Full data view for gene CNNM4

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_020184.3 transcript reference sequence.

133 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+?/. - c.1-?_1403+?del r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? g.? CNNM4 c.1-?_1403+?del, p.? - SNRNP200_000007 homozygous PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease IV:1 PubMed: Parry 2009 family Iran M yes Iran - - - - - 1 LOVD
+?/. - c.1-?_1403+?del r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? g.? CNNM4 c.1-?_1403+?del, p.? - SNRNP200_000007 homozygous PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease IV:2 PubMed: Parry 2009 family Iran F yes Iran - - - - - 1 LOVD
+?/. - c.1-?_1403+?del r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? g.? CNNM4 c.1-?_1403+?del, p.? - SNRNP200_000007 homozygous PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease IV:3 PubMed: Parry 2009 family Iran M yes Iran - - - - - 1 LOVD
+?/. - c.1-?_1403+?del r.(?) p.? Both (homozygous) - likely pathogenic (recessive) g.? g.? CNNM4 c.1-?_1403+?del, p.? - SNRNP200_000007 homozygous PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease V:1 PubMed: Parry 2009 family Iran M yes Iran - - - - - 1 LOVD
?/. - c.29_55del r.(?) p.(Pro10_Arg18del) Unknown - VUS g.97426765_97426791del g.96761028_96761054del CNNM4(NM_020184.3):c.29_55delCGGTCGGCGGACCGGCCCGCGGGCGCC (p.P10_R18del) - CNNM4_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.64_147del r.(?) p.(Ala22_Met49del) Parent #2 - likely pathogenic (recessive) g.97426800_97426883del g.96761063_96761146del CNNM4 c.62_145del, Leu21HisfsX185 - CNNM4_000049 heterozygous; error in annotation, 3' rule, deletion coordinates corrected PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease II:3 PubMed: Parry 2009 family Guatemala M no Guatemala - - - - - 1 LOVD
+?/. - c.64_147del r.(?) p.(Ala22_Met49del) Parent #2 - likely pathogenic (recessive) g.97426800_97426883del g.96761063_96761146del CNNM4 c.62_145del, Leu21HisfsX185 - CNNM4_000049 heterozygous; error in annotation, 3' rule, deletion coordinates corrected PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease II:4 PubMed: Parry 2009 family Guatemala M no Guatemala - - - - - 1 LOVD
+?/. - c.64_147del r.(?) p.(Ala22_Met49del) Parent #2 - likely pathogenic (recessive) g.97426800_97426883del g.96761063_96761146del CNNM4 c.62_145del, Leu21HisfsX185 - CNNM4_000049 heterozygous; error in annotation, 3' rule, deletion coordinates corrected PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease II:5 PubMed: Parry 2009 family Guatemala M no Guatemala - - - - - 1 LOVD
+?/. - c.64_147del r.(?) p.(Ala22_Met49del) Parent #2 - likely pathogenic (recessive) g.97426800_97426883del g.96761063_96761146del CNNM4 c.62_145del, Leu21HisfsX185 - CNNM4_000049 heterozygous; error in annotation, 3' rule, deletion coordinates corrected PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease II:6 PubMed: Parry 2009 family Guatemala M no Guatemala - - - - - 1 LOVD
-?/. - c.69G>A r.(?) p.(Ala23=) Unknown - likely benign g.97426805G>A g.96761068G>A CNNM4(NM_020184.3):c.69G>A (p.A23=) - CNNM4_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.106C>T r.(?) p.(Arg36Trp) Unknown - VUS g.97426842C>T g.96761105C>T CNNM4(NM_020184.4):c.106C>T (p.R36W) - CNNM4_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.189del r.(?) p.(Asp63GlufsTer12) Both (homozygous) - likely pathogenic g.97426925del g.96761188del - - CNNM4_000036 - PubMed: Coppieters 2014 - - Germline - - - - - DNA SEQ - WES retinal disease Fam7 PubMed: Coppieters 2014 see paper - yes Algeria - - - - - 1 LOVD
+?/. - c.241dup r.(?) p.(Tyr81LeufsTer153) Unknown - likely pathogenic g.97426977dup g.96761240dup CNNM4(NM_020184.4):c.241dupT (p.Y81Lfs*153) - CNNM4_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.268C>T r.(?) p.(Leu90=) Unknown - likely benign g.97427004C>T g.96761267C>T CNNM4(NM_020184.4):c.268C>T (p.L90=) - CNNM4_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.275_277del r.(?) p.(Ser92del) Unknown ACMG VUS g.97427011_97427013del g.96761274_96761276del CNNM4:NM_020184 c.273_275del, p.S92del - CNNM4_000043 error in annotation:c.273_275del normalised to c.275_277del, heterozygous, individual unsolved, causality of variants unknown PubMed: Rodriguez-Munoz 2020 - - Germline ? - - - - DNA PCR, SEQ - - CRMCC - PubMed: Linnankivi 2006, PubMed: Polvi 2012 F8:II-1, patient 12 in Linnankivi et al. 2006 M no Finland Finnish >22y - - - 1 Anne Polvi
+/. - c.279delC r.(?) p.(Phe93Leufs*31) Both (homozygous) - pathogenic (recessive) g.97427015del g.96761278del CNNM4 c.279delC p.Phe93Leufs*31 - CNNM4_000062 homozygous PubMed: Prasov 2020 - - Germline yes - - - - DNA SEQ-NG, SEQ - clinical whole exome sequencing retinal disease Patient 3 PubMed: Prasov 2020 - M - United States Puerto Rican/white - - - - 1 LOVD
-?/. - c.399G>A r.(?) p.(Val133=) Unknown - likely benign g.97427135G>A g.96761398G>A CNNM4(NM_020184.3):c.399G>A (p.V133=), CNNM4(NM_020184.4):c.399G>A (p.V133=) - CNNM4_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.399G>A r.(?) p.(Val133=) Unknown - likely benign g.97427135G>A - CNNM4(NM_020184.3):c.399G>A (p.V133=), CNNM4(NM_020184.4):c.399G>A (p.V133=) - CNNM4_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.407C>A r.(?) p.(Thr136Asn) Unknown - VUS g.97427143C>A g.96761406C>A CNNM4(NM_020184.3):c.407C>A (p.T136N) - CNNM4_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.411G>A r.(?) p.(Lys137=) Unknown - likely benign g.97427147G>A g.96761410G>A CNNM4(NM_020184.3):c.411G>A (p.K137=) - CNNM4_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.434T>C r.(?) p.(Met145Thr) Unknown - VUS g.97427170T>C - CNNM4(NM_020184.3):c.434T>C (p.M145T) - CNNM4_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.471_484del r.(?) p.(Asp157GlufsTer72) Both (homozygous) - VUS g.97427207_97427220del g.96761470_96761483del c.469_482del - CNNM4_000035 variant found in controls PubMed: Liu 2015 - - Germline no - - - - DNA SEQ-NG - 316-gene panel retinal disease RH5 PubMed: Liu 2015 - - - China - - - - - 1 LOVD
?/. 1 c.482T>C r.(?) p.(Leu161Pro) Both (homozygous) ACMG VUS g.97427218T>C g.96761481T>C - - CNNM4_000066 - PubMed: Hitti-Malin 2024, Journal: Hitti-Malin 2024 - - Germline - - - - - DNA SEQ, SEQ-NG - smMIP-based 105 iMD/AMD genes macular dystrophy 073373 PubMed: Hitti-Malin 2024, Journal: Hitti-Malin 2024 - M - - - - - - - 1 Rebekkah Hitti-Malin
+?/. - c.509T>C r.(?) p.(Leu170Pro) Both (homozygous) ACMG likely pathogenic (recessive) g.97427245T>C g.96761508T>C NM_020184.3:c.509T>C;p.(Leu170Pro) - CNNM4_000037 - PubMed: Patel 2018 - - Germline yes - - - - DNA SEQ-NG - 322 eye disease gene panel (negative), WES retinal disease 13DG1743 PubMed: Patel 2018 - - likely Qatar - - - - - 1 LOVD
+?/. - c.509T>C r.(?) p.(Leu170Pro) Both (homozygous) - likely pathogenic g.97427245T>C g.96761508T>C Allele 1 c.509T>C p.(Leu170Pro), Allele 2 c.509T>C p.(Leu170Pro) - CNNM4_000037 homozygous PubMed: Khan 2019 - - Germline/De novo (untested) ? - - - - DNA ? - retrospective study retinal disease - PubMed: Khan 2019 - M - - - - - - - 1 LOVD
+?/. - c.586T>C r.(?) p.(Ser196Pro) Both (homozygous) - likely pathogenic (recessive) g.97427322T>C g.96761585T>C CNNM4 c.586T>C, Ser196Pro - CNNM4_000050 homozygous PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease II:2 PubMed: Parry 2009 family Turkey F yes Turkey - - - - - 1 LOVD
+?/. - c.586T>C r.(?) p.(Ser196Pro) Both (homozygous) - likely pathogenic (recessive) g.97427322T>C g.96761585T>C CNNM4 c.586T>C, Ser196Pro - CNNM4_000050 homozygous PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease II:3 PubMed: Parry 2009 family Turkey F yes Turkey - - - - - 1 LOVD
+?/. - c.599C>A r.(?) p.(Ser200Tyr) Both (homozygous) - likely pathogenic (recessive) g.97427335C>A g.96761598C>A CNNM4 c.599C>A, Ser200Tyr - CNNM4_000051 homozygous PubMed: Parry 2009 - - Unknown ? - - - - DNA SEQ - - retinal disease 1 PubMed: Parry 2009 family Gaza A, no pedigree, 2 affected adults analysed, no numbers - consecutive given ? yes Israel - - - - - 1 LOVD
+?/. - c.599C>A r.(?) p.(Ser200Tyr) Both (homozygous) - likely pathogenic (recessive) g.97427335C>A g.96761598C>A CNNM4 c.599C>A, Ser200Tyr - CNNM4_000051 homozygous PubMed: Parry 2009 - - Unknown ? - - - - DNA SEQ - - retinal disease 2 PubMed: Parry 2009 family Gaza A, no pedigree, 2 affected adults analysed, no numbers - consecutive given ? yes Israel - - - - - 1 LOVD
?/. - c.599C>A r.(?) p.(Ser200Tyr) Both (homozygous) ACMG VUS g.97427335C>A g.96761598C>A - - CNNM4_000051 - PubMed: Hitti-Malin 2022, Journal: Hitti-Malin 2022 - - Germline - - - - - DNA MIPsm - smMIPs 105 iMD/AMD genes retinal disease 070898 PubMed: Hitti-Malin 2022, Journal: Hitti-Malin 2022 - M - - - - - - - 1 Rebekkah Hitti-Malin
+?/. - c.706C>T r.(?) p.(Arg236Trp) Both (homozygous) - likely pathogenic (recessive) g.97427442C>T g.96761705C>T CNNM4 c.706C > T, p.Arg236Trp - CNNM4_000063 homozygous PubMed: Prasov 2020 - - Germline yes - - - - DNA SEQ-NG, SEQ - 581 gene panel from Molecular Vision Lab (MVL Panel v1) retinal disease Patient 1 PubMed: Prasov 2020 - F - United States Guatemalan - - - - 1 LOVD
+?/. - c.706C>T r.(?) p.(Arg236Trp) Both (homozygous) - likely pathogenic (recessive) g.97427442C>T g.96761705C>T CNNM4 c.706C > T, p.Arg236Trp - CNNM4_000063 homozygous PubMed: Prasov 2020 - - Germline yes - - - - DNA SEQ-NG, SEQ - Molecular Vision Lab NGS Retinal Dystrophy SmartPanel v11 (281 genes) retinal disease Patient 2 PubMed: Prasov 2020 - M - United States Guatemalan - - - - 1 LOVD
+?/. 1 c.707G>A r.(?) p.(Arg236Gln) Both (homozygous) - likely pathogenic g.97427443G>A g.96761706G>A - - CNNM4_000015 - Sharon, submitted - - Germline - - - - - DNA SEQ - - Jalili - Sharon, submitted - F yes Israel Arab-Muslim - - - - 1 Dror Sharon
+?/. - c.707G>A r.(?) p.(Arg236Gln) Unknown ACMG likely pathogenic g.97427443G>A - - - CNNM4_000015 - PubMed: Sharon 2019 - - Germline - 1/2420 IRD families - - - DNA SEQ - - retinal disease - PubMed: Sharon 2019 1 IRD family - - Israel - - - - - 1 Global Variome, with Curator vacancy
+?/. - c.707G>A r.(?) p.(Arg236Gln) Both (homozygous) - likely pathogenic (recessive) g.97427443G>A g.96761706G>A CNNM4 c.707G->A (p.R236Q) - CNNM4_000015 homozygous PubMed: Polok 2009 - - Germline yes - - - - DNA arraySNP, SEQ - - retinal disease V:6 PubMed: Polok 2009 Family B, sister of V:8 F yes Lebanon - - - - - 1 LOVD
+?/. - c.707G>A r.(?) p.(Arg236Gln) Both (homozygous) - likely pathogenic (recessive) g.97427443G>A g.96761706G>A CNNM4 c.707G->A (p.R236Q) - CNNM4_000015 homozygous PubMed: Polok 2009 - - Germline yes - - - - DNA arraySNP, SEQ - - retinal disease V:8 PubMed: Polok 2009 Family B, sister of V:6 F yes Lebanon - - - - - 1 LOVD
+?/. - c.707G>A r.(?) p.(Arg236Gln) Both (homozygous) - likely pathogenic (recessive) g.97427443G>A g.96761706G>A CNNM4 c.707G->A (p.R236Q) - CNNM4_000015 homozygous PubMed: Polok 2009 - - Germline yes - - - - DNA arraySNP, SEQ - - retinal disease V:1 PubMed: Polok 2009 Family B, cousin of V:6 and V:8 M yes Lebanon - - - - - 1 LOVD
+?/. - c.734C>T r.(?) p.(Ser245Leu) Unknown - likely pathogenic g.97427470C>T g.96761733C>T - - CNNM4_000033 - PubMed: Patel 2016 - - Germline - - - - - DNA SEQ-NG - gene panel retinal disease 10DG0615 PubMed: Patel 2016 - - - Saudi Arabia - - - - - 1 LOVD
+?/. - c.734C>T r.(?) p.(Ser245Leu) Both (homozygous) - likely pathogenic (recessive) g.97427470C>T g.96761733C>T CNNM4 c.C734T, p.Ser245Leu - CNNM4_000033 homozygous PubMed: Hirji 2018 - - Germline yes - - - - DNA ? - retrospective multicenter observational study retinal disease 6 PubMed: Hirji 2018 cousin of Patient 7 F yes - Afghani - - - - 1 LOVD
+?/. - c.734C>T r.(?) p.(Ser245Leu) Both (homozygous) - likely pathogenic (recessive) g.97427470C>T g.96761733C>T CNNM4 c.C734T, p.Ser245Leu - CNNM4_000033 homozygous PubMed: Hirji 2018 - - Germline yes - - - - DNA ? - retrospective multicenter observational study retinal disease 7 PubMed: Hirji 2018 cousin of Patient 6 M yes - Afghani - - - - 1 LOVD
?/. - c.734C>T r.(?) p.(Ser245Leu) Unknown - VUS g.97427470C>T - - - CNNM4_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.756G>C r.(?) p.(Leu252=) Unknown - likely benign g.97427492G>C - CNNM4(NM_020184.4):c.756G>C (p.L252=) - CNNM4_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 1 c.769del r.(?) p.(Leu257Serfs*5) Unknown - likely pathogenic (recessive) g.97427505del - c.767delC - CNNM4_000047 - PubMed: Liu-2020 - - Germline - - - - - DNA SEQ-NG - hereditary eye disease enrichment panel (HEDEP) retinal disease - PubMed: Liu-2020 - M - - - - - - - 1 LOVD
?/. - c.772A>C r.(?) p.(Thr258Pro) Unknown - VUS g.97427508A>C g.96761771A>C CNNM4(NM_020184.3):c.772A>C (p.T258P) - CNNM4_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.781C>T r.(?) p.(Leu261=) Unknown - likely benign g.97427517C>T - CNNM4(NM_020184.3):c.781C>T (p.L261=) - CNNM4_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.793A>C r.(?) p.(Ile265Leu) Unknown - likely benign g.97427529A>C g.96761792A>C CNNM4(NM_020184.3):c.793A>C (p.I265L, p.(Ile265Leu)) - CNNM4_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.793A>C r.(?) p.(Ile265Leu) Unknown - likely benign g.97427529A>C g.96761792A>C CNNM4(NM_020184.3):c.793A>C (p.I265L, p.(Ile265Leu)) - CNNM4_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.795C>T r.(?) p.(Ile265=) Unknown - likely benign g.97427531C>T g.96761794C>T CNNM4(NM_020184.3):c.795C>T (p.I265=) - CNNM4_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.897dup r.(?) p.(Ala300CysfsTer22) Both (homozygous) - likely pathogenic g.97427633dup g.96761896dup 896_897insT - CNNM4_000034 - PubMed: Wang 2015 - - Germline - - - - - DNA SEQ-NG - 163-gene panel retinal disease 88 PubMed: Wang 2015 index case - - China - - - - - 1 LOVD
-?/. - c.931C>T r.(?) p.(Leu311=) Unknown - likely benign g.97427667C>T g.96761930C>T CNNM4(NM_020184.3):c.931C>T (p.L311=) - CNNM4_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.939C>A r.(?) p.(Thr313=) Unknown - benign g.97427675C>A g.96761938C>A CNNM4(NM_020184.4):c.939C>A (p.T313=) - CNNM4_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.971T>C r.(?) p.(Leu324Pro) Parent #1 - likely pathogenic (recessive) g.97427707T>C g.96761970T>C CNNM4 c.971T>C, Leu324Pro - CNNM4_000052 heterozygous PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease III:1 PubMed: Parry 2009 family Scotland M no Scotland - - - - - 1 LOVD
+?/. - c.971T>C r.(?) p.(Leu324Pro) Both (homozygous) - likely pathogenic (recessive) g.97427707T>C g.96761970T>C CNNM4 c.971T->C (p.L324P) - CNNM4_000052 homozygous PubMed: Polok 2009 - - Germline yes - - - - DNA arraySNP, SEQ - - retinal disease ? PubMed: Polok 2009 Family C, isolated patient F - - - - - - - 1 LOVD
+?/. - c.971T>C r.(?) p.(Leu324Pro) Both (homozygous) - likely pathogenic (recessive) g.97427707T>C g.96761970T>C CNNM4 c.971T>C, Leu324Pro - CNNM4_000052 homozygous PubMed: Maia 2018 - - Germline yes - - - - DNA SEQ buccal mucosa cells - retinal disease A-1 PubMed: Maia 2018 Family A, parents third cousins; proband (single case) F yes Brazil - - - - - 1 LOVD
+?/. - c.971T>C r.(?) p.(Leu324Pro) Maternal (confirmed) - likely pathogenic (recessive) g.97427707T>C g.96761970T>C CNNM4 c.971T>C, Leu324Pro - CNNM4_000052 heterozygous PubMed: Maia 2018 - - Germline yes - - - - DNA SEQ buccal mucosa cells - retinal disease B-1 PubMed: Maia 2018 Family B; proband (single case) F no Brazil - - - - - 1 LOVD
?/. - c.973G>A r.(?) p.(Asp325Asn) Unknown - VUS g.97427709G>A g.96761972G>A - - CNNM4_000032 - PubMed: Tiwari 2016 - - Germline - - - - - DNA SEQ-NG - WES retinal disease Case71780 PubMed: Tiwari 2016 see paper M - Switzerland - - - - - 1 LOVD
+?/. 4 c.1076T>C r.(?) p.(Leu359Pro) Both (homozygous) - likely pathogenic (recessive) g.97427812T>C g.96762075T>C CNNM4 c.1076T>C, p.(Leu359Pro) - CNNM4_000053 homozygous PubMed: Wawrocka 2017 - - Germline yes - - - - DNA SEQ-NG, SEQ blood exome sequencing retinal disease p1 PubMed: Wawrocka 2017 Polish family, consanguineous; third cousin parents M yes Poland Polish - - - - 1 LOVD
+?/. 4 c.1076T>C r.(?) p.(Leu359Pro) Both (homozygous) - likely pathogenic (recessive) g.97427812T>C g.96762075T>C CNNM4 c.1076T>C, p.(Leu359Pro) - CNNM4_000053 homozygous PubMed: Wawrocka 2017 - - Germline yes - - - - DNA SEQ blood exome sequencing retinal disease p2 PubMed: Wawrocka 2017 Polish family, consanguineous; third cousin parents M yes Poland Polish - - - - 1 LOVD
+?/. 4 c.1076T>C r.(?) p.(Leu359Pro) Both (homozygous) - likely pathogenic (recessive) g.97427812T>C g.96762075T>C CNNM4 c.1076T>C, p.(Leu359Pro) - CNNM4_000053 homozygous PubMed: Wawrocka 2017 - - Germline yes - - - - DNA SEQ blood exome sequencing retinal disease p3 PubMed: Wawrocka 2017 Polish family, consanguineous; third cousin parents M yes Poland Polish - - - - 1 LOVD
+?/. 1 c.1091delG r.(?) p.(Gly364Valfs*10) Both (homozygous) - likely pathogenic (recessive) g.97427827del g.96762090del CNNM4 c.1091delG - CNNM4_000054 homozygous PubMed: Rahimi-Aliabadi 2016 - - Germline yes - - - - DNA SEQ blood - retinal disease IV.22 PubMed: Rahimi-Aliabadi 2016 Iranian family F yes Iran - - - - - 1 LOVD
+?/. 1 c.1091delG r.(?) p.(Gly364Valfs*10) Both (homozygous) - likely pathogenic (recessive) g.97427827del g.96762090del CNNM4 c.1091delG - CNNM4_000054 homozygous PubMed: Rahimi-Aliabadi 2016 - - Germline yes - - - - DNA SEQ blood - retinal disease V.9 PubMed: Rahimi-Aliabadi 2016 Iranian family F yes Iran - - - - - 1 LOVD
+?/. 1 c.1091delG r.(?) p.(Gly364Valfs*10) Both (homozygous) - likely pathogenic (recessive) g.97427827del g.96762090del CNNM4 c.1091delG - CNNM4_000054 homozygous PubMed: Rahimi-Aliabadi 2016 - - Germline yes - - - - DNA SEQ blood - retinal disease V.20 PubMed: Rahimi-Aliabadi 2016 Iranian family M yes Iran - - - - - 1 LOVD
+?/. 1 c.1091delG r.(?) p.(Gly364Valfs*10) Both (homozygous) - likely pathogenic (recessive) g.97427827del g.96762090del CNNM4 c.1091delG - CNNM4_000054 homozygous PubMed: Rahimi-Aliabadi 2016 - - Germline yes - - - - DNA SEQ blood - retinal disease V.8 PubMed: Rahimi-Aliabadi 2016 Iranian family M yes Iran - - - - - 1 LOVD
+?/. - c.1220G>T r.(?) p.(Arg407Leu) Both (homozygous) - likely pathogenic (recessive) g.97427956G>T g.96762219G>T CNNM4 c.1220G>T, p.Arg407Leu - CNNM4_000055 homozygous PubMed: Parveen 2019 - - Germline yes - - - - DNA SEQ blood - retinal disease IV-3 PubMed: Parveen 2019 Pakistani family, proband F yes - Pakistani - - - - 1 LOVD
+?/. - c.1220G>T r.(?) p.(Arg407Leu) Both (homozygous) - likely pathogenic (recessive) g.97427956G>T g.96762219G>T CNNM4 c.1220G>T, p.Arg407Leu - CNNM4_000055 homozygous PubMed: Parveen 2019 - - Germline yes - - - - DNA SEQ blood - retinal disease IV-4 PubMed: Parveen 2019 Pakistani family, proband's sister 1 F yes - Pakistani - - - - 1 LOVD
+?/. - c.1220G>T r.(?) p.(Arg407Leu) Both (homozygous) - likely pathogenic (recessive) g.97427956G>T g.96762219G>T CNNM4 c.1220G>T, p.Arg407Leu - CNNM4_000055 homozygous PubMed: Parveen 2019 - - Germline yes - - - - DNA SEQ blood - retinal disease IV-5 PubMed: Parveen 2019 Pakistani family, proband's sister 2 F yes - Pakistani - - - - 1 LOVD
+?/. - c.1226C>T r.(?) p.(Pro409Leu) Both (homozygous) - likely pathogenic (recessive) g.97427962C>T g.96762225C>T CNNM4 c.1226C>T, p.Pro409Leu - CNNM4_000056 homozygous PubMed: Hirji 2018 - - Germline yes - - - - DNA ? - retrospective multicenter observational study retinal disease 4 PubMed: Hirji 2018 - M yes - Pakistani - - - - 1 LOVD
+?/. - c.1312del r.(?) p.(Leu438Serfs*41) Parent #1 - likely pathogenic (recessive) g.97428048del g.96762311del CNNM4 c.1307delC, p.Leu438Serfs*41 - CNNM4_000057 homozygous PubMed: Hirji 2018 - - Germline yes - - - - DNA ? - retrospective multicenter observational study retinal disease 5 PubMed: Hirji 2018 - M no - English/Irish/German - - - - 1 LOVD
+?/. - c.1312dup r.(?) p.(Leu438Profs*9) Parent #1 - likely pathogenic g.97428048dup g.96762311dup CNNM4, variant 1: c.1312dup/p.L438Pfs*9, variant 2: c.1312dup/p.L438Pfs*9 - CNNM4_000046 solved, homozygous PubMed: Weisschuh 2020 - - Unknown ? - - - - DNA SEQ-NG blood RET3 targeted sequencing panel - see paper retinal disease 966 PubMed: Weisschuh 2020 Filing key number: 432, cone-rod dystrophy, no patient Ids, consecutive numbers given M - Germany - - - - - 1 LOVD
+?/. - c.1312dup r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312dupC, Leu438ProfsX9 - CNNM4_000046 homozygous PubMed: Parry 2009 - - Unknown ? - - - - DNA SEQ - - retinal disease ? PubMed: Parry 2009 family Kosovo ? no Kosovo - - - - - 1 LOVD
+?/. - c.1312dup r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312dupC, p.Leu438ProfsX9 - CNNM4_000046 homozygous PubMed: Zobor 2012 - - Germline yes - - - - DNA SEQ - - retinal disease ? PubMed: Zobor 2012 - F yes Kosovo Kosovan - - - - 1 LOVD
+?/. - c.1312dup r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312dupC, p.Leu438ProfsX9 - CNNM4_000046 homozygous PubMed: Luder 2013 - - Germline yes - - - - DNA SEQ - - retinal disease 1 PubMed: Luder 2013 Kosovan family, no patient numbering - consecutive numbers given; brother of 2 M no - Kosovan - - - - 1 LOVD
+?/. - c.1312dup r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312dupC, p.Leu438ProfsX9 - CNNM4_000046 homozygous PubMed: Luder 2013 - - Germline yes - - - - DNA SEQ - - retinal disease 2 PubMed: Luder 2013 Kosovan family, no patient numbering - consecutive numbers given; brother of 1 M no - Kosovan - - - - 1 LOVD
+?/. - c.1312dup r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312dupC, p.L438Pfs*9 - CNNM4_000046 homozygous PubMed: Gerth-Kahlert 2015 - - Germline yes - - - - DNA SEQ - - retinal disease III:4 PubMed: Gerth-Kahlert 2015 Kosovan family, sister of III:5 F no - Kosovan - - - - 1 LOVD
+?/. - c.1312dup r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312dupC, p.L438Pfs*9 - CNNM4_000046 homozygous PubMed: Gerth-Kahlert 2015 - - Germline yes - - - - DNA SEQ - - retinal disease III:5 PubMed: Gerth-Kahlert 2015 Kosovan family, sister of III:4 F no - Kosovan - - - - 1 LOVD
+?/. - c.1312dup r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312dupC, p.Leu438Profs*9 - CNNM4_000046 homozygous PubMed: Hirji 2018 - - Germline yes - - - - DNA ? - retrospective multicenter observational study retinal disease 3 PubMed: Hirji 2018 - M no - Kosovan - - - - 1 LOVD
+?/. - c.1312dupC r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312 dupC - CNNM4_000046 homozygous PubMed: Polok 2009 - - Germline yes - - - - DNA arraySNP, SEQ - - retinal disease II:1 PubMed: Polok 2009 Family A, sister of II:4 F no Kosovo - - - - - 1 LOVD
+?/. - c.1312dupC r.(?) p.(Leu438Profs*9) Both (homozygous) - likely pathogenic (recessive) g.97428048dup g.96762311dup CNNM4 c.1312 dupC - CNNM4_000046 homozygous PubMed: Polok 2009 - - Germline yes - - - - DNA arraySNP, SEQ - - retinal disease II:4 PubMed: Polok 2009 Family A, brother 2 of II:1 M no Kosovo - - - - - 1 LOVD
?/. - c.1337A>G r.(?) p.(Asn446Ser) Unknown - VUS g.97428073A>G g.96762336A>G CNNM4(NM_020184.3):c.1337A>G (p.N446S) - CNNM4_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1431G>A r.(?) p.(Lys477=) Unknown - likely benign g.97462777G>A g.96797040G>A CNNM4(NM_020184.3):c.1431G>A (p.K477=) - CNNM4_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2 c.1484C>T r.(?) p.(Thr495Ile) Both (homozygous) - pathogenic g.97462830C>T g.96797093C>T - - CNNM4_000001 - PubMed: Abu-Safieh-2013 - - Germline - - - - - DNA SEQ-NG-I - - CORD - PubMed: Abu-Safieh-2013 - - - - - - - - - 1 Leen Abu Safieh
+?/. - c.1484C>T r.(?) p.(Thr495Ile) Unknown - likely pathogenic g.97462830C>T g.96797093C>T - - CNNM4_000001 - PubMed: Patel 2016 - - Germline - - - - - DNA SEQ-NG - gene panel retinal disease 11DG1725 PubMed: Patel 2016 - - - Saudi Arabia - - - - - 1 LOVD
+?/. 2 c.1494C>A r.(?) p.(Asp498Glu) Both (homozygous) - likely pathogenic (recessive) g.97462840C>A g.96797103C>A - - CNNM4_000016 - PubMed: Beryozkin 2015, PubMed: Sharon 2019 - - Germline - - - - - DNA SEQ - - Jalili MOL0367 PubMed: Beryozkin 2015, PubMed: Sharon 2019 family F yes Israel Druze - - - - 1 Dror Sharon
+/. - c.1494C>A r.(?) p.(Asp498Glu) Unknown ACMG pathogenic g.97462840C>A - - - CNNM4_000016 - PubMed: Sharon 2019 - - Germline - 3/2420 IRD families - - - DNA SEQ - - retinal disease - PubMed: Sharon 2019 family - - Israel - - - - - 1 Global Variome, with Curator vacancy
+/. - c.1494C>A r.(?) p.(Asp498Glu) Unknown ACMG pathogenic g.97462840C>A - - - CNNM4_000016 - PubMed: Sharon 2019 - - Germline - 3/2420 IRD families - - - DNA SEQ - - retinal disease - PubMed: Sharon 2019 family - - Israel - - - - - 1 Dror Sharon
-?/. - c.1494C>T r.(?) p.(Asp498=) Unknown - likely benign g.97462840C>T g.96797103C>T CNNM4(NM_020184.3):c.1494C>T (p.D498=) - CNNM4_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1495G>A r.(?) p.(Val499Met) Both (homozygous) - pathogenic (recessive) g.97462841G>A g.96797104G>A - - CNNM4_000044 - PubMed: Prasad 2016 - - Germline - - - - - DNA SEQ, SEQ-NG - disease gene panel AI V2.05 PubMed: Prasad 2016 - M yes - - - - - - 1 Johan den Dunnen
-/. - c.1500C>T r.(?) p.(Ile500=) Unknown - benign g.97462846C>T g.96797109C>T CNNM4(NM_020184.3):c.1500C>T (p.I500=), CNNM4(NM_020184.4):c.1500C>T (p.I500=) - CNNM4_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1500C>T r.(?) p.(Ile500=) Unknown - likely benign g.97462846C>T g.96797109C>T CNNM4(NM_020184.3):c.1500C>T (p.I500=), CNNM4(NM_020184.4):c.1500C>T (p.I500=) - CNNM4_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1547-16G>A r.(=) p.(=) Unknown - benign g.97463234G>A g.96797497G>A CNNM4(NM_020184.4):c.1547-16G>A - CNNM4_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 4 c.1682-1G>C r.spl p.(Glu561Glyfs*5) Both (homozygous) - likely pathogenic (recessive) g.97464793G>C g.96799056G>C CNNM4 c.1682-1G > C - CNNM4_000058 substitution resulting in deletion of AG in cDNA and subsequent frameshift; homozygous PubMed: Cherkaoui Jaouad 2017 - - Germline yes - - - - DNA SEQ blood - retinal disease IV-2 PubMed: Cherkaoui Jaouad 2017 Moroccan family; proband's sister 1 F yes Morocco - - - - - 1 LOVD
+?/. 4 c.1682-1G>C r.spl p.(Glu561Glyfs*5) Both (homozygous) - likely pathogenic (recessive) g.97464793G>C g.96799056G>C CNNM4 c.1682-1G > C - CNNM4_000058 substitution resulting in deletion of AG in cDNA and subsequent frameshift; homozygous PubMed: Cherkaoui Jaouad 2017 - - Germline yes - - - - DNA SEQ blood - retinal disease IV-3 PubMed: Cherkaoui Jaouad 2017 Moroccan family; proband F yes Morocco - - - - - 1 LOVD
+?/. 4 c.1682-1G>C r.spl p.(Glu561Glyfs*5) Both (homozygous) - likely pathogenic (recessive) g.97464793G>C g.96799056G>C CNNM4 c.1682-1G > C - CNNM4_000058 substitution resulting in deletion of AG in cDNA and subsequent frameshift; homozygous PubMed: Cherkaoui Jaouad 2017 - - Germline yes - - - - DNA SEQ blood - retinal disease IV-4 PubMed: Cherkaoui Jaouad 2017 Moroccan family; proband's sister 2 F yes Morocco - - - - - 1 LOVD
+?/. - c.1690C>T r.(?) p.(Gln564*) Parent #2 - likely pathogenic (recessive) g.97464802C>T g.96799065C>T CNNM4 c.1690C>T, Gln564X - CNNM4_000059 heterozygous PubMed: Parry 2009 - - Germline yes - - - - DNA SEQ - - retinal disease III:1 PubMed: Parry 2009 family Scotland M no Scotland - - - - - 1 LOVD
+?/. - c.1690C>T r.(?) p.(Gln564*) Parent #2 - likely pathogenic (recessive) g.97464802C>T g.96799065C>T CNNM4 c.C1690T, p.Gln564* - CNNM4_000059 homozygous PubMed: Hirji 2018 - - Germline yes - - - - DNA ? - retrospective multicenter observational study retinal disease 5 PubMed: Hirji 2018 - M no - English/Irish/German - - - - 1 LOVD
+?/. - c.1743C>G r.(?) p.(Tyr581*) Paternal (confirmed) - likely pathogenic (recessive) g.97464855C>G g.96799118C>G CNNM4 c.971T>C, Leu324Pro - CNNM4_000060 heterozygous PubMed: Maia 2018 - - Germline yes - - - - DNA SEQ buccal mucosa cells - retinal disease B-1 PubMed: Maia 2018 Family B; proband (single case) F no Brazil - - - - - 1 LOVD
?/. - c.1750G>A r.(?) p.(Val584Ile) Unknown - VUS g.97464862G>A g.96799125G>A CNNM4(NM_020184.3):c.1750G>A (p.V584I) - CNNM4_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 4 c.1781A>G r.(?) p.(Asn594Ser) Both (homozygous) - likely pathogenic (recessive) g.97464893A>G g.96799156A>G CNNM4 c.1781A>G (p.N594S) - CNNM4_000061 homozygous PubMed: Topcu 2017 - - Germline yes - - - - DNA SEQ blood - retinal disease V-1 PubMed: Topcu 2017 Turkish family, sister of V-2 and V-3 F yes Turkey - - - - - 1 LOVD
+?/. 4 c.1781A>G r.(?) p.(Asn594Ser) Both (homozygous) - likely pathogenic (recessive) g.97464893A>G g.96799156A>G CNNM4 c.1781A>G (p.N594S) - CNNM4_000061 homozygous PubMed: Topcu 2017 - - Germline yes - - - - DNA SEQ blood - retinal disease V-2 PubMed: Topcu 2017 Turkish family, sister of V-1 and V-3 F yes Turkey - - - - - 1 LOVD
+?/. 4 c.1781A>G r.(?) p.(Asn594Ser) Both (homozygous) - likely pathogenic (recessive) g.97464893A>G g.96799156A>G CNNM4 c.1781A>G (p.N594S) - CNNM4_000061 homozygous PubMed: Topcu 2017 - - Germline yes - - - - DNA SEQ blood - retinal disease V-3 PubMed: Topcu 2017 Turkish family, sister of V-2 and V-1 F yes Turkey - - - - - 1 LOVD
Legend   How to query   « First ‹ Prev     1 2     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.