Full data view for gene MFSD2A

Information The variants shown are described using the NM_032793.3 transcript reference sequence.

19 entries on 1 page. Showing entries 1 - 19.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/. - c.94-8C>A r.(=) p.(=) Unknown - likely benign g.40422751C>A - MFSD2A(NM_032793.5):c.94-8C>A - MFSD2A_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.229-25_229-23del r.(?) p.(=) Both (homozygous) - likely pathogenic (recessive) g.40424348_40424350del g.39958676_39958678del - - MFSD2A_000002 - - ClinVar-000965673 - Germline yes - - - - DNA SEQ-NG Blood targeted WES for microcephaly microcephaly MFSD2A - - - yes Iran - - - - - 1 Ehsan Razmara
+/. - c.476C>T r.(?) p.(Thr159Met) Both (homozygous) - likely pathogenic (recessive) g.40431005C>T g.39965333C>T - - MFSD2A_000005 ACMG PS3, PM2, PP3, PP4, PP5 PubMed: Scala 2020 - - Germline yes - - - - DNA SEQ-NG - - NEDMISBA;MCPH15 FamEPat6 PubMed: Scala 2020 2-generation family, 2 affected sibs (F, M) F yes Saudi Arabia - - - - - 1 Marcello Scala
+/. - c.476C>T r.(?) p.(Thr159Met) Both (homozygous) - pathogenic (recessive) g.40431005C>T - - - MFSD2A_000005 - PubMed: Guemez-Gamboa 2015 - - Germline yes - - - - DNA SEQ, SEQ-NG - - NEDMISBA;MCPH15 Fam1825 PubMed: Guemez-Gamboa 2015 4-generation family, affected brother/sister, unaffected heterozygous carrier parents/relatives F;M yes Egypt - - - - - 2 Johan den Dunnen
+?/. - c.490C>A r.(?) p.(Pro164Thr) Both (homozygous) - likely pathogenic (recessive) g.40431155C>A g.39965483C>A - - MFSD2A_000011 novel candidate disease gene PubMed: Hu 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - - ID M8700073 PubMed: Hu 2019 family, 3 affected individuals, first cousin parents - yes Iran Baloch - - - - 3 Johan den Dunnen
+/. - c.497C>T r.(?) p.(Ser166Leu) Both (homozygous) - pathogenic (recessive) g.40431162C>T - - - MFSD2A_000014 - PubMed: Guemez-Gamboa 2015 - - Germline yes - - - - DNA SEQ, SEQ-NG - - NEDMISBA;MCPH15 Fam1422 PubMed: Guemez-Gamboa 2015 4-generation family, 2 affected, sisters unaffected heterozygous carrier parents F yes Libya - - - - - 2 Johan den Dunnen
+/. - c.556+1G>A r.spl p.? Both (homozygous) - pathogenic (recessive) g.40431222G>A g.39965550G>A - - MFSD2A_000004 ACMG PVS1, PM2, PP3, PP4 PubMed: Scala 2020 - rs758953000 Germline yes - - - - DNA SEQ-NG - - NEDMISBA;MCPH15 FamBPat2 PubMed: Scala 2020 2-generation family, 2 affected brothers M yes Iran - - - - - 2 Marcello Scala
+/. - c.593C>T r.(?) p.(Thr198Met) Both (homozygous) - likely pathogenic (recessive) g.40431565C>T g.39965893C>T - - MFSD2A_000006 ACMG PS3, PM2, PP3, PP4 PubMed: Scala 2020 - rs756467073 Germline yes - - - - DNA SEQ-NG - - NEDMISBA;MCPH15 FamCPat3 PubMed: Scala 2020 2-generation family, 4 affected sibs (2F, 2M) F yes Pakistan - - - - - 4 Marcello Scala
+?/. - c.593C>T r.(?) p.(Thr198Met) Both (homozygous) - VUS g.40431565C>T g.39965893C>T NM_001136493.2:c.632C>T - MFSD2A_000006 - PubMed: Riazuddin 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID PKMR97 PubMed: Riazuddin 2017 - - yes Pakistan - - - - - 1 Johan den Dunnen
+/. - c.593C>T r.(?) p.(Thr198Met) Both (homozygous) - likely pathogenic (recessive) g.40431565C>T - - - MFSD2A_000006 ACMG PS3, PM2, PP3, PP4 PubMed: Scala 2020 - - Germline yes - - - - DNA SEQ - - NEDMISBA;MCPH15 FamCPat4 PubMed: Scala 2020 FamCPat4 F yes Pakistan - - - - - 1 Johan den Dunnen
+/. - c.748G>T r.(?) p.(Val250Phe) Parent #1 - likely pathogenic (recessive) g.40432306G>T g.39966634G>T - - MFSD2A_000008 ACMG PS3, PM2, PP3, PP4 PubMed: Scala 2020 - - Germline yes - - - - DNA SEQ-NG - - NEDMISBA;MCPH15 FamDPat5 PubMed: Scala 2020 2-generation family, 1 affected M no Russia - - - - - 1 Marcello Scala
+/. - c.750_753del r.(?) p.(Cys251SerfsTer3) Both (homozygous) - pathogenic (recessive) g.40432308_40432311del g.39966636_39966639del chr1:40432304 TTGTC>T - MFSD2A_000007 ACMG PVS1, PM2, PP4 PubMed: Scala 2020 - - Germline yes - - - - DNA SEQ-NG - - NEDMISBA;MCPH15 FamGPat8 PubMed: Scala 2020 2-generation family, 1 affected F yes Saudi Arabia - - - - - 1 Marcello Scala
?/. - c.874G>A r.(?) p.(Gly292Ser) Unknown - VUS g.40432551G>A - MFSD2A(NM_032793.5):c.874G>A (p.(Gly292Ser)) - MFSD2A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.977G>A r.(?) p.(Arg326His) Parent #2 - likely pathogenic (recessive) g.40432807G>A g.39967135G>A - - MFSD2A_000009 ACMG PS3, PM2, PP3, PP4 PubMed: Scala 2020 - - Germline yes - - - - DNA SEQ-NG - - NEDMISBA;MCPH15 FamDPat5 PubMed: Scala 2020 2-generation family, 1 affected M no Russia - - - - - 1 Marcello Scala
+/. - c.1016C>T r.(?) p.(Ser339Leu) Both (homozygous) - pathogenic (recessive) g.40433304C>T - - - MFSD2A_000013 - PubMed: Abe 2015 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES MCPH family PubMed: Abe 2015 3-generation family, 10 affected (3F, 7M) F;M yes Pakistan - - - - - 10 Johan den Dunnen
+?/. - c.1172C>G r.(?) p.(Ala391Gly) Unknown - likely pathogenic g.40433552C>G g.39967880C>G NM_001136493.2(MFSD2A):c.1211C>G p.(Ala404Gly) - MFSD2A_000001 variant could not be associated with disease phenotype PubMed: Vogelaar 2017, Journal: Vogelaar 2017 - - Germline - - - - - DNA SEQ-NG - - cancer, gastric Vogelaar-759A PubMed: Vogelaar 2017, Journal: Vogelaar 2017 54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer - - - - - - - - 1 Marjolijn JL Ligtenberg
+/. - c.1205C>A r.(?) p.(Pro402His) Both (homozygous) - pathogenic (recessive) g.40433585C>A - - - MFSD2A_000012 - PubMed: Harel 2018 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES NEDMISBA;MCPH15 family PubMed: Harel 2018 2-generation family, affected brother/sister, unaffected heterozygous carrier parents F;M yes Morocco Jewish - - - - 2 Johan den Dunnen
+/. - c.1386_1435del r.(?) p.(Gln462HisfsTer17) Both (homozygous) - pathogenic (recessive) g.40434274_40434323del g.39968602_39968651del 1423_1472deldelCAGCCGGAACGTGTCAAGTTTACACTGAACATGCTCGTGACCATGGCTCC - MFSD2A_000010 ACMG PVS1, PM2, PP4 PubMed: Scala 2020 - - Germline yes - - - - DNA SEQ-NG - - NEDMISBA;MCPH15 FamFPat7 PubMed: Scala 2020 2-generation family, 1 affected M yes Saudi Arabia - - - - - 1 Marcello Scala
+/. - c.1478C>T r.(?) p.(Pro493Leu) Both (homozygous) - likely pathogenic (recessive) g.40434366C>T g.39968694C>T - - MFSD2A_000003 ACMG PS3, PM2, PP3, PP4 PubMed: Scala 2020 - - Germline yes - - - - DNA SEQ-NG - - NEDMISBA;MCPH15 FamAPat1 PubMed: Scala 2020 2-generation family, 1 affected F yes Iran - - - - - 1 Marcello Scala
Legend   How to query  


Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.