Full data view for gene EDN3

Information The variants shown are described using the NM_000114.2 transcript reference sequence.

38 entries on 1 page. Showing entries 1 - 38.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+?/-? 1 c.-248G>A r.(?) p.(=) Unknown - likely benign g.57875620G>A g.59300565G>A - - EDN3_000015 suggested to alter mRNA expression, but found in control population PMID20009762:Sanchez-Mejias 2010; also has 45 kb de novo duplication DACH1 PubMed: Cui 2013 - - Germline - - - 0 - DNA arrayCGH, SEQ - - HSCR FamPatII5 PubMed: Cui 2013 3-generation family, 5 affected (2F, 3M), mixed phenotypes M - Brazil European - 0 - - 5 Veronique Pingault
+/+ 1 c.-125G>A r.(=) p.(=) Parent #1 - pathogenic g.57875743G>A g.59300688G>A - - EDN3_000023 - MORL Deafness Variation Database, PubMed: Sangkhathat 2006 - - SUMMARY record - - - 0 - DNA ? - - ? - PubMed: Sangkhathat 2006 - - - - - - 0 - - 1 Global Variome, with Curator vacancy
-?/. 1 c.46G>A r.(?) p.(Ala16Thr) Unknown - likely benign g.57875913G>A - EDN3(NM_207032.2):c.46G>A (p.A16T) - EDN3_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/-? 1 c.49G>A r.(?) p.(Ala17Thr) Unknown - likely pathogenic g.57875916G>A g.59300861G>A A17T - EDN3_000001 initialy reported as a Hirschsprung disease-causing variant PubMed: Bidaud 1997, PubMed: Garcia-Barcelo 2004 - rs11570255 Germline - 0.007 - 0 - DNA SSCA, SEQ - - HSCR - PubMed: Bidaud 1997, PubMed: Garcia-Barcelo 2004 - - - - - - 0 - - 1 Veronique Pingault
-?/. 2 c.95G>C r.(?) p.(Gly32Ala) Unknown - likely benign g.57876507G>C g.59301452G>C EDN3(NM_207032.2):c.95G>C (p.G32A) - EDN3_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 2 c.144G>C r.(?) p.(Glu48Asp) Parent #1 - pathogenic g.57876556G>C g.59301501G>C - - EDN3_000024 - MORL Deafness Variation Database, PubMed: Garcia-Barceló 2004 - - SUMMARY record - - - 0 - DNA ? - - ? - PubMed: Garcia-Barceló 2004 - - - - - - 0 - - 1 Global Variome, with Curator vacancy
+/+ 2 c.163G>T r.(?) p.(Glu55*) Unknown - pathogenic g.57876575G>T g.59301520G>T E55X - EDN3_000002 - PubMed: Bidaud 1997, PubMed: Bidaud 1997 - - Germline - - - 0 - DNA SSCA, SEQ - - WS - PubMed: Bidaud 1997, PubMed: Bidaud 1997 - M yes - - - 0 - - 2 Veronique Pingault
-?/. 2 c.167_190del r.(?) p.(Glu56_Glu63del) Unknown - likely benign g.57876579_57876602del g.59301524_59301547del EDN3(NM_207032.2):c.167_190delAGACTGTGGCTGGCCCTGGCGAGG (p.E56_E63del) - EDN3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. 2 c.203C>T r.(?) p.(Pro68Leu) Unknown - likely benign g.57876615C>T g.59301560C>T EDN3(NM_207032.2):c.203C>T (p.P68L) - EDN3_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 2 c.262dup r.(?) p.(Ala88Glyfs*3) Parent #1 - pathogenic g.57876674dup g.59301619dup - - EDN3_000025 - MORL Deafness Variation Database, PubMed: Svensson 1999 - - SUMMARY record - - - 0 - DNA ? - - ? - PubMed: Svensson 1999 - - - - - - 0 - - 1 Global Variome, with Curator vacancy
+/+ 2 c.262_263delinsT r.(?) p.(Ala88Serfs*121) Unknown - pathogenic g.57876674_57876675delinsT g.59301619_59301620delinsT 262 GC>T - EDN3_000003 - PubMed: Edery 1996, PubMed: Bidaud 1997 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Edery 1996, PubMed: Bidaud 1997 - F no - - - 0 - - 2 Veronique Pingault
+/+ 2 c.262_263delinsT r.(?) p.(Ala88Serfs*121) Unknown - pathogenic g.57876674_57876675delinsT g.59301619_59301620delinsT - - EDN3_000003 - PubMed: Pingault 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2010 - M no Bosnia and Herzegovina Bosnia - 0 - - 1 Veronique Pingault
+?/+? 2 c.277C>G r.(?) p.(Arg93Gly) Unknown - likely pathogenic g.57876689C>G g.59301634C>G - - EDN3_000013 predicted to alter furin cleavage PubMed: Shamseldin 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Shamseldin 2010 - M - Egypt - - 0 - - 1 Veronique Pingault
?/. 2 c.278G>A r.(?) p.(Arg93Gln) Unknown - VUS g.57876690G>A g.59301635G>A EDN3(NM_207032.2):c.278G>A (p.R93Q) - EDN3_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/+? 2 c.286C>T r.(?) p.(Arg96Cys) Unknown - likely pathogenic g.57876698C>T g.59301643C>T - - EDN3_000004 - PubMed: Pingault 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2010 - F no - - - 0 - - 1 Veronique Pingault
+?/+? 2 c.293C>A r.(?) p.(Thr98Lys) Unknown - likely pathogenic g.57876705C>A g.59301650C>A - - EDN3_000005 - PubMed: Pingault 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2010 - M yes India;Madagascar Caribbean - 0 - - 1 Veronique Pingault
+?/+? 2 c.293C>A r.(?) p.(Thr98Lys) Unknown - likely pathogenic g.57876705C>A g.59301650C>A - - EDN3_000005 variant has been excluded as a frequent polymorphism in a control population of India PubMed: Pingault 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2010 - M yes India - - 0 - - 1 Veronique Pingault
+?/+? 2 c.293C>A r.(?) p.(Thr98Lys) Paternal (confirmed) - likely pathogenic (recessive) g.57876705C>A g.59301650C>A - - EDN3_000005 - PubMed: Pingault 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2010 - F - India - - 0 - - 1 Veronique Pingault
+?/+? 2 c.293C>T r.(?) p.(Thr98Met) Unknown - likely pathogenic g.57876705C>T g.59301650C>T - - EDN3_000014 not in 50 ehtnically matched controls PubMed: Kapoor 2012 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Kapoor 2012 patient also has Duchenne muscular dystrophy, homozygote brother has WS4 M yes India - - 0 - - 1 Veronique Pingault
?/. - c.313A>G r.(?) p.(Lys105Glu) Unknown - VUS g.57876725A>G - - - EDN3_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/+? 2 c.335A>G r.(?) p.(His112Arg) Unknown - likely pathogenic g.57876747A>G g.59301692A>G - - EDN3_000006 - PubMed: Vinuela 2009 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Vinuela 2009 - M yes - - - 0 - - 1 Veronique Pingault
+?/+? 3 c.380A>G r.(?) p.(Tyr127Cys) Unknown - likely pathogenic g.57896086A>G g.59321031A>G Y127C - EDN3_000007 - PubMed: Pingault 2002 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2002 - M - India - - 0 - - 1 Veronique Pingault
?/? 3 c.472C>A r.(?) p.(Arg158Ser) Parent #1 - VUS g.57896178C>A g.59321123C>A - - EDN3_000026 - MORL Deafness Variation Database, PubMed: Miller 2010, PubMed: Farwell 2015 - - SUMMARY record - - - 0 - DNA ? - - - - PubMed: Miller 2010, PubMed: Farwell 2015 - - - - - - 0 - - 1 Global Variome, with Curator vacancy
+?/+? 3 c.476G>T r.(?) p.(Cys159Phe) Unknown - likely pathogenic g.57896182G>T g.59321127G>T - - EDN3_000008 - PubMed: Hofstra 1996 - - Germline - - - 0 - DNA DGGE, SEQ - - WS - PubMed: Hofstra 1996 - - yes Pakistan - - 0 - - 1 Veronique Pingault
+?/+? 3 c.476G>T r.(?) p.(Cys159Phe) Unknown - likely pathogenic g.57896182G>T g.59321127G>T - - EDN3_000008 - PubMed: Pingault 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2010 - - yes Pakistan - - 0 - - 1 Veronique Pingault
+?/+? 3 c.476G>T r.(?) p.(Cys159Phe) Unknown - likely pathogenic g.57896182G>T g.59321127G>T - - EDN3_000008 - PubMed: Pingault 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2010 - - yes Pakistan - - 0 - - 1 Veronique Pingault
+/+ 3 c.498C>G r.(?) p.(Asp166Glu) Parent #1 - pathogenic g.57896204C>G g.59321149C>G - - EDN3_000027 - MORL Deafness Variation Database, PubMed: Sangkhathat 2006 - - SUMMARY record - - - 0 - DNA ? - - ? - PubMed: Sangkhathat 2006 - - - - - - 0 - - 1 Global Variome, with Curator vacancy
+/+ 3 c.507C>A r.(?) p.(Cys169*) Parent #1 - pathogenic g.57896213C>A g.59321158C>A - - EDN3_000009 - MORL Deafness Variation Database, PubMed: Xiong 2015 - - SUMMARY record - - - 0 - DNA ? - - WS - PubMed: Xiong 2015 - - - - - - 0 - - 1 Global Variome, with Curator vacancy
+/+ 3 c.507C>A r.(?) p.(Cys169*) Maternal (confirmed) - pathogenic g.57896213C>A g.59321158C>A C169X - EDN3_000009 - PubMed: Pingault 2001 - - Germline - - - 0 - DNA SSCA, SEQ - - WS - PubMed: Pingault 2001 - F - Yugoslavia - - 0 - - 1 Veronique Pingault
+/+ 3 c.517T>C r.(?) p.(Cys173Arg) Parent #1 - pathogenic g.57896223T>C g.59321168T>C - - EDN3_000010 - MORL Deafness Variation Database, PubMed: Sangkhathat 2006 - - SUMMARY record - - - 0 - DNA ? - - ? - PubMed: Sangkhathat 2006 - - - - - - 0 - - 1 Global Variome, with Curator vacancy
+?/+? 3 c.517T>C r.(?) p.(Cys173Arg) Maternal (confirmed) - likely pathogenic (recessive) g.57896223T>C g.59321168T>C - - EDN3_000010 - PubMed: Pingault 2010 - - Germline - - - 0 - DNA SEQ - - WS - PubMed: Pingault 2010 - F - India - - 0 - - 1 Veronique Pingault
?/. 4 c.548C>T r.(?) p.(Ser183Leu) Unknown - VUS g.57897432C>T g.59322377C>T EDN3(NM_207032.2):c.548C>T (p.S183L) - EDN3_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 4 c.554C>T r.(?) p.(Thr185Met) Parent #1 - pathogenic g.57897438C>T g.59322383C>T - - EDN3_000028 - MORL Deafness Variation Database, PubMed: Miyagawa 2013 - - SUMMARY record - - - 0 - DNA ? - - deafness - PubMed: Miyagawa 2013 - - - - - - 0 - - 1 Global Variome, with Curator vacancy
?/. 4 c.565dup r.(?) p.(Thr189AsnfsTer10) Unknown - VUS g.57897449dup g.59322394dup EDN3(NM_207032.2):c.565dupA (p.T189Nfs*63) - EDN3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/-? 4 c.565dup r.(?) p.(Thr189Asnfs*10) Unknown - likely pathogenic g.57897449dup g.59322394dup 565dupA - EDN3_000011 initialy reported as a CCHS-causing mutation; functional test show no alteration of the proteolytic processing of preproendothelin PubMed: Bolk 1996 - rs11570344 Germline - 0.006 - 0 - DNA SSCA, SEQ - - CDHS - PubMed: Bolk 1996 - - - - - - 0 - - 1 Veronique Pingault
?/. 4 c.568_569del r.(?) p.(Asp190GlnfsTer8) Unknown - VUS g.57897452_57897453del g.59322397_59322398del EDN3(NM_207032.2):c.568_569delGA (p.D190Qfs*61) - EDN3_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. 5 c.646A>C r.(?) p.(Met216Leu) Unknown - likely benign g.57899443A>C g.59324388A>C EDN3(NM_207034.2):c.646A>C (p.M216L) - EDN3_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/-? 5 c.670G>A r.(?) p.(Ala224Thr) Unknown - likely pathogenic g.57899467G>A g.59324412G>A A224T - EDN3_000012 initialy reported as a Hirschsprung disease-causing mutation PubMed: Bidaud 1997 - rs11570351 Unknown - 0.006 - 0 - DNA SSCA, SEQ - - HSCR - PubMed: Bidaud 1997 - - - - - - 0 - - 1 Veronique Pingault
Legend   How to query