Full data view for gene BBS2

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_031885.3 transcript reference sequence.

464 entries on 5 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3 4 5     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-/. - c.-344A>G r.(?) p.(=) Unknown - benign g.56554118T>C g.56520206T>C - - OGFOD1_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-318C>G r.(?) p.(=) Unknown - benign g.56554092G>C g.56520180G>C - - OGFOD1_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 1 c.-234-1G>C r.(?) p.? Unknown - likely pathogenic (recessive) g.56554009C>G - IVS1-1G>C - BBS2_000142 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 one BBS2 mutation but excluded genetically from the BBS2 locus; Unknown 2nd allele - - - - - - - - 1 LOVD
-/. - c.-225C>T r.(?) p.(=) Unknown - benign g.56553999G>A g.56520087G>A - - BBS2_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-42T>G r.(?) p.(=) Unknown - benign g.56553816A>C g.56519904A>C - - BBS2_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. 1 c.-42T>G r.(=) p.(=) Unknown - benign g.56553816A>C - -42T>G - BBS2_000092 - PubMed: Duelund Hjortshoj-2010 - - Germline - 0.07 - - - DNA, RNA DHPLC, arraySNP, RT-PCR blood - retinal disease - PubMed: Duelund Hjortshoj-2010 - - - - - - - - - 1 LOVD
-/. - c.-40T>C r.(?) p.(=) Unknown - benign g.56553814A>G g.56519902A>G - - BBS2_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. 1 c.-40T>C r.(=) p.(=) Unknown - benign g.56553814A>G - -40T>C - BBS2_000091 - PubMed: Duelund Hjortshoj-2010 - - Germline - 0.07 - - - DNA, RNA DHPLC, arraySNP, RT-PCR blood - retinal disease - PubMed: Duelund Hjortshoj-2010 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - R634P - CRYM_000000 - PubMed: Katsanis-2001 - - Germline yes - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? - R275X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline yes 0/192 ethnically matched control chromosomes - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? - Y24X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline yes - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? - D170fsX171 - CRYM_000000 - PubMed: Katsanis-2001 - - Germline yes - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 homozygous by descent BBS1 - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? - C210fsX246 - CRYM_000000 - PubMed: Katsanis-2001 - - Germline yes - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - Y24X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline yes - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 BBS2-linkage - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - Q59X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 one BBS2 mutation but excluded genetically from the BBS2 locus; Unknown 2nd allele - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - R275X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 one BBS2 mutation but excluded genetically from the BBS2 locus; 2nd and 3rd allele BBS1 - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - V158fsX200 - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - 0/192 ethnically matched control chromosomes - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 one BBS2 mutation but excluded genetically from the BBS2 locus; 2nd and 3rd allele BBS1 - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - R216X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - L168fsX170 - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? - Y24X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - Q59X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 two BBS2 mutations found in unaffected individuals - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic (recessive) g.? - Y24X - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 two BBS2 mutations found in unaffected individuals - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? - T560I - CRYM_000000 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 two BBS2 mutations found in unaffected individuals; homozygous by descent BBS4 - - - - - - - - 1 LOVD
+/. - c.? r.(?) p.? Unknown - pathogenic g.? - p.[D104A]+[R632P] - CRYM_000000 - PubMed: Bin-2009 - - Germline - - - - - DNA, RNA SEQ, RT-PCR - - retinal disease - PubMed: Bin-2009 - - - - Russian - - - - 1 LOVD
+/. - c.? r.(?) p.? Unknown - pathogenic g.? - p.[D104A]+[R632P] - CRYM_000000 - PubMed: Bin-2009 - - Germline - - - - - DNA, RNA SEQ, RT-PCR - - retinal disease - PubMed: Bin-2009 - - - - Russian - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic g.? - Y24X - CRYM_000000 - PubMed: Muller-2010, Katsanis 2001 - - Germline - - - - - DNA ? blood ASPER microarray retinal disease - PubMed: Muller-2010, Katsanis 2001 - - - - Australia - - - - 1 LOVD
+/. - c.? r.(?) p.? Both (homozygous) - pathogenic g.? - R275X - CRYM_000000 - PubMed: Badano-2003 - - Germline - - - - - DNA PCR blood - retinal disease - PubMed: Badano-2003 - F no - northern Italy - - - - 1 LOVD
+/. - c.? r.(?) p.? Both (homozygous) - pathogenic g.? - R275X - CRYM_000000 - PubMed: Badano-2003 - - Germline - - - - - DNA PCR blood - retinal disease - PubMed: Badano-2003 - M no - northern Italy - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic g.? - Q59X - CRYM_000000 - PubMed: Eichers-2009, Katsanis 2001 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Beales 2003 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic g.? - I168fsX170 - CRYM_000000 - PubMed: Eichers-2009, Katsanis 2001 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Katsanis 2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic g.? - R275X - CRYM_000000 - PubMed: Eichers-2009, Katsanis 2001 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Katsanis 2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic g.? - R275X - CRYM_000000 - PubMed: Eichers-2009, Badano 2003 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Katsanis 2001 - - - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? - T560I - CRYM_000000 four mutant alleles are potentially necessary for disease pathogenesis. PubMed: Eichers-2009, Katsanis 2002 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Badano 2003 one unaffected sibling and the unaffected mother of this BBS patient carry one mutant BBS2 allele and two mutant BBS4 alleles. F - - - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic g.? - [p.G81C] - CRYM_000000 - PubMed: Imhoff-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Imhoff-2011 - - - - white - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic g.? - [p.L536L] - CRYM_000000 normal 2nd chromosome PubMed: Imhoff-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Imhoff-2011 - - - - white - - - - 1 LOVD
+?/. - c.? r.(?) p.? Parent #1 - likely pathogenic g.? - [p.L88R];[p.N461KfsX10] - CRYM_000000 - PubMed: Deveault-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Deveault-2011 - M - - Ghanian - - - - 1 LOVD
+?/. - c.? r.(?) p.? Parent #2 - likely pathogenic g.? - [p.I330T];[p.R483X] - CRYM_000000 - PubMed: Deveault-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Deveault-2011 novel - - - white - - - - 1 LOVD
+?/. - c.? r.(?) p.? Parent #2 - likely pathogenic g.? - [p.M242RfsX83];[p.M390R] - CRYM_000000 - PubMed: Deveault-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Deveault-2011 - - - - English/Scottish/Irish/German/Icelandic - - - - 1 LOVD
+?/. - c.? r.(?) p.? Parent #2 - likely pathogenic g.? - [p.M390R];[p.L505PfsX52] - CRYM_000000 - PubMed: Deveault-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Deveault-2011 - F - - English/Irish/Scottish - - - - 1 LOVD
+?/. - c.? r.(?) p.? Parent #2 - likely pathogenic g.? - [p.G162fsX4];[p.I334fsX1] - CRYM_000000 - PubMed: Deveault-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Deveault-2011 novel F - - Mexican - - - - 1 LOVD
+?/. - c.? r.(?) p.? Parent #2 - likely pathogenic g.? - [p.C91LfsX5];[p.E104KfsX7] - CRYM_000000 - PubMed: Deveault-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Deveault-2011 - M - - English/Irish/Scottish - - - - 1 LOVD
+/. 6i c.? r.spl? p.? Unknown - pathogenic g.56540030? - c.IVS6+2(h) - CRYM_000000 - PubMed: Janssen-2011 - - Germline - 0.008 - - - DNA SEQ, HD - SEQ or HD retinal disease A3436-II1 PubMed: Janssen-2011 - - - Turkey - - - - - 1 LOVD
+/. - c.? r.(?) p.R413* Unknown - pathogenic g.? - p.R413X;p.R480X - CRYM_000000 - PubMed: Hirano 2015 - - Germline - - - - - DNA, RNA SEQ, PCR blood - retinal disease - PubMed: Hirano 2015 - M no Japan Japanese - - - - 1 LOVD
+/. - c.? r.(?) p.(R48*) Unknown - pathogenic g.? - p.R413X;p.R480X - CRYM_000000 - PubMed: Hirano 2015 - - Germline - - - - - DNA, RNA SEQ, PCR blood - retinal disease - PubMed: Hirano 2015 - M no Japan Japanese - - - - 1 LOVD
+/. - c.? r.(?) p.? Unknown - pathogenic g.? - c.535-79_90del/N - CRYM_000000 normal 2nd chromosome PubMed: Esposito 2017 - - Germline - - - - - DNA arraySNP blood BBS-ALMS1 mutation array retinal disease P.12 PubMed: Esposito 2017 - - - Italy - - - - - 1 LOVD
+?/. - c.? r.(?) p.? Unknown - likely pathogenic g.? g.? BBS2 I234V - CRYM_000000 homozygous; no nucleotide annotation, could not be extrapolated from protein and databases, as no known transcripts contain Ile in the position 234 PubMed: Heon 2005 - - Germline yes - - - - DNA ? - - BBS ? PubMed: Heon 2005 10 affected individuals from the family mapped to the BBS2 locus - - - - - - - - 1 LOVD
?/. - c.1A>G r.(?) p.(Met1?) Unknown - VUS g.56553774T>C g.56519862T>C - - BBS2_000110 - PubMed: Koyanagi 2019, Journal: Koyanagi 2019 - rs753338961 Germline - 1/1204 cases with retinitis pigmentosa - - - DNA SEQ-NG - - retinal disease - PubMed: Koyanagi 2019, Journal: Koyanagi 2019 analysis 1204 retinitis pigmentosa cases - - Japan - - - - - 1 Yoshito Koyanagi
?/. - c.1A>G r.(?) p.(Met1?) Unknown ACMG VUS g.56553774T>C g.56519862T>C BBS2 c.A1G, p.M1V - BBS2_000110 marked as causative, heterozygous PubMed: Ma 2021 - - Unknown ? - - - - DNA SEQ-NG-I, SEQ - whole exome sequencing retinal disease 155 PubMed: Ma 2021 - ? - Korea - - - - - 1 LOVD
+/. - c.2T>G r.(?) p.(Met1?) Unknown - pathogenic g.56553773A>C g.56519861A>C - - BBS2_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 1 c.68G>C r.(?) p.(Arg23Pro) Both (homozygous) - pathogenic g.56553707C>G - 68G/C (R23P) - BBS2_000132 - PubMed: Harville-2010 - - Germline - 0/90 ethnically matched controls - - - DNA SEQ blood - retinal disease - PubMed: Harville-2010 - - yes Turkey - - - - - 1 LOVD
+?/. - c.72C>G r.(?) p.(Tyr24*) Parent #1 - likely pathogenic g.56553703G>C g.56519791G>C - - BBS2_000119 - PubMed: Stone 2017 - - Germline - - - - - DNA SEQ-NG - - retinal disease 615 PubMed: Stone 2017 1 affected M - (United States) - - - - - 1 LOVD
+/. - c.72C>G r.(?) p.(Tyr24Ter) Parent #2 - pathogenic (recessive) g.56553703G>C g.56519791G>C - - BBS2_000119 - PubMed: Consugar 2015 - - Germline yes - - - - DNA SEQ-NG - 238-gene panel retinal disease OGI-297-650 PubMed: Consugar 2015 - - - United States - - - - - 1 LOVD
+/. - c.72C>G r.(?) p.(Tyr24*) Unknown ACMG pathogenic g.56553703G>C g.56519791G>C BBS2 c.72C>G, p.(Tyr24*) - BBS2_000119 single heterozygous variant (recessive) PubMed: Jespersgaar 2019 - - Germline ? - - - - DNA SEQ-NG-I blood 125 genes associated with inherited retinal disorders, see paper supplemental data retinal disease 355 PubMed: Jespersgaar 2019 - ? - Denmark - - - - - 1 LOVD
+?/. 1 c.72C>G r.(?) p.(Tyr24*) Unknown - likely pathogenic g.56553703G>C - c.72G>C (p.Y24X) - BBS2_000119 - PubMed: Duelund Hjortshoj-2010 - - Germline - - - - - DNA, RNA DHPLC, arraySNP, RT-PCR blood - retinal disease - PubMed: Duelund Hjortshoj-2010 - M - - - - - - - 1 LOVD
+?/. 1 c.72C>G r.(?) p.(Tyr24*) Unknown - likely pathogenic g.56553703G>C - c.72G>C (p.Y24X) - BBS2_000119 - PubMed: Duelund Hjortshoj-2010 - - Germline - - - - - DNA, RNA DHPLC, arraySNP, RT-PCR blood - retinal disease - PubMed: Duelund Hjortshoj-2010 - - - - - - - - - 1 LOVD
+?/. 1 c.72C>G r.(?) p.(Tyr24*) Unknown - likely pathogenic g.56553703G>C - Y24X - BBS2_000119 - PubMed: Eichers-2009, Beales 2003 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Beales 2003 - - - - - - - - - 1 LOVD
+?/. 1 c.72C>G r.(?) p.(Tyr24*) Both (homozygous) - likely pathogenic g.56553703G>C - Y24X - BBS2_000119 - PubMed: Eichers-2009, Katsanis 2001 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Katsanis 2001 - - - - - - - - - 1 LOVD
+/. 1 c.72C>G r.(?) p.(Tyr24*) Unknown - pathogenic g.56553703G>C - c.72C>G(h) - BBS2_000119 Family AR724 (A2866) has previously been published for this heterozygous change in BBS2 (p.Q59X) by Katsanis et al. 2001 PubMed: Janssen-2011 - - Germline - - - - - DNA SEQ, HD - SEQ or HD retinal disease AR724(A2866)-5 PubMed: Janssen-2011 - - - - Northern-Europe - - - - 1 LOVD
+/. 1 c.72C>G r.(?) p.(Tyr24*) Unknown - pathogenic g.56553703G>C - c.72C>G(h) - BBS2_000119 - PubMed: Janssen-2011 - - Germline - 0.007 - - - DNA SEQ, HD - SEQ or HD retinal disease AR850(A2878)-3 PubMed: Janssen-2011 - - - - Northern-Europe - - - - 1 LOVD
+/. 1 c.72C>G r.(?) p.(Tyr24*) Unknown - pathogenic g.56553703G>C - c.72C>G(h) - BBS2_000119 - PubMed: Janssen-2011 - - Germline - 0.007 - - - DNA SEQ, HD - SEQ or HD retinal disease AR850(A2878)-4 PubMed: Janssen-2011 - - - - Northern-Europe - - - - 1 LOVD
+?/. - c.72C>G r.(?) p.(Tyr24*) Unknown - pathogenic (recessive) g.56553703G>C g.56519791G>C BBS2 c.72C>T, p.Tyr24* - BBS2_000119 error in annotation, should be C>G; compound heterozygous PubMed: Delvallee 2021 - - Germline yes - - - - DNA SEQ-NG, SEQ blood whole-exome sequencing retinal disease H.II.1 PubMed: Delvallee 2021 - - - France - - - - - 1 LOVD
+?/. - c.79A>C r.(?) p.(Thr27Pro) Unknown ACMG likely pathogenic g.56553696T>G g.56519784T>G BBS2 NM_031885: g.500A>C, c.79A>C, p.T27P - BBS2_000185 - PubMed: Xu 2020 - - Unknown ? - - - - DNA SEQ-NG - targeted next-generation sequencing retinal disease 19400 PubMed: Xu 2020 - ? no China - - - - - 1 LOVD
?/. 1 c.79A>C r.(?) p.(Thr27Pro) Both (homozygous) ACMG VUS g.56553696T>G g.56519784T>G BBS2 c.79A > C, p.T27P - BBS2_000185 homozygous PubMed: Meng 2021 - - Germline yes - - - - DNA SEQ-NG-I blood 131 known inherited retinal disease genes retinal disease F2-II:1 PubMed: Meng 2021 - M yes China - - - - - 1 LOVD
?/. 1 c.79A>C r.(?) p.(Thr27Pro) Both (homozygous) ACMG VUS g.56553696T>G g.56519784T>G BBS2 c.79A > C, p.T27P - BBS2_000185 homozygous PubMed: Meng 2021 - - Germline yes - - - - DNA SEQ-NG-I blood 131 known inherited retinal disease genes retinal disease F2-II:2 PubMed: Meng 2021 - F yes China - - - - - 1 LOVD
+/. 1 c.84delC r.(?) p.(Pro29Argfs*50) Unknown - pathogenic g.56553691delG - c.84delC/c.1059dupT - BBS2_000204 - PubMed: Esposito 2017 - - Germline - - - - - DNA arraySNP blood BBS-ALMS1 mutation array retinal disease P.8 PubMed: Esposito 2017 - - - Italy - - - - - 1 LOVD
?/. - c.86C>T r.(?) p.(Pro29Leu) Unknown - VUS g.56553689G>A g.56519777G>A - - BBS2_000109 - PubMed: Koyanagi 2019, Journal: Koyanagi 2019 - rs771211831 Germline - 1/1204 cases with retinitis pigmentosa - - - DNA SEQ-NG - - retinal disease - PubMed: Koyanagi 2019, Journal: Koyanagi 2019 analysis 1204 retinitis pigmentosa cases - - Japan - - - - - 1 Yoshito Koyanagi
+/. 2 c.98C>A r.(?) p.(Ala33Asp) Unknown - pathogenic (recessive) g.56553677G>T g.56519765G>T - - BBS2_000095 - PubMed: Shevach 2015 - - Germline - - - - - DNA SEQ - - retinal disease FamMOL0369 PubMed: Shevach 2015 3-generation family, 3 affected (F, 2M), unaffected parents M no Israel Morocco;Jewish - - - - 3 Dror Sharon
+/. - c.98C>A r.(?) p.(Ala33Asp) Parent #2 - pathogenic (recessive) g.56553677G>T g.56519765G>T - - BBS2_000095 - PubMed: Shevach 2015 - - Germline - - - - - DNA SEQ - - retinal disease FamRD158 PubMed: Shevach 2015 2-generation family, 1 affected, unaffected parents F - Israel Jewish-Ashkenazi - - - - 1 Johan den Dunnen
+?/. - c.98C>A r.(?) p.(Ala33Asp) Unknown ACMG likely pathogenic g.56553677G>T - - - BBS2_000095 - PubMed: Sharon 2019 - - Germline - 1/2420 IRD families - - - DNA SEQ - - retinal disease - PubMed: Sharon 2019 1 IRD family - - Israel - - - - - 1 Global Variome, with Curator vacancy
+?/. - c.98C>A r.(?) p.(Ala33Asp) Both (homozygous) ACMG likely pathogenic (recessive) g.56553677G>T g.56519765G>T - - BBS2_000095 ACMG PM2, PP3, PP5 PubMed: Marinakis 2021 - rs797045155 Germline - - - - - DNA SEQ, SEQ-NG - WES ? 9141 PubMed: Marinakis 2021 - F - Greece - - - - - 1 Jan Traeger-Synodinos
+/. - c.98C>A r.(?) p.(Ala33Asp) Unknown - pathogenic g.56553677G>T g.56519765G>T - - BBS2_000095 - PubMed: Kostoulas 2026 - rs797045155 Germline - 1/276 unrelated individuals - - - DNA SEQ-NG - WES Healthy/Control - PubMed: Kostoulas 2026 analysis 276 unrelated individuals (carrier screening) - - Greece - - - - - 1 Johan den Dunnen
+?/. 1 c.117G>A r.(=) p.(=) Parent #2 - likely pathogenic g.56553658C>T - [p.C91W];[p.V707XfsX1] - BBS2_000184 - PubMed: Deveault-2011 - - Unknown - - - - - DNA PCR - - retinal disease - PubMed: Deveault-2011 - M - - English/Irish/Scottish - - - - 1 LOVD
+?/. - c.117G>A r.spl p.(Lys39=) Both (homozygous) - likely pathogenic g.56553658C>T g.56519746C>T BBS2 c.117G>A p.(Lys39;) - BBS2_000184 homozygous PubMed: Méjécase 2020 - - Unknown ? - - - - DNA SEQ-NG - retrospective case note review, targeted gene panel testing retinal disease 43 {PMID:Méjécase 2020:3278337 - ? - United Arab Emirates - - - - - 1 LOVD
+?/. 1i c.117+1G>C r.spl? p.? Unknown - likely pathogenic (recessive) g.56553657C>G - IVS1+1G>C (R315Q) - BBS2_000141 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 two BBS2 mutations found in unaffected individuals; 3rd allele unmapped - - - - - - - - 1 LOVD
+?/. 1i c.117+1G>C r.spl? p.? Unknown - likely pathogenic g.56553657C>G - IVS1+1G>C/R315Q - BBS2_000141 - PubMed: Eichers-2009, Beales 2003 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Beales 2003 - - - - - - - - - 1 LOVD
+?/. 1i c.117+1G>T r.spl p.(?) Unknown - likely pathogenic g.56553657C>A g.56519745C>A c.117+1G>T, p.? - BBS2_000167 Compound heterozygous PubMed: Tayebi 2019 - - Germline yes - - - - DNA SEQ-NG-I blood 108-gene panel targeted resequencing using MIPs library prep retinal disease 066568 PubMed: Tayebi 2019 - - - Iran - - - - - 1 LOVD
-?/. - c.118-47T>G r.(=) p.(=) Unknown - likely benign g.56548639A>C - BBS2(NM_031885.5):c.118-47T>G - OGFOD1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.118G>T r.(?) p.(Val40Phe) Parent #1 - likely pathogenic g.56548592C>A g.56514680C>A - - BBS2_000118 - PubMed: Stone 2017 - - Germline - - - - - DNA SEQ-NG - - retinal disease 616 PubMed: Stone 2017 1 affected M - (United States) - - - - - 1 LOVD
+?/. 2 c.141_142del r.(?) p.(Arg48GlufsTer17) Parent #1 - likely pathogenic g.56548570_56548571del g.56514658_56514659del 141_142delAC - chr16_007681 - PubMed: Liu 2026 - - Germline - 1/7496 chromosomes - - - DNA SEQ, SEQ-NG - 334-gene panel Healthy/Control - PubMed: Liu 2026 carrier screening 3748 individuals (2087F, 1661M) - - China - - - - - 1 Johan den Dunnen
?/. - c.143G>A r.(?) p.(Arg48Gln) Parent #1 - VUS g.56548567C>T g.56514655C>T - - BBS2_000115 - PubMed: Zenteno 2020 - - Germline - 1/143 cases - - - DNA SEQ, SEQ-NG - 199 gene panel retinal disease 2007 PubMed: Zenteno 2020 family - - Mexico - - - - - 1 Johan den Dunnen
./. - c.175C>T r.(?) p.(Gln59*) Maternal (confirmed) - pathogenic g.56548535G>A g.56514623G>A - - BBS2_000036 - PubMed: DDDS 2015, Journal: DDDS 2015 - - Germline - - - - - DNA SEQ, SEQ-NG-I - - ? - PubMed: DDDS 2015, Journal: DDDS 2015 family, affected sibling(s) M - United Kingdom (Great Britain) - - - Decipher - 2 Johan den Dunnen
+/. 2 c.175C>T r.(?) p.(Gln59*) Unknown - pathogenic g.56548535G>A - c.175C>T(h) - BBS2_000036 Family AR724 (A2866) has previously been published for this heterozygous change in BBS2 (p.Q59X) by Katsanis et al. 2001 PubMed: Janssen-2011 - - Germline - 0.009 - - - DNA SEQ, HD - SEQ or HD retinal disease AR724(A2866)-5 PubMed: Janssen-2011 - - - - Northern-Europe - - - - 1 LOVD
+?/. - c.175C>T r.(?) p.(Gln59*) Unknown - pathogenic (recessive) g.56548535G>A g.56514623G>A BBS2 c.175C>T, p.Gln59* - BBS2_000036 compound heterozygous PubMed: Delvallee 2021 - - Germline yes - - - - DNA SEQ-NG, SEQ blood whole-exome sequencing retinal disease H.II.1 PubMed: Delvallee 2021 - - - France - - - - - 1 LOVD
?/. - c.184C>G r.(?) p.(Leu62Val) Unknown - VUS g.56548526G>C - BBS2(NM_031885.3):c.184C>G (p.L62V) - OGFOD1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 2 c.198_231del r.(?) p.(Ser67Ter) Parent #1 - likely pathogenic g.56548482_56548515del g.56514570_56514603del 198_231delTTCTCTTCTCAGCATTAACCAGGCAGTCAGCTGT - chr16_007683 - PubMed: Liu 2026 - - Germline - 1/7496 chromosomes - - - DNA SEQ, SEQ-NG - 334-gene panel Healthy/Control - PubMed: Liu 2026 carrier screening 3748 individuals (2087F, 1661M) - - China - - - - - 1 Johan den Dunnen
-/. - c.209= r.(=) p.(Asn70=) Unknown - benign g.56548501C>T g.56514589C>T BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N) - BBS2_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.209= r.(=) p.(Asn70=) Unknown - benign g.56548501C>T g.56514589C>T BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N) - BBS2_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.209= r.(=) p.(Asn70=) Unknown - benign g.56548501C>T g.56514589C>T BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N) - BBS2_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.209= r.(=) p.(Asn70=) Unknown - benign g.56548501C>T g.56514589C>T BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N) - BBS2_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.209= r.(=) p.(Asn70=) Unknown - benign g.56548501C>T - BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N) - BBS2_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.209A>G r.(?) p.(Asn70Ser) Parent #1 - likely pathogenic g.56548501T>C - - - BBS2_000114 - PubMed: Holtan 2020 - - Germline - 1/899 cases - - - DNA SEQ - - retinal disease - PubMed: Holtan 2020 1 patient with variant in heterozygous or compound heterozygous form - - Norway - - - - - 1 Global Variome, with Curator vacancy
+?/. - c.209A>G r.(?) p.(Asn70Ser) Both (homozygous) - likely pathogenic (recessive) g.56548501T>C - - - BBS2_000114 - PubMed: Holtan 2020 - - Germline - 1/899 cases - - - DNA SEQ - - retinal disease - PubMed: Holtan 2020 1 homozygous patient - - Norway - - - - - 1 Global Variome, with Curator vacancy
+?/. 2 c.209A>G r.(?) p.(Asn70Ser) Unknown - likely pathogenic (recessive) g.56548501T>C - N70S - BBS2_000114 - PubMed: Katsanis-2001 - - Germline - - - - - DNA SEQ - - retinal disease - PubMed: Katsanis-2001 - - - - - - - - - 1 LOVD
+?/. 2 c.209A>G r.(?) p.(Asn70Ser) Unknown - likely pathogenic g.56548501T>C - N70S - BBS2_000114 - PubMed: Eichers-2009, Katsanis 2001 - - Germline - - - - - DNA ? - - retinal disease - PubMed: Eichers-2009, Katsanis 2002 - - - - - - - - - 1 LOVD
?/. - c.209G>A r.(?) p.(Ser70Asn) Unknown - VUS g.56548501C>T - - - BBS2_000084 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. PubMed: Koyanagi 2019, Journal: Koyanagi 2019 - rs4784677 Germline - 1/1204 cases with retinitis pigmentosa - - - DNA SEQ-NG - - retinal disease - PubMed: Koyanagi 2019, Journal: Koyanagi 2019 analysis 1204 retinitis pigmentosa cases - - Japan - - - - - 1 Yoshito Koyanagi
?/. - c.209G>A r.(?) p.(Ser70Asn) Both (homozygous) - VUS g.56548501C>T - - - BBS2_000084 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. PubMed: Koyanagi 2019, Journal: Koyanagi 2019 - rs4784677 Germline - 1203/1204 cases with retinitis pigmentosa - - - DNA SEQ-NG - - retinal disease - PubMed: Koyanagi 2019, Journal: Koyanagi 2019 analysis 1204 retinitis pigmentosa cases - - Japan - - - - - 1203 Yoshito Koyanagi
+?/. 2 c.209G>A r.(?) p.(Ser70Asn) Both (homozygous) - likely pathogenic g.56548501C>T - c.209G>A - BBS2_000084 Disease associated polymorphisms PubMed: Sathya Priya-2015 - - Germline yes - - - - DNA, RNA arraySNP, PCR blood - retinal disease - PubMed: Sathya Priya-2015 - - - - - - - - - 1 LOVD
+/. - c.224T>G r.(?) p.(Val75Gly) Unknown ACMG pathogenic g.56548486A>C - - - BBS2_000113 - PubMed: Sharon 2019 - - Germline - 3/2420 IRD families - - - DNA SEQ - - retinal disease - PubMed: Sharon 2019 3 IRD families - - Israel - - - - - 3 Global Variome, with Curator vacancy
+?/. 2 c.224T>G r.(?) p.(Val75Gly) Both (homozygous) - likely pathogenic g.56548486A>C g.56514574A>C c.224T>G, p.(Val75Gly) - BBS2_000113 Homozygous PubMed: Tayebi 2019 - - Germline yes - - - - DNA SEQ-NG-I blood 108-gene panel targeted resequencing using MIPs library prep retinal disease 066574 PubMed: Tayebi 2019 - - - Iran - - - - - 1 LOVD
+/. 2 c.225T>G r.(?) p.V75G) Both (homozygous) - pathogenic g.56548485A>C - c.225T>G/c.225T>G (p.V75G) - BBS2_000203 - PubMed: Esposito 2017 - - Germline - - - - - DNA arraySNP blood BBS-ALMS1 mutation array retinal disease P.9 PubMed: Esposito 2017 - - - Italy - - - - - 1 LOVD
Legend   How to query   « First ‹ Prev     1 2 3 4 5     Next › Last »


Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.