Full data view for gene FBXO11

Information The variants shown are described using the NM_001190274.1 transcript reference sequence.

603 entries on 7 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+?/. - c.109C>T r.(?) p.(Gln37Ter) Unknown - likely pathogenic g.48132751G>A g.47905612G>A - - MSH6_001251 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.120_134del r.(?) p.(Gln42_Pro46del) Unknown - likely benign g.48132747_48132761del g.47905608_47905622del FBXO11(NM_001190274.1):c.120_134del (p.(Gln42_Pro46del)) - MSH6_001250 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.146C>A r.(?) p.(Pro49Gln) Unknown - likely benign g.48132714G>T g.47905575G>T FBXO11(NM_001190274.1):c.146C>A (p.(Pro49Gln)) - MSH6_001249 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.149A>C r.(?) p.(Gln50Pro) Unknown - likely benign g.48132711T>G - FBXO11(NM_001190274.1):c.149A>C (p.Q50P) - MSH6_001248 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.167_169del r.(?) p.(Gln56del) Unknown - likely benign g.48132711_48132713del g.47905572_47905574del FBXO11(NM_001190274.1):c.167_169delAGC (p.Q56del) - MSH6_001290 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.167_169dup r.(?) p.(Gln56dup) Unknown - likely benign g.48132711_48132713dup g.47905572_47905574dup FBXO11(NM_001190274.1):c.167_169dupAGC (p.Q56dup), FBXO11(NM_001190274.1):c.169_170insAGC (p.(Gln56dup)) - FBXO11_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.167_169dup r.(?) p.(Gln56dup) Unknown - likely benign g.48132711_48132713dup g.47905572_47905574dup FBXO11(NM_001190274.1):c.167_169dupAGC (p.Q56dup), FBXO11(NM_001190274.1):c.169_170insAGC (p.(Gln56dup)) - FBXO11_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.233-19_1398+22del r.? p.? Unknown - pathogenic g.48059468_48066929del g.47832329_47839790del - - FBXO11_000042 - - - - Unknown - - - 0 - DNA SEQ - - ? - - - F - - - - 0 - - 1 IMGAG
+?/. - c.319_320del r.(?) p.(Leu107Alafs*45) Unknown ACMG pathogenic g.48066823_48066824del g.47839684_47839685del - - FBXO11_000040 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
+?/. - c.404A>G r.(?) p.(Lys135Arg) Unknown - likely pathogenic g.48066596T>C g.47839457T>C FBXO11(NM_001190274.1):c.404A>G (p.K135R) - MSH6_001274 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.414A>T r.(?) p.(Arg138Ser) Unknown ACMG likely pathogenic g.48066586T>A g.47839447T>A - - FBXO11_000024 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo yes - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - F - - - - 0 - - 1 Christiane Zweier
+/. - c.440C>G r.(?) p.(Ser147Ter) Unknown - pathogenic g.48066560G>C g.47839421G>C FBXO11(NM_001190274.1):c.440C>G (p.S147*) - MSH6_001273 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.442G>A r.(?) p.(Ala148Thr) Unknown - VUS g.48066558C>T g.47839419C>T FBXO11(NM_001190274.1):c.442G>A (p.(Ala148Thr)) - FBXO11_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
./. - c.442+1dup r.spl? p.? Unknown - likely pathogenic g.48066558dup g.47839419dup - - FBXO11_000007 - - - - De novo - - - 0 - DNA SEQ, SEQ-NG - - - Individual 1 - - M - - - - 0 - - 1 Jessica Becker
+/. - c.442+1dup r.spl? p.? Unknown - pathogenic (dominant) g.48066558dup g.47839419dup - - FBXO11_000007 - PubMed: Fritzen 2018, Journal: Fritzen 2018 - - De novo - - - 0 - DNA SEQ, SEQ-NG - WES ID 29796876-Pat1 PubMed: Fritzen 2018, Journal: Fritzen 2018 - M - Germany - - 0 - - 1 Johan den Dunnen
+?/. - c.467A>G r.(?) p.(Gln156Arg) Unknown ACMG likely pathogenic g.48066118T>C g.47838979T>C - - FBXO11_000026 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - ? - - - - 0 - - 1 Christiane Zweier
+?/. - c.506_507del r.(?) p.(Ser169Leufs*9) Unknown ACMG pathogenic g.48066081_48066082del g.47838942_47838943del - - FBXO11_000039 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
./. - c.552del r.(?) p.(Lys184Asnfs*27) Unknown - likely pathogenic g.48066035del g.47838896del - - FBXO11_000023 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 5 Jansen, submitted - F - - - - 0 - - 1 Lisenka Vissers
?/. - c.596T>C r.(?) p.(Leu199Ser) Unknown - VUS g.48063132A>G - - - MSH6_010294 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.599A>T r.(?) p.(Tyr200Phe) Unknown - likely benign g.48063129T>A g.47835990T>A FBXO11(NM_001190274.1):c.599A>T (p.(Tyr200Phe)) - MSH6_001246 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
./. - c.606A>C r.(?) p.(Glu202Asp) Unknown - likely pathogenic g.48063122T>G g.47835983T>G - - FBXO11_000022 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 15 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
./. - c.668del r.(?) p.(Pro223Glnfs*23) Unknown - likely pathogenic g.48063061del g.47835922del - - FBXO11_000006 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 18 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
?/. - c.947T>G r.(?) p.(Val316Gly) Unknown - VUS g.48060197A>C g.47833058A>C FBXO11(NM_001190274.1):c.947T>G (p.V316G) - MSH6_001289 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1042-1G>C r.spl p.? Unknown ACMG likely pathogenic g.48060020C>G g.47832881C>G - - FBXO11_000038 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
+?/. - c.1046dup r.(?) p.(Asn349LysfsTer3) Unknown - likely pathogenic g.48060016dup - - - MSH6_001298 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1260+1G>C r.spl p.? Unknown ACMG likely pathogenic g.48059710C>G g.47832571C>G - - FBXO11_000037 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
./. - c.1517A>G r.(?) p.(Tyr506Cys) Unknown - likely pathogenic g.48050381T>C g.47823242T>C - - FBXO11_000021 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 14 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
-?/. - c.1549G>C r.(?) p.(Glu517Gln) Unknown - likely benign g.48050349C>G g.47823210C>G - - MSH6_001245 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1612A>G r.(?) p.(Ile538Val) Unknown - likely pathogenic g.48050286T>C g.47823147T>C - - FBXO11_000025 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG blood - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - 0 - - 1 Christiane Zweier
+?/. - c.1648G>C r.(?) p.(Gly550Arg) Unknown - likely pathogenic g.48049411C>G - - - FBXO11_000045 - - - - Unknown - - - 0 - DNA SEQ - - ? - - - M - - - - 0 - - 1 IMGAG
?/. - c.1660T>G r.(?) p.(Phe554Val) Unknown - VUS g.48049399A>C g.47822260A>C - - FBXO11_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
./. - c.1660T>G r.(?) p.(Phe554Val) Unknown - likely pathogenic g.48049399A>C g.47822260A>C - - FBXO11_000005 10-20% mosaic. - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 20 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
+?/. - c.1706A>G r.(?) p.(Asn569Ser) Unknown - likely pathogenic g.48047592T>C g.47820453T>C - - FBXO11_000043 - - - - Unknown - - - 0 - DNA SEQ - - IDDFBA - - - F - - - - 0 - - 1 IMGAG
./. - c.1781A>G r.(?) p.(His594Arg) Unknown - likely pathogenic g.48047517T>C g.47820378T>C - - FBXO11_000020 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 13 Jansen, submitted - F - - - - 0 - - 1 Lisenka Vissers
./. - c.1798-1G>A r.spl? p.? Unknown - likely pathogenic g.48046218C>T g.47819079C>T - - FBXO11_000019 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 12 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
+?/. - c.1825_1829del r.(?) p.(Glu609*) Unknown ACMG pathogenic g.48046190_48046194del g.47819051_47819055del - - FBXO11_000036 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
./. - c.1830T>G r.(?) p.(Asn610Lys) Unknown - likely pathogenic g.48046185A>C g.47819046A>C - - FBXO11_000018 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 22 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
+?/. - c.1868C>G r.(?) p.(Thr623Arg) Unknown ACMG likely pathogenic g.48046147G>C g.47819008G>C - - FBXO11_000027 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - 0 - - 1 Christiane Zweier
./. - c.1967A>G r.(?) p.(Asn656Ser) Unknown - likely pathogenic g.48045957T>C g.47818818T>C - - FBXO11_000017 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 19 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
./. - c.2060G>A r.(?) p.(Gly687Asp) Unknown - likely pathogenic g.48040953C>T g.47813814C>T - - FBXO11_000016 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 16 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
./. - c.2074T>A r.(?) p.(Tyr692Asn) Unknown - likely pathogenic g.48040939A>T g.47813800A>T - - FBXO11_000015 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 2 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
./. - c.2075A>T r.(?) p.(Tyr692Phe) Unknown - likely pathogenic g.48040938T>A g.47813799T>A - - FBXO11_000014 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 24 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
+?/. - c.2084-6_2085dup r.spl p.? Unknown ACMG pathogenic g.48040516_48040523dup g.47813377_47813384dup - - FBXO11_000034 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
+?/. - c.2084-1G>A r.spl p.? Unknown ACMG likely pathogenic g.48040517C>T g.47813378C>T - - FBXO11_000035 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
./. - c.2145G>C r.(?) p.(Lys715Asn) Unknown - likely pathogenic g.48040455C>G g.47813316C>G - - FBXO11_000013 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 8 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
./. - c.2145G>C r.(?) p.(Lys715Asn) Unknown - likely pathogenic g.48040455C>G g.47813316C>G - - FBXO11_000013 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 17 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
?/. - c.2171_2173del r.(?) p.(Arg724del) Unknown - VUS g.48040432_48040434del g.47813293_47813295del FBXO11(NM_001190274.1):c.2171_2173del (p.(Arg724del)) - FBXO11_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.2171_2173del r.(?) p.(Arg724del) Unknown - likely pathogenic g.48040432_48040434del g.47813293_47813295del 2171_2173delGAA - FBXO11_000001 - - - - Germline/De novo (untested) - - - 0 - DNA SEQ - - ? - - - M - - - - 0 - - 1 IMGAG
+?/. - c.2211_2217del r.(?) p.(Ile737Metfs*30) Unknown ACMG likely pathogenic (dominant) g.48040385_48040391del g.47813246_47813252del - - FBXO11_000046 ACMG: PVS1, PM2_SUP - - - Germline/De novo (untested) ? - - 0 - DNA SEQ-NG-I - - IDDFBA 177941 - - M ? Germany - - 0 - - 1 Andreas Laner
./. - c.2395_2397del r.(?) p.(Asn799del) Unknown - likely pathogenic g.48036791_48036793del g.47809652_47809654del - - FBXO11_000008 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 21 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
?/. - c.2398C>T r.(?) p.(Arg800Trp) Unknown - VUS g.48036787G>A g.47809648G>A - - MSH6_001244 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2446+8G>A r.(=) p.(=) Unknown - likely benign g.48036731C>T g.47809592C>T FBXO11(NM_001190274.1):c.2446+8G>A (p.(=)) - MSH6_001243 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2491A>G r.(?) p.(Ser831Gly) Unknown - likely benign g.48036361T>C g.47809222T>C FBXO11(NM_001190274.1):c.2491A>G (p.S831G) - MSH6_001242 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.2518T>C r.(?) p.(Ser840Pro) Unknown ACMG likely pathogenic g.48036334A>G g.47809195A>G - - FBXO11_000033 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
./. - c.2520_2521del r.(?) p.(Ser841Leufs*8) Unknown - likely pathogenic g.48036331_48036332del g.47809192_47809193del - - FBXO11_000012 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 4 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
./. - c.2568_2572del r.(?) p.(Asn857Hisfs*12) Unknown - likely pathogenic g.48035550_48035554del g.47808411_47808415del - - FBXO11_000011 35% mosaic - - - Somatic - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 10 Jansen, submitted - F - - - - 0 - - 1 Lisenka Vissers
./. - c.2570_2572del r.(?) p.(Asn857del) Unknown - likely pathogenic g.48035551_48035553del g.47808412_47808414del - - FBXO11_000004 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 3 Jansen, submitted - F - - - - 0 - - 1 Lisenka Vissers
./. - c.2592_2593del r.(?) p.(Ile864Metfs*6) Unknown - likely pathogenic g.48035531_48035532del g.47808392_47808393del - - FBXO11_000003 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 1 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
./. - c.2592_2593del r.(?) p.(Ile864Metfs*6) Unknown - likely pathogenic g.48035531_48035532del g.47808392_47808393del - - FBXO11_000003 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 1 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
+?/. - c.2675C>A r.(?) p.(Ala892Asp) Unknown ACMG likely pathogenic g.48035366G>T g.47808227G>T - - FBXO11_000032 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
./. - c.2685_2686del r.(?) p.(Ser896*) Unknown - likely pathogenic g.48035356_48035357del g.47808217_47808218del - - FBXO11_000010 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 11 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
+?/. - c.2700_2703dup r.(?) p.(Ala902Ilefs*4) Unknown ACMG pathogenic g.48035338_48035341dup g.47808199_47808202dup - - FBXO11_000031 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
+?/. - c.2709dup r.(?) p.(Glu904*) Unknown ACMG pathogenic g.48035332dup g.47808193dup - - FBXO11_000030 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
+?/. - c.2714C>G r.(?) p.(Pro905Arg) Unknown ACMG likely pathogenic g.48035327G>C g.47808188G>C - - FBXO11_000029 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
+?/. - c.2729A>G r.(?) p.(Asp910Gly) Unknown ACMG likely pathogenic g.48035312T>C g.47808173T>C - - FBXO11_000028 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
./. - c.2738_2739del r.(?) p.(Tyr913*) Unknown - likely pathogenic g.48035305_48035306del g.47808166_47808167del - - MSH6_001165 - - - - De novo - - - 0 - DNA SEQ, SEQ-NG - - - Individual 2 - - M - - - - 0 - - 1 Jessica Becker
./. - c.2738_2739del r.(?) p.(Tyr913*) Unknown - likely pathogenic g.48035305_48035306del g.47808166_47808167del - - MSH6_010287 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 9 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
+?/. - c.2738_2739del r.(?) p.(Tyr913*) Unknown ACMG pathogenic g.48035305_48035306del g.47808166_47808167del - - MSH6_010287 - PubMed: Gregor 2018, Journal: Gregor 2018 - - De novo - - - 0 - DNA SEQ-NG - - ID - PubMed: Gregor 2018, Journal: Gregor 2018 - - - - - - - - - 1 Christiane Zweier
+/. - c.2738_2739del r.(?) p.(Tyr913*) Unknown - pathogenic (dominant) g.48035305_48035306del g.47808166_47808167del 2738_2739delAT - MSH6_010287 - PubMed: Fritzen 2018, Journal: Fritzen 2018 - - De novo - - - 0 - DNA SEQ, SEQ-NG - WES ID 29796876-Pat2 PubMed: Fritzen 2018, Journal: Fritzen 2018 - M - Germany - - 0 - - 1 Johan den Dunnen
+?/. 23 c.2738_2739del r.(?) p.(Tyr913*) Unknown - likely pathogenic g.48035305_48035306del g.47808166_47808167del 2738_2739delAT - MSH6_010287 - PubMed: Martinez 2017, Journal: Martinez 2017 - - De novo - - - 0 - DNA SEQ, SEQ-NG - 1256 gene panel ID 27620904-Pat33 PubMed: Martinez 2017, Journal: Martinez 2017 - - - Spain - - 0 - - 1 Johan den Dunnen
./. - c.2748_2749del r.(?) p.(Pro917Thrfs*5) Unknown - likely pathogenic g.48035293_48035294del g.47808154_47808155del - - FBXO11_000009 - - - - De novo - - - 0 - DNA SEQ-NG - - ID Jansen et al. Patient 23 Jansen, submitted - M - - - - 0 - - 1 Lisenka Vissers
-/. - c.*1173A>T r.(=) p.(=) Unknown - benign g.48034084T>A g.47806945T>A - - MSH6_000695 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.*1181_*1182dup r.(=) p.(=) Unknown - VUS g.48034076_48034077dup g.47806937_47806938dup MSH6(NM_000179.2):c.*78_*79dupTT - MSH6_000741 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*1272_*1275dup r.(=) p.(=) Unknown - likely benign g.48033984_48033987dup g.47806845_47806848dup MSH6(NM_000179.2):c.4065_4066insTTGA (p.(Lys1358Aspfs*2)), MSH6(NM_000179.2):c.4068_4071dupGATT (p.K1358Dfs*2) - MSH6_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1272_*1275dup r.(=) p.(=) Unknown - likely benign g.48033984_48033987dup g.47806845_47806848dup MSH6(NM_000179.2):c.4065_4066insTTGA (p.(Lys1358Aspfs*2)), MSH6(NM_000179.2):c.4068_4071dupGATT (p.K1358Dfs*2) - MSH6_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1272_*1275dup r.(=) p.(=) Unknown - likely benign g.48033984_48033987dup g.47806845_47806848dup MSH6(NM_000179.2):c.4065_4066insTTGA (p.(Lys1358Aspfs*2)), MSH6(NM_000179.2):c.4068_4071dupGATT (p.K1358Dfs*2) - MSH6_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1272_*1275dup r.(=) p.(=) Unknown - likely benign g.48033984_48033987dup - MSH6(NM_000179.2):c.4065_4066insTTGA (p.(Lys1358Aspfs*2)), MSH6(NM_000179.2):c.4068_4071dupGATT (p.K1358Dfs*2) - MSH6_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1319_*1320insTCCTT r.(=) p.(=) Unknown - VUS g.48033939_48033940insGGAAA - - - MSH6_010293 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1337T>G r.(=) p.(=) Unknown - VUS g.48033920A>C g.47806781A>C MSH6(NM_000179.2):c.4004A>C (p.E1335A) - MSH6_001272 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1347_*1348del r.(=) p.(=) Unknown - likely benign g.48033909_48033910del g.47806770_47806771del MSH6(NM_000179.2):c.4002-9_4002-8del (p.(=)) - MSH6_001241 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1347_*1365del r.(=) p.(=) Unknown - VUS g.48033896_48033914del g.47806757_47806775del MSH6(NM_000179.2):c.4002-26_4002-8del (p.(=)) - MSH6_001157 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.*1349A>T r.(=) p.(=) Unknown - VUS g.48033908T>A g.47806769T>A MSH6(NM_000179.2):c.4002-10T>A - MSH6_000763 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*1349A>T r.(=) p.(=) Unknown - likely benign g.48033908T>A g.47806769T>A MSH6(NM_000179.2):c.4002-10T>A - MSH6_000763 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1364_*1366del r.(=) p.(=) Unknown - benign g.48033906_48033908del g.47806767_47806769del MSH6(NM_000179.2):c.4002-12_4002-10delTTT - MSH6_001159 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1365_*1366del r.(=) p.(=) Unknown - benign g.48033907_48033908del g.47806768_47806769del MSH6(NM_000179.2):c.4002-11_4002-10delTT - MSH6_000577 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1366del r.(?) p.(=) Unknown - benign g.48033908del g.47806769del MSH6(NM_000179.2):c.4002-10delT, MSH6(NM_000179.2):c.4002-27delT - MSH6_000581 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1366del r.(?) p.(=) Unknown - benign g.48033908del g.47806769del MSH6(NM_000179.2):c.4002-10delT, MSH6(NM_000179.2):c.4002-27delT - MSH6_000581 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1366del r.(?) p.(=) Unknown - benign g.48033908del - MSH6(NM_000179.2):c.4002-10delT, MSH6(NM_000179.2):c.4002-27delT - MSH6_000581 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1366dup r.(?) p.(=) Unknown - likely benign g.48033908dup g.47806769dup MSH6(NM_000179.2):c.4002-10dupT, MSH6(NM_000179.2):c.4002-28_4002-27insT, MSH6(NM_000179.2):c.4002-9delAinsTA - MSH6_001160 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1366dup r.(?) p.(=) Unknown - benign g.48033908dup g.47806769dup MSH6(NM_000179.2):c.4002-10dupT, MSH6(NM_000179.2):c.4002-28_4002-27insT, MSH6(NM_000179.2):c.4002-9delAinsTA - MSH6_001160 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*1366dup r.(?) p.(=) Unknown - benign g.48033908dup - MSH6(NM_000179.2):c.4002-10dupT, MSH6(NM_000179.2):c.4002-28_4002-27insT, MSH6(NM_000179.2):c.4002-9delAinsTA - MSH6_001160 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1436_*1449dup r.(=) p.(=) Unknown - benign g.48033809_48033822dup g.47806670_47806683dup MSH6(NM_000179.2):c.4001+18_4001+31dupATGGAATTATAACT - MSH6_001240 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1441_*1465del r.(=) p.(=) Unknown - likely benign g.48033801_48033825del g.47806662_47806686del MSH6(NM_000179.2):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT - MSH6_001238 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1452T>C r.(=) p.(=) Unknown - likely benign g.48033805A>G g.47806666A>G MSH6(NM_000179.2):c.4001+15A>G - MSH6_001239 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1460_*1464dup r.(=) p.(=) Unknown - likely benign g.48033794_48033798dup g.47806655_47806659dup MSH6(NM_000179.2):c.4001+3_4001+7dupAACTA - MSH6_001152 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1462_*1465del r.(=) p.(=) Unknown - benign g.48033802_48033805del g.47806663_47806666del MSH6(NM_000179.2):c.4001+12_4001+15delACTA - MSH6_001151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*1462_*1465del r.(=) p.(=) Unknown - likely benign g.48033802_48033805del g.47806663_47806666del MSH6(NM_000179.2):c.4001+12_4001+15delACTA - MSH6_000120 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*1462_*1465del r.(=) p.(=) Unknown - likely benign g.48033802_48033805del g.47806663_47806666del MSH6(NM_000179.2):c.4001+12_4001+15delACTA - MSH6_001151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*1462_*1465del r.(=) p.(=) Unknown - likely benign g.48033802_48033805del g.47806663_47806666del MSH6(NM_000179.2):c.4001+12_4001+15delACTA - MSH6_000120 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1462_*1465dup r.(=) p.(=) Unknown - benign g.48033802_48033805dup g.47806663_47806666dup MSH6(NM_000179.2):c.4001+10_4001+13dupTAAC, MSH6(NM_000179.2):c.4001+13_4001+16dupCTAA, MSH6(NM_000179.2):c.4001+16_4001+17insCTAA - MSH6_000795 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7     Next › Last »