>C g.179124543T>C ADAMTS2(NM_014244.4):c.2958+430A>G - ADAMTS2_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2958+675A>C r.(=) p.(=) - - Both (homozygous) - VUS g.178551299T>G g.179124298T>G - - ADAMTS2_000061 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. - c.2959-17C>T r.(=) p.(=) - - Unknown - benign g.178549791G>A g.179122790G>A ADAMTS2(NM_014244.4):c.2959-17C>T, ADAMTS2(NM_014244.5):c.2959-17C>T - ADAMTS2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.2959-17C>T r.(=) p.(=) - - Unknown - benign g.178549791G>A g.179122790G>A ADAMTS2(NM_014244.4):c.2959-17C>T, ADAMTS2(NM_014244.5):c.2959-17C>T - ADAMTS2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2959-16G>A r.(=) p.(=) - - Unknown - likely benign g.178549790C>T g.179122789C>T ADAMTS2(NM_014244.4):c.2959-16G>A - ADAMTS2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/- 20 c.3028G>A r.(?) p.(Gly1010Ser) missense substitution Unknown - likely benign g.178549705C>T - - - ADAMTS2_000015 - PubMed: Chen et al., 2020 - rs368690576 Unknown - - - 0 - DNA SEQ-NG - - ? - PubMed: Chen et al., 2020 This deleterious SNP is highly associated with intracranial aneurysms. The technique used was whole exome sequencing. The technique used was whole genome sequencing. - - China Han Chinese - 0 - - 1 Raymond Dalgleish
-/- 21 c.3155C>A r.(?) p.(Ser1052*) nonsense substitution Unknown - likely benign g.178548685G>T - - - ADAMTS2_000017 - PubMed: van der Wekken et al., 2017 - - Unknown - - - 0 - DNA SEQ-NG - - ? Patient 4 PubMed: van der Wekken et al., 2017 This variant is associated with afatinib-resistance in non-small cell lung carcinoma (NSCLC) patients that have been previously treated with geftinib or erlotinib, and subsequently with afatinib. The variant has a CADD score of 40, and is highly deleterious.The technique used was whole exome sequencing. - - - - - 0 - - 1 Raymond Dalgleish
-/. - c.3279T>C r.(?) p.(Cys1093=) - - Unknown - benign g.178541225A>G g.179114224A>G ADAMTS2(NM_014244.4):c.3279T>C (p.C1093=) - ADAMTS2_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.3342C>T r.(?) p.(Asn1114=) - - Unknown - likely benign g.178541162G>A - ADAMTS2(NM_014244.4):c.3342C>T (p.N1114=) - ADAMTS2_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.3480C>A r.(?) p.(Ala1160=) - - Unknown - benign g.178541024G>T g.179114023G>T ADAMTS2(NM_014244.4):c.3480C>A (p.A1160=) - ADAMTS2_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3529C>T r.(?) p.(Pro1177Ser) - - Unknown - benign g.178540975G>A g.179113974G>A ADAMTS2(NM_014244.4):c.3529C>T (p.P1177S), ADAMTS2(NM_014244.5):c.3529C>T (p.P1177S) - ADAMTS2_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3529C>T r.(?) p.(Pro1177Ser) - - Unknown - benign g.178540975G>A g.179113974G>A ADAMTS2(NM_014244.4):c.3529C>T (p.P1177S), ADAMTS2(NM_014244.5):c.3529C>T (p.P1177S) - ADAMTS2_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
Legend   How to query