Full data view for gene ATOH7

Information The variants shown are described using the NM_145178.3 transcript reference sequence.

32 entries on 1 page. Showing entries 1 - 32.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+?/. - - r.? p.? Both (homozygous) - likely pathogenic (recessive) g.70007125_70013647del g.68247368_68253890del ATOH7 6523bp deletion - ATOH7_000014 ATOH7 6523bp deletion that spans a remote cis regulatory element 20 kb upstream from ATOH7 (Math5), a bHLH transcription factor gene required for retinal ganglion cell (RGC) and optic nerve development; variant calculated from sequence Fig.4; shadow enhancer deletion affecting expression PubMed: Ghiasvand 2011 - - Germline yes - - - - DNA PCR - - EVR;FEVR 10877 PubMed: Ghiasvand 2011 9 generation consanguineous family, 42 affected ? ? Iran Kurdish (Iranian) ? - - - 42 Jasmine Chen
+/. - c.? r.? p.? Both (homozygous) - pathogenic g.? - 6523-bp deletion - CYP2C9_001038 - PubMed: Keser 2017 - - Germline yes - - - - DNA arraySNP, SEQ-NG - gene panel retinal disease NCRNA5 PubMed: Keser 2017 - - - Pakistan - - - - - 1 LOVD
+/. - c.? r.? p.? Both (homozygous) - pathogenic g.? - 6523-bp deletion - CYP2C9_001038 - PubMed: Keser 2017 - - Germline yes - - - - DNA arraySNP, SEQ-NG - gene panel retinal disease NCRNA6 PubMed: Keser 2017 - - - Pakistan - - - - - 1 LOVD
?/. - c.8C>T r.(?) p.(Ser3Phe) Unknown - VUS g.69991427G>A - ATOH7(NM_145178.3):c.8C>T (p.S3F), ATOH7(NM_145178.4):c.8C>T (p.(Ser3Phe)) - ATOH7_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.8C>T r.(?) p.(Ser3Phe) Unknown - VUS g.69991427G>A - ATOH7(NM_145178.3):c.8C>T (p.S3F), ATOH7(NM_145178.4):c.8C>T (p.(Ser3Phe)) - ATOH7_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.16C>A r.(?) p.(Pro6Thr) Unknown - likely benign g.69991419G>T g.68231662G>T ATOH7(NM_145178.3):c.16C>A (p.(Pro6Thr)) - ATOH7_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.53del r.(?) p.(Pro18Argfs*69) Both (homozygous) - likely pathogenic (recessive) g.69991386del g.68231629del 53delC - ATOH7_000004 - PubMed: Khan 2011 - - Germline yes - - - - DNA PCR, SEQ - direct sequencing EVR;FEVR NE1 F475 PubMed: Khan 2011 4 generation family, 2 affected M yes Turkey - - - - - 2 Jasmine Chen
?/. - c.64_81del r.(?) p.(Gly22_Gly27del) Unknown - VUS g.69991364_69991381del - ATOH7(NM_145178.4):c.64_81del (p.(Gly22_Gly27del)) - ATOH7_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.94del r.(?) p.(Ala32ProfsTer55) Both (homozygous) ACMG likely pathogenic (recessive) g.69991344del g.68231587del - - ATOH7_000017 ACMG PVS1, PM2 PubMed: Basharat 2024 - - Germline yes - - - - DNA SEQ, SEQ-NG - smMIPs, WGS ? FamBPatVI3 PubMed: Basharat 2024 6-generation family, 6 affected (2F, 4M) F yes Pakistan - - - - - 6 Rabia Basharat
+?/. - c.94del r.(?) p.(Ala32ProfsTer55) Both (homozygous) ACMG likely pathogenic (recessive) g.69991344del g.68231587del - - ATOH7_000017 ACMG PVS1, PM2 PubMed: Basharat 2024 - - Germline yes - - - - DNA SEQ, SEQ-NG - smMIPs, WGS ? FamBPatVI4 PubMed: Basharat 2024 brother M yes Pakistan - - - - - 1 Rabia Basharat
+?/. - c.94del r.(?) p.(Ala32ProfsTer55) Both (homozygous) ACMG likely pathogenic (recessive) g.69991344del g.68231587del - - ATOH7_000017 ACMG PVS1, PM2 PubMed: Basharat 2024 - - Germline yes - - - - DNA SEQ, SEQ-NG - smMIPs, WGS ? FamBPatVI5 PubMed: Basharat 2024 niece F yes Pakistan - - - - - 1 Rabia Basharat
+?/. - c.121_144del r.(?) p.(Arg41_Arg48del) Both (homozygous) - likely pathogenic (recessive) g.69991297_69991320del g.68231540_68231563del 106_129del, 121_144delAGGCGCCTGGCGGCCAACGCGCGC - ATOH7_000005 - PubMed: Kondo 2016, correction in PubMed: Kondo 2018 - rs10529471 Germline yes - - - - DNA PCR, SEQ - direct sequencing EVR;FEVR 7101 PubMed: Kondo 2016 2 generation family, 1 affected M no Japan - - - - lensectomy 1 Jasmine Chen
+?/. - c.121_144del r.(?) p.(Arg41_Arg48del) Parent #1 - likely pathogenic (recessive) g.69991297_69991320del g.68231540_68231563del 106_129del, 121_144delAGGCGCCTGGCGGCCAACGCGCGC - ATOH7_000005 - PubMed: Kondo 2016, correction in PubMed: Kondo 2018 - rs10529471 Germline ? - - - - DNA PCR, SEQ - direct sequencing EVR;FEVR 12001 PubMed: Kondo 2016 sporadic F ? Japan - - - - - 1 Jasmine Chen
+?/. - c.121_144del r.(?) p.(Arg41_Arg48del) Paternal (inferred) - likely pathogenic (recessive) g.69991297_69991320del g.68231540_68231563del 106_129del, 121_144delAGGCGCCTGGCGGCCAACGCGCGC - ATOH7_000005 - PubMed: Kondo 2016, correction in PubMed: Kondo 2018 - rs10529471 Germline no - - - - DNA PCR, SEQ - direct sequencing EVR;FEVR 15402 PubMed: Kondo 2016 2 generation family, 2 affected (F, M), unaffected heterozygous carrier father F no Japan - - - - - 2 Jasmine Chen
+?/. - c.125G>C r.(?) p.(Arg42Pro) Both (homozygous) - likely pathogenic g.69991310C>G g.68231553C>G G125C - ATOH7_000013 - PubMed: Keser 2017 - - Germline yes - - - - DNA arraySNP, SEQ-NG - gene panel retinal disease NCRNA4 PubMed: Keser 2017 - - - Pakistan - - - - - 1 LOVD
+/. - c.136A>C r.(?) p.(Asn46His) Both (homozygous) - pathogenic (recessive) g.69991299T>G g.68231542T>G - - ATOH7_000008 - PubMed: Prasov 2012 - - Germline yes 0/72 controls - - - DNA PCR - - PHPVAR PHPV Patient V-5 PubMed: Prasov 2012 6 generation family, 5 affected (previously reported in PubMed: Khaliq 2011) - yes Pakistan - - - - - 5 Jasmine Chen
+/. - c.139G>A r.(?) p.(Ala47Thr) Unknown - likely pathogenic g.69991296C>T - - - ATOH7_000011 obsolete nycleotide annotation; heterozygous ATOH7 g.560G>A; p.(Ala47Thr) - rs3858145 Unknown - - - - - DNA PCR - - hypoplasia, optic nerve, bilateral ONH Patient 2 PubMed: Macgregor 2010PubMed: Prasov 2012 originally described in McGregor ? ? United Kingdom (Great Britain) - - - - - 1 Jasmine Chen
+/. - c.146A>T r.(?) p.(Glu49Val) Both (homozygous) - pathogenic (recessive) g.69991289T>A g.68231532T>A c.146G>T; p.E49V - ATOH7_000003 - PubMed: Khan 2011 - - Germline yes - - - - DNA SEQ-NG-I - exome sequencing EVR;FEVR MEP57 2298 PubMed: Khan 2011 4 generation family, consanguineous, 5 affected M yes Pakistan - - - - - 5 Jasmine Chen
+?/. - c.175G>A r.(?) p.(Ala59Thr) Maternal (confirmed) - likely pathogenic g.69991260C>T g.68231503C>T ATOH7 c.175G>A; p.(Ala59Thr) - ATOH7_000016 heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression PubMed: Atac 2020 - - Germline yes - - - - DNA SEQ-NG-S, SEQ - whole-exome sequencing retinal disease 72005 PubMed: Atac 2020 sibling of 71953 F - - - - - - - 1 LOVD
+?/. - c.175G>A r.(?) p.(Ala59Thr) Maternal (confirmed) - likely pathogenic g.69991260C>T g.68231503C>T ATOH7 c.175G>A; p.(Ala59Thr) - ATOH7_000016 heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression PubMed: Atac 2020 - - Germline yes - - - - DNA SEQ-NG-S, SEQ - whole-exome sequencing retinal disease 71953 PubMed: Atac 2020 sibling of 72005 F - - - - - - - 1 LOVD
+?/. - c.176C>T r.(?) p.(Ala59Val) Unknown - likely pathogenic g.69991259G>A g.68231502G>A ATOH7 c.176C>T; p.(Ala59Val) - ATOH7_000015 heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression PubMed: Atac 2020 - - Germline yes - - - - DNA SEQ-NG-S, SEQ - whole-exome sequencing retinal disease 71965 PubMed: Atac 2020 father of 72005 and 71953 M - - - - - - - 1 LOVD
+?/. - c.176C>T r.(?) p.(Ala59Val) Paternal (confirmed) - likely pathogenic g.69991259G>A g.68231502G>A ATOH7 c.176C>T; p.(Ala59Val) - ATOH7_000015 heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression PubMed: Atac 2020 - - Germline yes - - - - DNA SEQ-NG-S, SEQ - whole-exome sequencing retinal disease 72005 PubMed: Atac 2020 sibling of 71953 F - - - - - - - 1 LOVD
+?/. - c.176C>T r.(?) p.(Ala59Val) Paternal (confirmed) - likely pathogenic g.69991259G>A g.68231502G>A ATOH7 c.176C>T; p.(Ala59Val) - ATOH7_000015 heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression PubMed: Atac 2020 - - Germline yes - - - - DNA SEQ-NG-S, SEQ - whole-exome sequencing retinal disease 71953 PubMed: Atac 2020 sibling of 72005 F - - - - - - - 1 LOVD
?/. - c.184C>A r.(?) p.(Arg62Ser) Unknown - VUS g.69991251G>T - ATOH7(NM_145178.4):c.184C>A (p.(Arg62Ser)) - ATOH7_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.193A>G r.(?) p.(Arg65Gly) Parent #1 - likely benign g.69991242T>C g.68231485T>C - - ATOH7_000007 - PubMed: Prasov 2012 - - Unknown ? 20/2190 chromosomes (1000 Genomes) - - - DNA SEQ-NG-I - direct sequencing ID, hypoplasia, optic nerve, bilateral ONA Patient 1 PubMed: Prasov 2012 2 generation family, 1 affected - optic nerve aplasia F no - - - - - - 1 Jasmine Chen
+?/. - c.193A>G r.(?) p.(Arg65Gly) Unknown - likely pathogenic g.69991242T>C g.68231485T>C ATOH7 g.614A>G; p.(Arg65Gly) - ATOH7_000007 obsolete nycleotide annotation; heterozygous PubMed: Macgregor 2010 - - Unknown ? - - - - DNA arraySNP, SEQ - - retinal disease ? PubMed: Macgregor 2010 - - - - - - - - - 1 LOVD
?/. - c.206A>G r.(?) p.(Gln69Arg) Unknown - VUS g.69991229T>C g.68231472T>C ATOH7(NM_145178.3):c.206A>G (p.Q69R) - ATOH7_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.213C>A r.(?) p.(Gly71=) Parent #1 - likely benign g.69991222G>T g.68231465G>T - - ATOH7_000021 - PubMed: Garcia-Montalvo 2014 - - Germline - several MAC cases - - - DNA SEQ - - MCOP patients PubMed: Garcia-Montalvo 2014 - - - Mexico - - - - - 2 Johan den Dunnen
-?/. - c.258G>A r.(?) p.(Leu86=) Unknown - likely benign g.69991177C>T g.68231420C>T - - ATOH7_000022 - PubMed: Garcia-Montalvo 2014 - - Germline - - - - - DNA SEQ - - MCOP patients PubMed: Garcia-Montalvo 2014 - - - Mexico - - - - - 2 Johan den Dunnen
?/. - c.271_272delinsAT r.(?) p.(Ala91Ile) Unknown - VUS g.69991163_69991164delinsAT - ATOH7(NM_145178.4):c.271_272delinsAT (p.(Ala91Ile)) - ATOH7_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.396G>A r.(?) p.(Glu132=) Unknown - likely benign g.69991039C>T g.68231282C>T ATOH7(NM_145178.3):c.396G>A (p.E132=) - ATOH7_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.400G>T r.(?) p.(Glu134*) Parent #1 - likely pathogenic g.69991035C>A g.68231278C>A - - ATOH7_000006 - PubMed: Kondo 2016 - - Germline no - - - - DNA PCR - direct sequencing EVR;FEVR 14501 PubMed: Kondo 2016 sporadic M ? Japan - - - - - 1 Jasmine Chen
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.