Full data view for gene COL4A3

Information The variants shown are described using the NM_000091.4 transcript reference sequence.

783 entries on 8 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3 4 5 6 7 8     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

Allele     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age/Death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
?/. 1 c.-26G>T VUS r.(?) p.(=) Parent #1 g.228029417G>T - - - COL4A3_000456 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - M - United Kingdom (Great Britain) - - 0 - - 1 Judy Savige
-?/. 1 c.-10C>T - r.(?) p.(=) Unknown g.228029433C>T g.227164717C>T 1-10C>T 3'UTR - COL4A3_000001 - PubMed: Tazon Vega 2003 - - Germline - - - 0 - DNA HD, SSCA, SEQ - - ? - PubMed: Tazon Vega 2003 - - - Spain - - 0 - - 1 Judy Savige
+/. _1_1i c.(?_-1)_(87+1_88-1)del VUS r.0? p.0? Parent #1 g.(?_228029442)_(228029530_228102683)del - del ex1 - COL4A3_000446 - PubMed: Mencarelli 2015, Journal: Mencarelli 2015 - - Germline - - - 0 - DNA SEQ-NG blood - ASAR - PubMed: Mencarelli 2015, Journal: Mencarelli 2015 3-generation family, 3 affecteds (3M), father and paternal uncle died with ESRF M - - Europe - 0 - - 3 Judy Savige
+/. _1_1i c.(?_-1)_(87+1_88-1)del - r.0? p.0? Paternal (confirmed) g.(227985865_228004876)_(228029530_228102683)del - del ex1 COL4A3, ex1-4 COL4A4 - COL4A4_000408 - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - ASAD - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - - France - - 0 - - 1 Judy Savige
+/. 14 c.? - r.805_828del p.Glu269_Ser276del Parent #2 g.? - 805_828delGAGCCTGGACCTCCTGGACCCTCA - COL4A3_000000 - PubMed: Zhang 2011 - - Germline - - - 0 - DNA SEQ - - ASAR 21143337-Fam5 PubMed: Zhang 2011 - - - China - - 0 - - 1 Johan den Dunnen
+/+? 1 c.1A>T - r.(?) p.0? Unknown g.228029443A>T g.227164727A>T M1L - COL4A3_000002 nonsense; Compound heterozygous; PubMed: Longo 2002 - - Germline - - - 0 - DNA SSCA, SEQ - - ASAR - PubMed: Longo 2002 - F - Italy - - 0 - - 1 Judy Savige
./. 1 c.2T>A VUS r.(?) p.0? Parent #1 g.228029444T>A - p.Met1Lys - COL4A3_000457 - PubMed: Weber 2016, Journal: Weber 2016 - - Germline - - - 0 - DNA SEQ blood - AS - PubMed: Weber 2016, Journal: Weber 2016 - M - Germany - - 0 - - 1 Judy Savige
./. 1 c.2T>C - r.(?) p.0? Unknown g.228029444T>C g.227164728T>C Met1Thr - COL4A3_000250 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 1 c.2T>C VUS r.(?) p.0? Parent #1 g.228029444T>C - p.Met1Thr - COL4A3_000250 - PubMed: Uzak 2013 - - Germline - - - 0 - DNA SEQ blood - ASAR - PubMed: Uzak 2013 Diagnosed at 11 years. Three of her relatives also diagnosed as Alport syndrome, progressed to ESRD M - Turkey Turkish - 0 - - 1 Judy Savige
./. 1 c.2T>G VUS r.(?) p.0? Parent #1 g.228029444T>G - p.Met1Arg - COL4A3_000458 - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - ASAR - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - - France - - 0 - - 1 Judy Savige
./. 1 c.3G>A - r.(?) p.0? Unknown g.228029445G>A g.227164729G>A Met1Ile - COL4A3_000251 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 1 c.19C>A - r.(?) p.(Pro7Thr) Unknown g.228029461C>A g.227164745C>A - - COL4A3_000252 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 1 c.21C>A - r.(?) p.(Pro7=) Unknown g.228029463C>A g.227164747C>A - - COL4A3_000178 - 1000 genome; NCBI - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Judy Savige
?/. 1 c.26C>T VUS r.(?) p.(Pro9Leu) Parent #1 g.228029468C>T - - - COL4A3_000459 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - M - United Kingdom (Great Britain) - - 0 - - 1 Judy Savige
+/+? 1 c.40_63del - r.(?) p.(Leu14_Leu21del) Unknown g.228029482_228029505del g.227164766_227164789del 40del24 - COL4A3_000003 - PubMed: Longo 2002 - - Germline - - - 0 - DNA SSCA, SEQ - - ASAD - PubMed: Longo 2002 - M - Italy - - 0 - - 1 Judy Savige
+/+? 1 c.40_63del - r.(?) p.(Leu14_Leu21del) Unknown g.228029482_228029505del g.227164766_227164789del 40_63delCTGCCGCTCCTGCTGGTGCTCCTG (del LPLLLVLL) - COL4A3_000003 Compound heterozygous PubMed: Tazon Vega 2003 - - Germline - - - 0 - DNA HD, SSCA, SEQ - - ASAR - PubMed: Tazon Vega 2003 - F - Spain - - 0 - - 1 Judy Savige
./. 1 c.40_63del - r.(?) p.(Leu14_Leu21del) Unknown g.228029482_228029505del g.227164766_227164789del 40_63delCTGCCGCTCCTGCTGGTGCTCCTG - COL4A3_000003 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
+/. 1 c.40_63del pathogenic r.(?) p.(Leu14_Leu21del) Parent #1 g.228029482_228029505del - - - COL4A3_000003 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - F - United Kingdom (Great Britain) - - 0 - - 1 Judy Savige
./. 1 c.40_63del VUS r.(?) p.(Leu14_Leu21del) Parent #1 g.228029482_228029505del - 30_53del - COL4A3_000003 - PubMed: Chatterjee 2013, Journal: Chatterjee 2013 - - Germline - - - 0 - DNA SEQ-NG blood WES ASAR - PubMed: Chatterjee 2013, Journal: Chatterjee 2013 25 yo with FH of haematuria. Presented at age 2 yo, developed proteinuria at 7. Renal biopsy confirmed Alport syndrome. By age 10, she had a hearing loss. At 21, macular flecks. This deletion has been reported previously in Alport syndrome. The 24 bp deletion removes 8 aa from the signal peptide, possibly altering COL4A3 secretion, as predicted by three different programs. F - Italy Italian - 0 - - 1 Judy Savige
+/. 1 c.40_63del pathogenic r.(?) p.(Leu14_Leu21del) Parent #1 g.228029482_228029505del - - - COL4A3_000003 - PubMed: Oka 2014, Journal: Oka 2014 - - Germline - - - 0 - DNA PCRq, RT-PCR, SEQ blood - ASAR - PubMed: Oka 2014, Journal: Oka 2014 - F - Japan Japanese - 0 - - 1 Judy Savige
+/. 1 c.40_63del pathogenic r.(?) p.(Leu14_Leu21del) Parent #1 g.228029482_228029505del - - - COL4A3_000003 - PubMed: Oka 2014, Journal: Oka 2014 - - Germline - - - 0 - DNA PCRq, RT-PCR, SEQ blood - ASAR - PubMed: Oka 2014, Journal: Oka 2014 - F - Japan Japanese - 0 - - 1 Judy Savige
+/. 1 c.40_63del pathogenic r.(?) p.(Leu14_Leu21del) Both (homozygous) g.228029482_228029505del - - - COL4A3_000003 - PubMed: Oka 2014, Journal: Oka 2014 - - Germline - - - 0 - DNA PCRq, RT-PCR, SEQ blood - ASAR - PubMed: Oka 2014, Journal: Oka 2014 - F - Japan Japanese - 0 - - 1 Judy Savige
./. 1 c.40_63del VUS r.(?) p.(Leu14_Leu21del) Unknown g.228029482_228029505del - 40_63delCTGCCGCTCCTGCTGGTGCTCCTG - COL4A3_000003 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - M - China Chinese - 0 - - 1 Judy Savige
./. 1 c.40_66del - r.(?) p.(Leu14_Ala22del) Unknown g.228029482_228029508del g.227164766_227164792del - - COL4A3_000254 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
?/. 1 c.43_54del VUS r.(?) p.(Pro15_Leu18del) Parent #1 g.228029485_228029496del - - - COL4A3_000460 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - F - United Kingdom (Great Britain) - - 0 - - 1 Judy Savige
+?/. 1 c.71C>G - r.(?) p.(Ala24Gly) Unknown g.228029513C>G g.227164797C>G - - COL4A3_000179 - 1000 genome; NCBI - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Judy Savige
+?/. 1 c.73C>T - r.(?) p.(Pro25Ser) Unknown g.228029515C>T g.227164799C>T - - COL4A3_000180 - 1000 genome; NCBI - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Judy Savige
-/. - c.88-4C>T benign r.spl? p.? Unknown g.228102680C>T - COL4A3:c.88-4C>T - COL4A3_000402 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
./. 1i_50i c.88-?_4755+?dup VUS r.? p.? Parent #1 g.228102684_228174034dup - 88-?_4755+?dup - COL4A3_000461 - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - ASAR - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - - France - - 0 - - 1 Judy Savige
./. 2 c.96dup - r.(?) p.(Cys33Leufs*2) Unknown g.228102692dup g.227237976dup c.95_96insC - COL4A3_000255 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 2 c.127G>A - r.(?) p.(Gly43Arg) Unknown g.228102723G>A g.227238007G>A - - COL4A3_000004 Missense PubMed: Badenas 2002 - - Germline - - - 0 - DNA SSCA, SEQ - - BFH;TBMN - PubMed: Badenas 2002 - - - Spain - - 0 - - 1 Judy Savige
./. 2 c.127G>A - r.(?) p.(Gly43Arg) Unknown g.228102723G>A g.227238007G>A - - COL4A3_000004 Polymorphism PubMed: Slajpah 2007 - - Germline - - - 0 - DNA SSCA, SEQ - - ? - PubMed: Slajpah 2007 - - - Slovenia - - 0 - - 1 Judy Savige
./. 2 c.127G>A - r.(?) p.(Gly43Arg) Unknown g.228102723G>A g.227238007G>A - - COL4A3_000004 Polymorphism PubMed: Wang 2004 - - Germline - - - 0 - DNA SSCA, SEQ - - BFH;TBMN - PubMed: Wang 2004 - - - - - - 0 - - 1 Judy Savige
-/-? 2 c.127G>C - r.(?) p.(Gly43Arg) Unknown g.228102723G>C g.227238007G>C - - COL4A3_000005 Polymorphism PubMed: Heidet 2001 - - Germline - - - 0 - DNA, RNA SSCA, RT-PCR, SEQ - - ASAR - PubMed: Heidet 2001 - - - - - - 0 - - 26 Judy Savige
-/-? 2 c.127G>C - r.(?) p.(Gly43Arg) Unknown g.228102723G>C g.227238007G>C - - COL4A3_000005 Polymorphism PubMed: Longo 2002 - - Germline - - - 0 - DNA SSCA, SEQ - - ASAR - PubMed: Longo 2002 - - - Italy - - 0 - - 1 Judy Savige
-/-? 2 c.127G>C - r.(?) p.(Gly43Arg) Unknown g.228102723G>C g.227238007G>C - - COL4A3_000005 Polymorphism PubMed: Tazon Vega 2003 - - Germline - - - 0 - DNA HD, SSCA, SEQ - - ? - PubMed: Tazon Vega 2003 - - - Spain - - 0 - - 1 Judy Savige
./. 2 c.127G>C - r.(?) p.(Gly43Arg) Unknown g.228102723G>C g.227238007G>C - - COL4A3_000005 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
-/. - c.127G>C benign r.(?) p.(Gly43Arg) Unknown g.228102723G>C - COL4A3:c.127G>C (G43R) - COL4A3_000005 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. 2 c.127G>C benign r.(?) p.(Gly43Arg) Parent #1 g.228102723G>C - - - COL4A3_000005 - PubMed: Kovacs 2016, Journal: Kovacs 2016 - - Germline - - - 0 - DNA SEQ, SEQ-NG blood - ASAR - PubMed: Kovacs 2016, Journal: Kovacs 2016 - - - Hungary Hungarian - 0 - - 1 Judy Savige
./. 2i c.144+12C>A - r.(?) p.(=) Unknown g.228102752C>A g.227238036C>A - - COL4A3_000006 - PubMed: Badenas 2002 - - Germline - - - 0 - DNA SSCA, SEQ - - BFH;TBMN - PubMed: Badenas 2002 - - - Spain - - 0 - - 1 Judy Savige
./. 2i c.144+12C>A - r.(?) p.(=) Unknown g.228102752C>A g.227238036C>A - - COL4A3_000006 - PubMed: Tazon Vega 2003 - - Germline - - - 0 - DNA HD, SSCA, SEQ - - ? - PubMed: Tazon Vega 2003 - - - Spain - - 0 - - 1 Judy Savige
./. 2i c.144+12C>A - r.(?) p.(=) Unknown g.228102752C>A g.227238036C>A - - COL4A3_000006 - PubMed: Wang 2004 - - Germline - - - 0 - DNA SSCA, SEQ - - ? - PubMed: Wang 2004 - - - - - - 0 - - 1 Judy Savige
-/. - c.144+12C>A benign r.(=) p.(=) Unknown g.228102752C>A - COL4A3:c.144+12C>A - COL4A3_000006 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.144+12C>A benign r.(=) p.(=) Unknown g.228102752C>A - LOC654841:c.1681+50G>T - COL4A3_000006 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. 2i c.144+12C>A benign r.(?) p.(=) Parent #1 g.228102752C>A - - - COL4A3_000006 - PubMed: Kovacs 2016, Journal: Kovacs 2016 - - Germline - - - 0 - DNA SEQ, SEQ-NG blood - ASAR - PubMed: Kovacs 2016, Journal: Kovacs 2016 - - - Hungary Hungarian - 0 - - 1 Judy Savige
./. 3 c.145G>C VUS r.(?) p.(Gly49Arg) Parent #1 g.228104859G>C - - - COL4A3_000462 - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - ASAR - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - - France - - 0 - - 1 Judy Savige
./. 2i c.162-2A>G VUS exon 3 (90 bp) skip p.? Parent #1 g.228104874A>G - - - COL4A3_000463 - PubMed: Oka 2014, Journal: Oka 2014 - - Germline - - - 0 - DNA PCRq, RT-PCR, SEQ blood - ASAR - PubMed: Oka 2014, Journal: Oka 2014 - F - Japan Japanese - 0 - - 1 Judy Savige
+/. 3 c.162dup - r.(?) p.(Gly55Trpfs*15) Parent #1 g.228104876dup g.227240160dup - - COL4A3_000246 - PubMed: Storey 2013 - - Germline - - - 0 - DNA SEQ - - ASAR - PubMed: Storey 2013 - M - Australia Tasmanian, British origin - 0 - - 1 Helen Storey
./. 3 c.162dup - r.(?) p.(Gly55Trpfs*15) Unknown g.228104876dup g.227240160dup 162_163insT - COL4A3_000246 - - - - Germline - - - 0 - DNA SEQ - - ? - Judy Savige - M - - British - 0 - - 1 Judy Savige
./. 3 c.162dup - r.(?) p.(Gly55Trpfs*15) Unknown g.228104876dup g.227240160dup 162_163insT - COL4A3_000246 - - - - Germline - - - 0 - DNA SEQ - - ? - Judy Sacvige - M - - British - 0 - - 1 Judy Savige
./. 3 c.162dup - r.(?) p.(Gly55Trpfs*15) Unknown g.228104876dup g.227240160dup 162_163insT - COL4A3_000246 - - - - Germline - - - 0 - DNA SEQ - - ? - Judy Savige - M - - British - 0 - - 1 Judy Savige
+/. 3 c.172G>A - r.(?) p.(Gly58Ser) Unknown g.228104886G>A g.227240170G>A - - COL4A3_000181 - 1000 genome; NCBI - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Judy Savige
./. 3 c.172G>C VUS r.(?) p.(Gly58Arg) Parent #1 g.228104886G>C - - - COL4A3_000464 - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - ASAR - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - - France - - 0 - - 1 Judy Savige
./. 3 c.222G>A - r.(?) p.(Pro74=) Unknown g.228104936G>A g.227240220G>A - - COL4A3_000182 - 1000 genome; NCBI - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Judy Savige
./. 3 c.222G>T - r.(?) p.(Pro74Pro) Unknown g.228104936G>T g.227240220G>T - - COL4A3_000007 - PubMed: Tazon Vega 2003 - - Germline - - - 0 - DNA HD, SSCA, SEQ - - ? - PubMed: Tazon Vega 2003 - - - Spain - - 0 - - 1 Judy Savige
./. 3 c.222G>T - r.(?) p.(=) Unknown g.228104936G>T g.227240220G>T - - COL4A3_000007 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
-?/. - c.222G>T likely benign r.(=) p.(=) Unknown g.228104936G>T - COL4A3:c.222G>T (P74=) - COL4A3_000007 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. 3 c.233A>G - r.(?) p.(Lys78Arg) Unknown g.228104947A>G g.227240231A>G - - COL4A3_000183 - 1000 genome; NCBI - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Judy Savige
./. 4 c.261G>A - r.(?) p.(=) Unknown g.228109062G>A g.227244346G>A - - COL4A3_000259 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 4 c.272G>T VUS r.(?) p.(Gly91Val) Parent #1 g.228109073G>T - - - COL4A3_000465 - PubMed: Weber 2016, Journal: Weber 2016 - - Germline - - - 0 - DNA SEQ blood - AS - PubMed: Weber 2016, Journal: Weber 2016 Mother, maternal grandmother, and several maternal uncles on dialysis F - Germany - - 0 - - 1 Judy Savige
+?/. 4i_8i c.(279+1_280-1)_(468+1_469-1)dup VUS r.? p.? Parent #1 g.(228109081_228109666)_(228112301_228113158)dup - ex5-8 dup - COL4A3_000450 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - M - United Kingdom (Great Britain) - - 0 - - 1 Judy Savige
-?/. 5i c.324+73C>T - r.(?) p.(=) Unknown g.228109784C>T g.227245068C>T - - COL4A3_000008 Intronic PubMed: Voskarides 2007 - - Germline - - - 0 - DNA EMC, SSCA, SEQ - - ? - PubMed: Voskarides 2007 - - - Cyprus Greek-Cypriot - 0 - - 1 Judy Savige
-/. - c.325-27C>T benign r.(=) p.(=) Unknown g.228110643C>T - COL4A3:c.325-27C>T - COL4A3_000403 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 6 c.329C>T VUS r.(?) p.(Thr110Ile) Unknown g.228110674C>T - - - COL4A3_000466 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - M - United Kingdom (Great Britain) - - 0 - - 1 Judy Savige
./. 6 c.345del VUS r.(?) p.Pro116Leufs*37 Parent #1 g.228110690del - c.345delG - COL4A3_000467 - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - ASAR - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - - France - - 0 - - 1 Judy Savige
./. 6 c.345del VUS r.(?) p.(Pro116Leufs*37) Parent #1 g.228110690del - 345delG - COL4A3_000467 - PubMed: Rosado 2015, Journal: Rosado 2015 - - Germline - - - 0 - DNA SEQ - - ASAD - PubMed: Rosado 2015, Journal: Rosado 2015 Hematuria at age of 2, proteinuria and CKD at 32, hearing loss at 46. Son had hematuria and proteinuria at 6, and hearing loss and anterior lenticonus at 9, CKD at 19 F - Spain Spanish - 0 - - 1 Judy Savige
./. 6 c.346C>A - r.(?) p.(Pro116Thr) Unknown g.228110691C>A g.227245975C>A - - COL4A3_000009 Polymorphism PubMed: Wang 2004 - - Germline - - - 0 - DNA SSCA, SEQ - - BFH;TBMN - PubMed: Wang 2004 - - - - - - 0 - - 1 Judy Savige
./. 6 c.346C>A - r.(?) p.(Pro116Thr) Unknown g.228110691C>A g.227245975C>A - - COL4A3_000009 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 6 c.346C>A - r.(?) p.(Pro116Thr) Unknown g.228110691C>A g.227245975C>A - - COL4A3_000009 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 6 c.346C>A VUS r.(?) p.(Pro116Thr) Parent #1 g.228110691C>A - - - COL4A3_000009 - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - ASAR - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - - France - - 0 - - 1 Judy Savige
+/+? 6 c.351C>A - r.(?) p.(Tyr117*) Unknown g.228110696C>A g.227245980C>A - - COL4A3_000010 Nonsense PubMed: Nagel 2005 - - Germline - - - 0 - DNA SEQ - - ASAR - PubMed: Nagel 2005 - - - - - - 0 - - 1 Judy Savige
+/+ 6 c.351C>A - r.(?) p.(Tyr117*) Unknown g.228110696C>A g.227245980C>A - - COL4A3_000010 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
+/+? 7 c.390dup - r.(?) p.(Glu131*) Unknown g.228111403dup g.227246687dup c.389_390insT - COL4A3_000011 Insertion; Heterozygous. PubMed: Heidet 2001 - - Germline - - - 0 - DNA, RNA SSCA, RT-PCR, SEQ - - ASAR - PubMed: Heidet 2001 - - - - - - 0 - - 1 Judy Savige
+/. 7 c.391G>T - r.(?) p.(Glu131*) Unknown g.228111404G>T g.227246688G>T - - COL4A3_000248 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
+/. 7 c.391G>T - r.(?) p.(Glu131*) Unknown g.228111404G>T g.227246688G>T - - COL4A3_000248 - PubMed: Storey 2013 - - Germline - - - 0 - DNA SEQ - - ASAR - PubMed: Storey 2013 - F - Australia British - 0 - - 1 Helen Storey
./. 7 c.393del VUS r.(?) p.(Glu131Aspfs*22) Parent #1 g.228111406del - del393G - COL4A3_000468 - PubMed: Malone 2014, Journal: Malone 2014 - - Germline - - - 0 - DNA SEQ-NG - WES FSGS - PubMed: Malone 2014, Journal: Malone 2014 two affected siblings (2F) F - United States white - 0 - - 1 Judy Savige
./. 7 c.394C>T - r.(?) p.(Gln132*) Unknown g.228111407C>T g.227246691C>T - - COL4A3_000262 - - - - Germline - - - 0 - DNA SEQ - - ? - Judy Savige - - - - - - 0 - - 1 Judy Savige
./. 7 c.399G>A - r.(?) p.(Gly133=) Unknown g.228111412G>A g.227246696G>A - - COL4A3_000184 - 1000 genome; NCBI - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Judy Savige
./. 7 c.399G>A - r.(?) p.(=) Unknown g.228111412G>A g.227246696G>A - - COL4A3_000184 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 7 c.400del - r.(?) p.(Pro135Glnfs*18) Unknown g.228111413del g.227246697del c.400delT - COL4A3_000264 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
+/. 7 c.415G>C - r.(?) p.(Gly139Arg) Both (homozygous) g.228111428G>C g.227246712G>C - - COL4A3_000441 - - - - Germline ? - - 0 - DNA MLPA, SEQ-NG-I blood - AS - - 3-generation family, 8 affected (4F, 4M) F yes Czech Republic - 46y 0 - - 1 Pavlina Plevova
./. 7 c.422C>T - r.(?) p.(Pro141Leu) Unknown g.228111435C>T g.227246719C>T - - COL4A3_000265 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 7 c.422T>C - r.(?) p.(Leu141Pro) Unknown g.228111435T>C g.227246719T>C - - COL4A3_000012 Polymorphism PubMed: Wang 2004 - - Germline - - - 0 - DNA SSCA, SEQ - - BFH;TBMN - PubMed: Wang 2004 - - - - - - 0 - - 1 Judy Savige
-/-? 7 c.422T>C - r.(?) p.(Leu141Pro) Both (homozygous) g.228111435T>C g.227246719T>C - - COL4A3_000012 missense. Homozygous PubMed: Hoefele 2010 - - Germline - - - 0 - DNA SEQ - - BFH;TBMN - PubMed: Hoefele 2010 - M - Italy - - 0 - - 1 Judy Savige
-/. - c.422T>C benign r.(?) p.(Leu141Pro) Unknown g.228111435T>C - COL4A3:c.422T>C (L141P) - COL4A3_000012 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.422T>C benign r.(?) p.(Leu141Pro) Unknown g.228111435T>C - LOC654841:c.1593-8545A>G - COL4A3_000012 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
./. 7 c.422T>C VUS r.(?) p.(Leu141Pro) Parent #1 g.228111435T>C - - - COL4A3_000012 - PubMed: Kovacs 2016, Journal: Kovacs 2016 - - Germline - - - 0 - DNA SEQ, SEQ-NG blood - ASAR - PubMed: Kovacs 2016, Journal: Kovacs 2016 - - - Hungary Hungarian - 0 - - 1 Judy Savige
./. 7 c.432_440delinsGATTA VUS r.(?) p.(Gly145Ilefs*7) Parent #1 g.228111445_228111453delinsGATTA - - - COL4A3_000469 - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - ASAR - PubMed: Moriniere 2014, Journal: Moriniere 2014 - - - France - - 0 - - 1 Judy Savige
+?/. 7 c.434G>A - r.(?) p.(Gly145Glu) Unknown g.228111447G>A g.227246731G>A - - COL4A3_000013 Missense PubMed: Nagel 2005 - - Germline - - - 0 - DNA SEQ - - ? - PubMed: Nagel 2005 - - - - - - 0 - - 1 Judy Savige
./. 7 c.441G>A - r.(?) p.(=) Unknown g.228111454G>A g.227246738G>A - - COL4A3_000266 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
+/. 7i c.441+2T>C pathogenic r.spl p.? Parent #1 g.228111456T>C - - - COL4A3_000470 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - F - China Chinese - 0 - - 1 Judy Savige
./. 8 c.443G>T - r.(?) p.(Gly148Val) Unknown g.228112275G>T g.227247559G>T - - COL4A3_000267 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 8 c.443G>T - r.(?) p.(Gly148Val) Unknown g.228112275G>T g.227247559G>T - - COL4A3_000267 - - - - Germline - - - 0 - DNA SEQ - - ? - Matonagel - - - - - - 0 - - 1 Judy Savige
./. 8 c.443G>T VUS r.(?) p.Gly148Val Parent #1 g.228112275G>T - - - COL4A3_000267 - PubMed: Malone 2014, Journal: Malone 2014 - - Germline - - - 0 - DNA SEQ-NG - WES FSGS - PubMed: Malone 2014, Journal: Malone 2014 - F - United States white - 0 - - 1 Judy Savige
+?/. 8 c.461G>C - r.(?) p.(Gly154Ala) Paternal (confirmed) g.228112293G>C g.227247577G>C - - COL4A3_000225 - PubMed: Storey 2013 - - Germline - - - 0 - DNA SEQ - - ASAR - PubMed: Storey 2013 - M - - English - 0 - - 1 Helen Storey
+/. 8_8i c.462_468+1del pathogenic r.spl p.? Parent #1 g.228112294_228112301del - 462_468+1delACAAAAGG - COL4A3_000471 - - - - Germline - - - 0 - DNA SEQ - - ASAR - - - M - United Kingdom (Great Britain) - - 0 - - 1 Judy Savige
-/. - c.469-53G>T benign r.(=) p.(=) Unknown g.228113106G>T - COL4A3:c.469-53G>T - COL4A3_000404 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
./. 9 c.473C>A - r.(?) p.(Ala158Asp) Unknown g.228113163C>A g.227248447C>A - - COL4A3_000014 Polymorphism PubMed: Wang 2004 - - Germline - - - 0 - DNA SSCA, SEQ - - ? - PubMed: Wang 2004 - - - - - - 0 - - 1 Judy Savige
./. 9 c.473C>A - r.(?) p.(Ala158Asp) Unknown g.228113163C>A g.227248447C>A - - COL4A3_000014 Missense PubMed: Badenas 2002 - - Germline - - - 0 - DNA SSCA, SEQ - - BFH;TBMN - PubMed: Badenas 2002 - - - Spain - - 0 - - 1 Judy Savige
./. 9 c.485A>G - r.(?) p.(Glu162Gly) Unknown g.228113175A>G g.227248459A>G - - COL4A3_000015 Missense PubMed: Badenas 2002 - - Germline - - - 0 - DNA SSCA, SEQ - - BFH;TBMN - PubMed: Badenas 2002 - - - Spain - - 0 - - 1 Judy Savige
Legend   « First ‹ Prev     1 2 3 4 5 6 7 8     Next › Last »