Full data view for gene ATXN2

A Parkinson's disease Mutation Database
Information The variants shown are described using the NM_002973.3 transcript reference sequence.

82 entries on 1 page. Showing entries 1 - 82.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

Haplotype     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/. - c.30T>C - r.(?) p.(Ser10=) Unknown - likely benign g.112037289A>G - ATXN2(NM_002973.3):c.30T>C (p.S10=) - ATXN2_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.46G>C - r.(?) p.(Glu16Gln) Unknown - likely benign g.112037273C>G g.111599469C>G ATXN2(NM_002973.3):c.46G>C (p.E16Q) - ATXN2_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.199C>T - r.(?) p.(Gln67Ter) Unknown - VUS g.112037120G>A g.111599316G>A ATXN2(NM_002973.3):c.199C>T (p.Q67*) - ATXN2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.244A>G - r.(?) p.(Asn82Asp) Unknown - likely benign g.112037075T>C g.111599271T>C ATXN2(NM_002973.3):c.244A>G (p.N82D) - ATXN2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.319C>G - r.(?) p.(Leu107Val) Unknown - benign g.112037000G>C g.111599196G>C ATXN2(NM_002973.3):c.319C>G (p.L107V) - ATXN2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.319C>G - r.(?) p.(Leu107Val) Unknown - benign g.112037000G>C g.111599196G>C ATXN2(NM_002973.3):c.319C>G (p.L107V) - ATXN2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.340C>T - r.(?) p.(Pro114Ser) Unknown - likely benign g.112036979G>A - ATXN2(NM_002973.3):c.340C>T (p.P114S) - ATXN2_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.341C>T - r.(?) p.(Pro114Leu) Unknown - likely benign g.112036978G>A - ATXN2(NM_002973.3):c.341C>T (p.P114L) - ATXN2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.390C>T - r.(?) p.(Arg130=) Unknown - benign g.112036929G>A g.111599125G>A ATXN2(NM_002973.3):c.390C>T (p.R130=) - ATXN2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.390C>T - r.(?) p.(Arg130=) Unknown - benign g.112036929G>A g.111599125G>A ATXN2(NM_002973.3):c.390C>T (p.R130=) - ATXN2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.403C>A - r.(?) p.(Arg135Ser) Unknown - VUS g.112036916G>T - ATXN2(NM_002973.3):c.403C>A (p.R135S) - ATXN2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.488T>C - r.(?) p.(Leu163Pro) Unknown - likely benign g.112036831A>G g.111599027A>G ATXN2(NM_002973.3):c.488T>C (p.L163P) - ATXN2_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.519G>A - r.(?) p.(Gln173=) Unknown - likely benign g.112036800C>T g.111598996C>T ATXN2(NM_002973.3):c.519G>A (p.Q173=) - ATXN2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. 1 c.521_522ins537_551;537_538ins[523_551;ACAG] Gln[39] 8-1-4-1-4-1-9-1-10 r.(?) p.(Gln173_Gln188dup) Parent #1 - pathogenic g.112036781_112036782ins[CTGT;112036768_112036796];112036797_112036798ins112036768_112036782 - - - ATXN2_000003 - PubMed: Charles 2007 - - Germline yes - - 0 - DNA PCR, SEQ - - PD 17568014-FamSAL-722 PubMed: Charles 2007 3-generation family, 8 affecteds (3F, 5M) F;M no France - - 0 - - 8 Johan den Dunnen
+/. 1 c.521_522ins537_551;540_541ins[526_551;A] Gln[37] 8-1-9-1-4-1-4-1-8 r.(?) p.(Gln175_Gln188dup) Parent #1 - pathogenic g.112036778_112036779ins[TT;112036754_112036793];112036797_112036798ins112036768_112036782 - - - ATXN2_000002 - PubMed: Charles 2007 - - Germline yes - - 0 - DNA PCR, SEQ - - PD 17568014-FamSAL-755 PubMed: Charles 2007 4-generation family, 4 affecteds (3F, M) F;M no France - - 0 - - 4 Johan den Dunnen
-/. - c.522G>A - r.(?) p.(Gln174=) Unknown - benign g.112036797C>T g.111598993C>T ATXN2(NM_002973.3):c.522G>A (p.Q174=) - ATXN2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.522G>A - r.(?) p.(Gln174=) Unknown - likely benign g.112036797C>T g.111598993C>T ATXN2(NM_002973.3):c.522G>A (p.Q174=) - ATXN2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. 1 c.522G>A;540_541ins[526_565;AA] Gln[37] 8-1-9-1-4-1-4-1-8 r.(?) p.(Gln175_Gln188dup) Parent #1 - pathogenic g.112036778_112036779ins[TT;112036754_112036793];112036797C>T - - - ATXN2_000001 - PubMed: Charles 2007 - - Germline yes - - 0 - DNA PCR, SEQ - - PD 17568014-FamFPD-116 PubMed: Charles 2007 3-generation family, 2 affecteds (2M) and 1 possibly affeted (M) M no France - - 0 - - 2 Johan den Dunnen
-?/. 1 c.522G>A;551_552ins523_540 Gln[29] 8-1-4-1-4-1-10 r.(?) p.(Gln183_Gln188dup) Maternal (inferred) - likely benign g.112036767_112036768ins112036779_112036796;112036797C>T - - - ATXN2_000007 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN22 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
-/. 1 c.522G>A;551_552ins526_537 Gln[27] 8-1-4-1-4-1-8 r.(?) p.(Gln185_Gln188dup) Maternal (inferred) - likely benign g.112036767_112036768ins112036782_112036793;112036797C>T - - - ATXN2_000006 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN11 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
-/. 1 c.522G>A;551_552ins526_537 Gln[27] 8-1-4-1-4-1-8 r.(?) p.(Gln185_Gln188dup) Maternal (inferred) - likely benign g.112036767_112036768ins112036782_112036793;112036797C>T - - - ATXN2_000006 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN12 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
-/. 1 c.522G>A;551_552ins526_537 Gln[27] 8-1-4-1-4-1-8 r.(?) p.(Gln185_Gln188dup) Maternal (inferred) - likely benign g.112036767_112036768ins112036782_112036793;112036797C>T - - - ATXN2_000006 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN13 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
-/. 1 c.522G>A;551_552ins526_537 Gln[27] 8-1-4-1-4-1-8 r.(?) p.(Gln185_Gln188dup) Maternal (inferred) - likely benign g.112036767_112036768ins112036782_112036793;112036797C>T - - - ATXN2_000006 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN14 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
-/. 1 c.522G>A;551_552ins526_537 Gln[27] 8-1-4-1-4-1-8 r.(?) p.(Gln185_Gln188dup) Maternal (inferred) - likely benign g.112036767_112036768ins112036782_112036793;112036797C>T - - - ATXN2_000006 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN15 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
-/. 1 c.522G>A;551_552ins526_537 Gln[27] 8-1-4-1-4-1-8 r.(?) p.(Gln185_Gln188dup) Maternal (inferred) - likely benign g.112036767_112036768ins112036782_112036793;112036797C>T - - - ATXN2_000006 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN16 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
-?/. 1 c.522G>A;563_564ins514_537 Gln[30] 21-1-8 r.(?) p.(Gln182_Gln188dup) Maternal (inferred) - likely benign g.112036755_112036756ins112036782_112036805;112036797C>T - - - ATXN2_000008 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN23 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
-?/. 1 c.522G>A;565_566ins511_537 Gln[32] 13-1-8-1-9 r.(?) p.(Gln180_Gln188dup) Maternal (inferred) - likely benign g.112036753_112036754ins112036782_112036808;112036797C>T - - - ATXN2_000009 - PubMed: Yu 2011, Journal: Yu 2011 - - Germline - - - 0 - DNA PCR, SEQ - - - 21479228_ConN24 PubMed: Yu 2011, Journal: Yu 2011 - - - United States - - 0 - - 1 Johan den Dunnen
+/. 1 c.536_537insGC;537_538ins498_534 Gln[36] 36 r.(?) p.(Gln176_Gln188dup) Paternal (inferred) - pathogenic g.112036781_112036782ins112036785_112036821;112036782_112036783insGC - CAG[36] - ATXN2_000004 - PubMed: Gwinn-Hardy 2000 - - Germline yes - - 0 - DNA PCR - - PD 10993999-FamPat3004 PubMed: Gwinn-Hardy 2000 5-generation family, 9 affecteds (2F, 7M) M no Taiwan Chinese - 0 - - 9 Johan den Dunnen
-/. - c.537A>G - r.(?) p.(Gln179=) Unknown - benign g.112036782T>C g.111598978T>C ATXN2(NM_002973.3):c.537A>G (p.Q179=) - ATXN2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.537A>G - r.(?) p.(Gln179=) Unknown - likely benign g.112036782T>C g.111598978T>C ATXN2(NM_002973.3):c.537A>G (p.Q179=) - ATXN2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. 1 c.537_539del Gln[22] 22 r.(?) p.(Gln188del) Maternal (inferred) - benign g.112036782_112036784del g.111598978_111598980del CAG[22] - ATXN2_000005 - PubMed: Gwinn-Hardy 2000 - - Germline no - - 0 - DNA PCR - - PD 10993999-FamPat3004 PubMed: Gwinn-Hardy 2000 5-generation family, 9 affecteds (2F, 7M) M no Taiwan Chinese - 0 - - 9 Johan den Dunnen
-/. - c.537_539del - r.(?) p.(Gln188del) Unknown - benign g.112036782_112036784del g.111598978_111598980del ATXN2(NM_002973.3):c.537_539delACA (p.Q188del) - ATXN2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.540G>A - r.(?) p.(Gln180=) Unknown - likely benign g.112036779C>T g.111598975C>T ATXN2(NM_002973.3):c.540G>A (p.Q180=) - ATXN2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.542_543insACA - r.(?) p.(Gln188dup) Unknown - likely benign g.112036778_112036779insTTG g.111598974_111598975insTTG ATXN2(NM_002973.3):c.542_543insACA (p.Q188dup) - ATXN2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.563_565del - r.(?) p.(Gln188del) Unknown - benign g.112036779_112036781del g.111598975_111598977del ATXN2(NM_002973.3):c.563_565delAGC (p.Q188del) - ATXN2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.563_565del - r.(?) p.(Gln188del) Unknown - likely benign g.112036779_112036781del g.111598975_111598977del ATXN2(NM_002973.3):c.563_565delAGC (p.Q188del) - ATXN2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.624C>A - r.(?) p.(Pro208=) Unknown - likely benign g.112036695G>T g.111598891G>T ATXN2(NM_002973.3):c.624C>A (p.P208=) - ATXN2_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.769-11del - r.(=) p.(=) Unknown - benign g.111992045del g.111554241del ATXN2(NM_002973.3):c.769-11delT - ATXN2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.769-11del - r.(=) p.(=) Unknown - likely benign g.111992045del g.111554241del ATXN2(NM_002973.3):c.769-11delT - ATXN2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.769-11dup - r.(=) p.(=) Unknown - benign g.111992045dup g.111554241dup ATXN2(NM_002973.3):c.769-11dupT, ATXN2(NM_002973.4):c.289-11dupT - ATXN2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.769-11dup - r.(=) p.(=) Unknown - benign g.111992045dup g.111554241dup ATXN2(NM_002973.3):c.769-11dupT, ATXN2(NM_002973.4):c.289-11dupT - ATXN2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.769-11dup - r.(=) p.(=) Unknown - benign g.111992045dup g.111554241dup ATXN2(NM_002973.3):c.769-11dupT, ATXN2(NM_002973.4):c.289-11dupT - ATXN2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1123G>A - r.(?) p.(Asp375Asn) Unknown - likely benign g.111963049C>T g.111525245C>T ATXN2(NM_002973.3):c.1123G>A (p.D375N) - ATXN2_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1176+3A>T - r.spl? p.? Unknown - VUS g.111962993T>A g.111525189T>A - - ATXN2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1472A>G - r.(?) p.(Asn491Ser) Unknown - VUS g.111956226T>C - ATXN2(NM_002973.3):c.1472A>G (p.N491S) - ATXN2_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1751C>T - r.(?) p.(Pro584Leu) Unknown - VUS g.111954062G>A g.111516258G>A ATXN2(NM_002973.3):c.1751C>T (p.P584L) - ATXN2_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2105C>G - r.(?) p.(Pro702Arg) Unknown - VUS g.111948320G>C g.111510516G>C ATXN2(NM_002973.3):c.2105C>G (p.P702R) - ATXN2_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2119C>T - r.(?) p.(Leu707Phe) Unknown - likely benign g.111948306G>A g.111510502G>A ATXN2(NM_002973.4):c.1639C>T (p.L547F) - ATXN2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2149A>G - r.(?) p.(Thr717Ala) Unknown - likely benign g.111948276T>C g.111510472T>C ATXN2(NM_002973.3):c.2149A>G (p.T717A) - ATXN2_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2294A>G - r.(?) p.(Asn765Ser) Unknown - VUS g.111947745T>C - ATXN2(NM_002973.3):c.2294A>G (p.N765S) - ATXN2_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2586C>A - r.(?) p.(Pro862=) Unknown - likely benign g.111926414G>T g.111488610G>T ATXN2(NM_002973.3):c.2586C>A (p.P862=) - ATXN2_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2686A>G - r.(?) p.(Lys896Glu) Unknown - VUS g.111926314T>C - ATXN2(NM_002973.3):c.2686A>G (p.K896E) - ATXN2_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2691C>T - r.(?) p.(Asp897=) Unknown - likely benign g.111926309G>A g.111488505G>A ATXN2(NM_002973.3):c.2691C>T (p.D897=) - ATXN2_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2860C>T - r.(?) p.(Pro954Ser) Unknown - VUS g.111923594G>A g.111485790G>A ATXN2(NM_002973.3):c.2860C>T (p.P954S) - ATXN2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2937+62C>T - r.(=) p.(=) Unknown - likely benign g.111923455G>A g.111485651G>A ATXN2(NM_002973.4):c.2457+62C>T - ATXN2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3000A>G - r.(?) p.(Val1000=) Unknown - likely benign g.111908545T>C g.111470741T>C ATXN2(NM_002973.3):c.3000A>G (p.V1000=) - ATXN2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.3247G>A - r.(?) p.(Ala1083Thr) Unknown - VUS g.111907981C>T - ATXN2(NM_002973.3):c.3247G>A (p.A1083T) - ATXN2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.3322C>T - r.(?) p.(Pro1108Ser) Unknown - likely benign g.111902514G>A g.111464710G>A ATXN2(NM_002973.3):c.3322C>T (p.P1108S), ATXN2(NM_002973.4):c.2842C>T (p.P948S) - ATXN2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3322C>T - r.(?) p.(Pro1108Ser) Unknown - VUS g.111902514G>A - ATXN2(NM_002973.3):c.3322C>T (p.P1108S), ATXN2(NM_002973.4):c.2842C>T (p.P948S) - ATXN2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.3412G>A - r.(?) p.(Ala1138Thr) Unknown - VUS g.111895122C>T - ATXN2(NM_002973.3):c.3412G>A (p.A1138T) - ATXN2_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.3472C>T - r.(?) p.(Gln1158Ter) Unknown - VUS g.111895062G>A g.111457258G>A - - ATXN2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3517-12G>A - r.(=) p.(=) Unknown - benign g.111894072C>T g.111456268C>T ATXN2(NM_002973.3):c.3517-12G>A - ATXN2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3517-12G>A - r.(=) p.(=) Unknown - likely benign g.111894072C>T g.111456268C>T ATXN2(NM_002973.3):c.3517-12G>A - ATXN2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3593T>C - r.(?) p.(Leu1198Pro) Unknown - VUS g.111893984A>G g.111456180A>G ATXN2(NM_002973.3):c.3593T>C (p.L1198P) - ATXN2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3708G>A - r.(?) p.(Ala1236=) Unknown - likely benign g.111893869C>T g.111456065C>T ATXN2(NM_002973.3):c.3708G>A (p.A1236=) - ATXN2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*4529T>G - r.(=) p.(=) Unknown - VUS g.111886087A>C g.111448283A>C SH2B3(NM_005475.2):c.1709A>C (p.N570T) - ATXN2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*4542G>A - r.(=) p.(=) Unknown - VUS g.111886074C>T - SH2B3(NM_005475.2):c.1696C>T (p.R566W) - ATXN2_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*4587G>A - r.(=) p.(=) Unknown - VUS g.111886029C>T g.111448225C>T SH2B3(NM_005475.2):c.1651C>T (p.R551W) - ATXN2_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*4632C>T - r.(=) p.(=) Unknown - likely benign g.111885984G>A - SH2B3(NM_005475.2):c.1606G>A (p.A536T) - ATXN2_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*4642G>A - r.(=) p.(=) Unknown - likely benign g.111885974C>T - SH2B3(NM_005475.2):c.1596C>T (p.P532=) - ATXN2_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*4760C>G - r.(=) p.(=) Unknown - likely benign g.111885856G>C g.111448052G>C SH2B3(NM_005475.2):c.1478G>C (p.G493A) - ATXN2_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*4777_*4800del - r.(=) p.(=) Unknown - likely benign g.111885832_111885855del g.111448028_111448051del SH2B3(NM_005475.2):c.1454_1477delATTCAGAGTCCCTTCCTCACTGGG (p.D485_W492del) - ATXN2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*4812G>A - r.(=) p.(=) Unknown - VUS g.111885804C>T - SH2B3(NM_005475.2):c.1426C>T (p.L476F) - ATXN2_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5025G>A - r.(=) p.(=) Unknown - likely benign g.111885591C>T - SH2B3(NM_005475.2):c.1368C>T (p.V456=) - ATXN2_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*5042C>T - r.(=) p.(=) Unknown - VUS g.111885574G>A g.111447770G>A SH2B3(NM_005475.2):c.1351G>A (p.G451S) - ATXN2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5255_*5264del - r.(=) p.(=) Unknown - likely benign g.111885367_111885376del - SH2B3(NM_005475.2):c.1236+19_1236+28delTGGGGTGGGG - ATXN2_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*5260_*5264del - r.(=) p.(=) Unknown - benign g.111885372_111885376del g.111447568_111447572del SH2B3(NM_005475.2):c.1236+24_1236+28delTGGGG - SH2B3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*5260_*5264del - r.(=) p.(=) Unknown - likely benign g.111885372_111885376del g.111447568_111447572del SH2B3(NM_005475.2):c.1236+24_1236+28delTGGGG - SH2B3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5260_*5264dup - r.(=) p.(=) Unknown - likely benign g.111885372_111885376dup g.111447568_111447572dup SH2B3(NM_005475.2):c.1236+24_1236+28dupTGGGG - ATXN2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5260_*5264dup - r.(=) p.(=) Unknown - likely benign g.111885372_111885376dup - SH2B3(NM_005475.2):c.1236+24_1236+28dupTGGGG - ATXN2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5316C>T - r.(=) p.(=) Unknown - likely benign g.111885300G>A - SH2B3(NM_005475.2):c.1188G>A (p.T396=) - ATXN2_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5429G>A - r.(=) p.(=) Unknown - likely benign g.111885187C>T g.111447383C>T SH2B3(NM_005475.2):c.1075C>T (p.L359=) - ATXN2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query