Full data view for gene C2

Information The variants shown are described using the NM_000063.4 transcript reference sequence.

92 entries on 1 page. Showing entries 1 - 92.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/. - c.-31085A>G r.(?) p.(=) Unknown - likely benign g.31864445A>G g.31896668A>G EHMT2(NM_001289413.1):c.437T>C (p.I146T) - C2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-30642C>T r.(?) p.(=) Unknown - likely benign g.31864888C>T g.31897111C>T EHMT2(NM_001289413.1):c.92G>A (p.G31E) - C2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-27394C>A r.(?) p.(=) Unknown - likely benign g.31868136C>A g.31900359C>A ZBTB12(NM_181842.2):c.947G>T (p.S316I) - C2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-26465T>A r.(?) p.(=) Unknown - likely benign g.31869065T>A g.31901288T>A C2(NM_001282457.2):c.-64+3346T>A - C2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.118G>A r.(?) p.(Gly40Ser) Unknown - VUS g.31895803G>A - - - C2_000041 - Liu submitted, 2021 - - Germline - - - - - DNA SEQ-NG PBMC WES virus, COVID-19 - Liu submitted, 2021 analysis 233 patients - - China - - - - - 1 Liu Wenbing
-?/. - c.256+37C>T r.(=) p.(=) Unknown - likely benign g.31895978C>T g.31928201C>T C2(NM_001282458.1):c.169+9C>T - C2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.309G>T r.(?) p.(Arg103=) Unknown - likely benign g.31896561G>T - C2(NM_001282458.1):c.222G>T (p.R74=) - C2_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.325G>A r.(?) p.(Val109Met) Unknown - VUS g.31896577G>A - - - C2_000042 - Liu submitted, 2021 - - Germline - - - - - DNA SEQ-NG PBMC WES virus, COVID-19 - Liu submitted, 2021 analysis 233 patients - - China - - - - - 1 Liu Wenbing
-?/. - c.345C>T r.(?) p.(Phe115=) Unknown - likely benign g.31896597C>T g.31928820C>T C2(NM_001282458.1):c.258C>T (p.F86=) - C2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.443-16C>T r.(=) p.(=) Unknown - likely benign g.31901371C>T g.31933594C>T C2(NM_000063.4):c.443-16C>T - C2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.536C>T r.(?) p.(Ser179Leu) Unknown - VUS g.31901480C>T g.31933703C>T C2(NM_001282457.1):c.31C>T (p.R11*) - C2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.584G>A r.(?) p.(Gly195Glu) Unknown - VUS g.31901528G>A - - - C2_000043 - Liu submitted, 2021 - - Germline - - - - - DNA SEQ-NG PBMC WES virus, COVID-19 - Liu submitted, 2021 analysis 233 patients - - China - - - - - 1 Liu Wenbing
?/. - c.727C>T r.(?) p.(Arg243Cys) Unknown - VUS g.31901954C>T g.31934177C>T C2(NM_001282458.1):c.640C>T (p.R214C) - C2_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.749C>G r.(?) p.(Ser250Cys) Unknown - VUS g.31901976C>G g.31934199C>G C2(NM_001282458.1):c.662C>G (p.S221C), C2(NM_001282458.2):c.662C>G (p.S221C) - C2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.749C>G r.(?) p.(Ser250Cys) Unknown - VUS g.31901976C>G g.31934199C>G C2(NM_001282458.1):c.662C>G (p.S221C), C2(NM_001282458.2):c.662C>G (p.S221C) - C2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.841_849+19del r.spl? p.? Unknown - pathogenic g.31902068_31902095del g.31934291_31934318del C2(NM_000063.4):c.839_849+17delTGGTGGACAGGGTCAGGAATCAGGAGTC, C2(NM_001282459.1):c.841_868delGTGGACAGGGTCAGGAATCAGGAGTCTG (p.V281Pfs*110), C2(NM_00...) - C2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.841_849+19del r.spl? p.? Unknown - VUS g.31902068_31902095del g.31934291_31934318del C2(NM_000063.4):c.839_849+17delTGGTGGACAGGGTCAGGAATCAGGAGTC, C2(NM_001282459.1):c.841_868delGTGGACAGGGTCAGGAATCAGGAGTCTG (p.V281Pfs*110), C2(NM_00...) - C2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.841_849+19del r.spl? p.? Unknown - VUS g.31902068_31902095del g.31934291_31934318del C2(NM_000063.4):c.839_849+17delTGGTGGACAGGGTCAGGAATCAGGAGTC, C2(NM_001282459.1):c.841_868delGTGGACAGGGTCAGGAATCAGGAGTCTG (p.V281Pfs*110), C2(NM_00...) - C2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.929A>G r.(?) p.(Asn310Ser) Unknown - likely benign g.31903779A>G g.31936002A>G C2(NM_001282458.1):c.842A>G (p.N281S) - C2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.931G>A r.(?) p.(Asp311Asn) Unknown - likely benign g.31903781G>A - C2(NM_001282458.1):c.844G>A (p.D282N) - C2_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.954G>C r.(?) p.(Glu318Asp) Unknown - benign g.31903804G>C g.31936027G>C C2(NM_000063.4):c.954G>C (p.E318D), C2(NM_001282458.2):c.867G>C (p.E289D) - C2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.954G>C r.(?) p.(Glu318Asp) Unknown - benign g.31903804G>C g.31936027G>C C2(NM_000063.4):c.954G>C (p.E318D), C2(NM_001282458.2):c.867G>C (p.E289D) - C2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.954G>C r.(?) p.(Glu318Asp) Unknown - benign g.31903804G>C g.31936027G>C C2(NM_000063.4):c.954G>C (p.E318D), C2(NM_001282458.2):c.867G>C (p.E289D) - C2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.980A>G r.(?) p.(Asn327Ser) Unknown - likely benign g.31903830A>G g.31936053A>G C2(NM_001282458.1):c.893A>G (p.N298S) - C2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1023G>A r.(?) p.(Ala341=) Unknown - benign g.31905130G>A g.31937353G>A - - C2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1246_1249del r.(?) p.(Leu416MetfsTer7) Unknown - pathogenic g.31910762_31910765del - C2(NM_001282458.1):c.1159_1162delCTGG (p.L387Mfs*7) - C2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1360+62G>T r.(=) p.(=) Unknown - benign g.31910938G>T g.31943161G>T C2(NM_000063.4):c.1360+62G>T - C2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1361-4A>G r.spl? p.? Unknown - likely benign g.31910998A>G g.31943221A>G C2(NM_000063.4):c.1361-4A>G - C2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1389C>T r.(?) p.(Cys463=) Unknown - likely benign g.31911030C>T g.31943253C>T C2(NM_001282458.2):c.1302C>T (p.C434=) - C2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1414G>A r.(?) p.(Ala472Thr) Parent #1 - VUS g.31911055G>A g.31943278G>A - - C2_000033 conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs142243595 Germline - 1/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 1 Mohammed Faruq
-?/. - c.1494C>T r.(?) p.(Ser498=) Unknown - likely benign g.31911231C>T - C2(NM_001282458.1):c.1407C>T (p.S469=) - C2_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1495G>A r.(?) p.(Asp499Asn) Unknown - likely benign g.31911232G>A g.31943455G>A C2(NM_000063.4):c.1495G>A (p.D499N) - C2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1716G>C r.(?) p.(Lys572Asn) Unknown - VUS g.31911569G>C g.31943792G>C C2(NM_001282458.2):c.1629G>C (p.K543N) - C2_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1811-3T>C r.spl? p.? Unknown - VUS g.31911909T>C - - - C2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1902+6G>C r.(=) p.(=) Unknown - benign g.31912009G>C g.31944232G>C C2(NM_000063.4):c.1902+6G>C - C2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1922T>C r.(?) p.(Val641Ala) Unknown - benign g.31912523T>C g.31944746T>C C2(NM_000063.4):c.1922T>C (p.V641A) - C2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1922T>C r.(?) p.(Val641Ala) Parent #1 - likely benign g.31912523T>C g.31944746T>C - - C2_000007 3 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs36221133 Germline - 3/2788 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 3 Mohammed Faruq
-/. - c.1922T>C r.(?) p.(Val641Ala) Unknown - benign g.31912523T>C - C2(NM_000063.4):c.1922T>C (p.V641A) - C2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2046A>G r.(?) p.(Ala682=) Unknown - benign g.31912773A>G g.31944996A>G C2(NM_001282458.1):c.1959A>G (p.A653=) - C2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.2171C>T r.(?) p.(Pro724Leu) Unknown - VUS g.31913046C>T g.31945269C>T C2(NM_000063.4):c.2171C>T (p.P724L), C2(NM_001282458.1):c.2084C>T (p.P695L) - C2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2171C>T r.(?) p.(Pro724Leu) Unknown - likely benign g.31913046C>T - C2(NM_000063.4):c.2171C>T (p.P724L), C2(NM_001282458.1):c.2084C>T (p.P695L) - C2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2200C>T r.(?) p.(Arg734Cys) Unknown - VUS g.31913075C>T - - - C2_000040 - Liu submitted, 2021 - - Germline - - - - - DNA SEQ-NG PBMC WES virus, COVID-19 - Liu submitted, 2021 analysis 233 patients - - China - - - - - 1 Liu Wenbing
?/. - c.2200C>T r.(?) p.(Arg734Cys) Unknown - VUS g.31913075C>T - - - C2_000040 - Liu submitted, 2021 - - Germline - - - - - DNA SEQ-NG PBMC WES virus, COVID-19 - Liu submitted, 2021 analysis 233 patients - - China - - - - - 1 Liu Wenbing
?/. - c.2200C>T r.(?) p.(Arg734Cys) Unknown - VUS g.31913075C>T - - - C2_000040 - Liu submitted, 2021 - - Germline - - - - - DNA SEQ-NG PBMC WES virus, COVID-19 - Liu submitted, 2021 analysis 233 patients - - China - - - - - 1 Liu Wenbing
?/. - c.2200C>T r.(?) p.(Arg734Cys) Unknown - VUS g.31913075C>T - - - C2_000040 - Liu submitted, 2021 - - Germline - - - - - DNA SEQ-NG PBMC WES virus, COVID-19 - Liu submitted, 2021 analysis 233 patients - - China - - - - - 1 Liu Wenbing
-?/. - c.*890T>A r.(=) p.(=) Unknown - likely benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*890T>A r.(=) p.(=) Unknown - likely benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*890T>A r.(=) p.(=) Unknown - benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*890T>A r.(=) p.(=) Unknown - benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1045C>T r.(=) p.(=) Unknown - benign g.31914179C>T g.31946402C>T CFB(NM_001710.5):c.94C>T (p.R32W) - CFB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.*1045C>T r.(=) p.(=) Unknown - VUS g.31914179C>T g.31946402C>T CFB(NM_001710.5):c.94C>T (p.R32W) - CFB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1046G>A r.(=) p.(=) Unknown - benign g.31914180G>A g.31946403G>A CFB(NM_001710.5):c.95G>A (p.R32Q) - CFB_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1046G>A r.(=) p.(=) Unknown - benign g.31914180G>A g.31946403G>A CFB(NM_001710.5):c.95G>A (p.R32Q) - CFB_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*1225A>T r.(=) p.(=) Unknown - likely benign g.31914359A>T - CFB(NM_001710.5):c.274A>T (p.T92S) - C2_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1745T>C r.(=) p.(=) Unknown - VUS g.31914879T>C g.31947102T>C CFB(NM_001710.5):c.394T>C (p.Y132H) - C2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1756C>T r.(=) p.(=) Unknown - benign g.31914890C>T g.31947113C>T - - CFB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1801A>G r.(=) p.(=) Unknown - benign g.31914935A>G g.31947158A>G - - CFB_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*2010G>A r.(=) p.(=) Unknown - benign g.31915144G>A g.31947367G>A CFB(NM_001710.5):c.504G>A (p.P168=) - CFB_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*2010G>A r.(=) p.(=) Unknown - benign g.31915144G>A g.31947367G>A CFB(NM_001710.5):c.504G>A (p.P168=) - CFB_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*2106C>T r.(=) p.(=) Unknown - benign g.31915240C>T g.31947463C>T CFB(NM_001710.5):c.600C>T (p.S200=) - CFB_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*2106C>T r.(=) p.(=) Unknown - likely benign g.31915240C>T g.31947463C>T CFB(NM_001710.5):c.600C>T (p.S200=) - CFB_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2147C>T r.(=) p.(=) Unknown - VUS g.31915281C>T - CFB(NM_001710.5):c.641C>T (p.T214M) - C2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*2398C>T r.(=) p.(=) Unknown - benign g.31915532C>T g.31947755C>T CFB(NM_001710.5):c.672C>T (p.Y224=) - CFB_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*2398C>T r.(=) p.(=) Unknown - benign g.31915532C>T g.31947755C>T CFB(NM_001710.5):c.672C>T (p.Y224=) - CFB_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.*2399G>A r.(=) p.(=) Unknown - VUS g.31915533G>A - CFB(NM_001710.5):c.673G>A (p.D225N) - C2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*2446G>A r.(=) p.(=) Unknown - benign g.31915580G>A g.31947803G>A - - C2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*2450A>C r.(=) p.(=) Unknown - likely benign g.31915584A>C g.31947807A>C CFB(NM_001710.5):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2450A>C r.(=) p.(=) Unknown - VUS g.31915584A>C g.31947807A>C CFB(NM_001710.5):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*2450A>C r.(=) p.(=) Unknown - likely benign g.31915584A>C - CFB(NM_001710.5):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*2480G>A r.(=) p.(=) Unknown - benign g.31915614G>A g.31947837G>A - - CFB_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*2685C>T r.(=) p.(=) Unknown - benign g.31915819C>T g.31948042C>T - - C2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*2879T>C r.(=) p.(=) Unknown - benign g.31916013T>C g.31948236T>C CFB(NM_001710.5):c.898-138T>C - CFB_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*3097A>C r.(=) p.(=) Unknown - likely benign g.31916231A>C - CFB(NM_001710.5):c.978A>C (p.E326D) - C2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*3463C>G r.(=) p.(=) Unknown - likely benign g.31916597C>G g.31948820C>G CFB(NM_001710.5):c.1037-10C>G - C2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*3463C>G r.(=) p.(=) Unknown - VUS g.31916597C>G g.31948820C>G CFB(NM_001710.5):c.1037-10C>G - C2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*3510C>T r.(=) p.(=) Unknown - VUS g.31916644C>T g.31948867C>T - - C2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*3542C>T r.(=) p.(=) Unknown - VUS g.31916676C>T - - - C2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*3573C>T r.(=) p.(=) Unknown - benign g.31916707C>T g.31948930C>T - - C2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*3579C>T r.(=) p.(=) Unknown - likely benign g.31916713C>T g.31948936C>T CFB(NM_001710.5):c.1143C>T (p.R381=) - CFB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*3579C>T r.(=) p.(=) Unknown - likely benign g.31916713C>T g.31948936C>T CFB(NM_001710.5):c.1143C>T (p.R381=) - CFB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*3579C>T r.(=) p.(=) Unknown - likely benign g.31916713C>T - CFB(NM_001710.5):c.1143C>T (p.R381=) - CFB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*3851T>A r.(=) p.(=) Unknown - benign g.31916985T>A g.31949208T>A CFB(NM_001710.5):c.1169-35T>A - CFB_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*4157C>T r.(=) p.(=) Unknown - benign g.31917291C>T g.31949514C>T CFB(NM_001710.5):c.1365C>T (p.V455=) - CFB_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*4157C>T r.(=) p.(=) Unknown - benign g.31917291C>T g.31949514C>T CFB(NM_001710.5):c.1365C>T (p.V455=) - CFB_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*4207A>C r.(=) p.(=) Unknown - likely benign g.31917341A>C g.31949564A>C - - C2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*4748C>T r.(=) p.(=) Unknown - VUS g.31917882C>T - - - C2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*4946C>T r.(=) p.(=) Unknown - likely benign g.31918080C>T g.31950303C>T CFB(NM_001710.5):c.1524C>T (p.H508=) - CFB_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*4946C>T r.(=) p.(=) Unknown - likely benign g.31918080C>T g.31950303C>T CFB(NM_001710.5):c.1524C>T (p.H508=) - CFB_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*4946C>T r.(=) p.(=) Unknown - likely benign g.31918080C>T g.31950303C>T CFB(NM_001710.5):c.1524C>T (p.H508=) - CFB_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*5020A>G r.(=) p.(=) Unknown - VUS g.31918154A>G g.31950377A>G CFB(NM_001710.5):c.1598A>G (p.K533R) - C2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5020A>G r.(=) p.(=) Unknown - likely benign g.31918154A>G g.31950377A>G CFB(NM_001710.5):c.1598A>G (p.K533R) - C2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*5020A>G r.(=) p.(=) Unknown - VUS g.31918154A>G - CFB(NM_001710.5):c.1598A>G (p.K533R) - C2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query