Full data view for gene NEFH

Information The variants shown are described using the NM_021076.3 transcript reference sequence.

86 entries on 1 page. Showing entries 1 - 86.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/. - c.21G>A r.(?) p.(Ala7=) Unknown - likely benign g.29876272G>A g.29480283G>A NEFH(NM_021076.4):c.21G>A (p.A7=) - NEFH_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.21G>A r.(?) p.(Ala7=) Unknown - benign g.29876272G>A - NEFH(NM_021076.4):c.21G>A (p.A7=) - NEFH_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.81G>A r.(?) p.(=) Unknown - benign g.29876332G>A - NEFH(NM_021076.4):c.81G>A (p.A27=) - NEFH_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.121G>T r.(?) p.(Ala41Ser) Unknown - VUS g.29876372G>T g.29480383G>T NEFH(NM_021076.4):c.121G>T (p.A41S) - NEFH_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.123T>C r.(?) p.(Ala41=) Unknown - benign g.29876374T>C - NEFH(NM_021076.4):c.123T>C (p.A41=) - NEFH_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.269C>T r.(?) p.(Ala90Val) Unknown - likely benign g.29876520C>T - NEFH(NM_021076.4):c.269C>T (p.A90V) - NEFH_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.297G>A r.(?) p.(Glu99=) Unknown - benign g.29876548G>A - NEFH(NM_021076.4):c.297G>A (p.E99=) - NEFH_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.469_491del r.(?) p.(Val157Argfs*115) Unknown - VUS g.29876720_29876742del - - - NEFH_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.555A>C r.(?) p.(Leu185=) Unknown - benign g.29876806A>C - NEFH(NM_021076.4):c.555A>C (p.L185=) - NEFH_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.605del r.(?) p.(Leu202Argfs*62) Unknown - pathogenic g.29876856del - NEFH(NM_021076.4):c.605delT (p.L202Rfs*62) - NEFH_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.623A>T r.(?) p.(Glu208Val) Unknown - likely benign g.29876874A>T g.29480885A>T NEFH(NM_021076.4):c.623A>T (p.E208V) - NEFH_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.744C>A r.(?) p.(Ser248=) Unknown - likely benign g.29876995C>A g.29481006C>A NEFH(NM_021076.4):c.744C>A (p.S248=) - NEFH_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.745G>A r.(?) p.(Gly249Ser) Unknown - benign g.29876996G>A g.29481007G>A NEFH(NM_021076.4):c.745G>A (p.G249S) - NEFH_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.759G>T r.(?) p.(Ala253=) Unknown - benign g.29877010G>T - NEFH(NM_021076.4):c.759G>T (p.A253=) - NEFH_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.762G>C r.(?) p.(Gln254His) Unknown - VUS g.29877013G>C - NEFH(NM_021076.4):c.762G>C (p.Q254H) - NEFH_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.787C>T r.(?) p.(Leu263=) Unknown - likely benign g.29877038C>T g.29481049C>T NEFH(NM_021076.4):c.787C>T (p.L263=) - NEFH_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.883+7A>G r.(=) p.(=) Unknown - likely benign g.29877141A>G g.29481152A>G NEFH(NM_021076.4):c.883+7A>G - NEFH_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.883+16G>A r.(=) p.(=) Unknown - likely benign g.29877150G>A g.29481161G>A NEFH(NM_021076.4):c.883+16G>A - NEFH_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.883+16G>A r.(=) p.(=) Unknown - likely benign g.29877150G>A g.29481161G>A NEFH(NM_021076.4):c.883+16G>A - NEFH_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1054C>A r.(?) p.(Arg352Ser) Unknown - likely benign g.29879534C>A g.29483545C>A NEFH(NM_021076.4):c.1054C>A (p.R352S) - NEFH_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1054C>A r.(?) p.(Arg352Ser) Unknown - VUS g.29879534C>A - NEFH(NM_021076.4):c.1054C>A (p.R352S) - NEFH_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1055G>A r.(?) p.(Arg352His) Unknown - likely benign g.29879535G>A - NEFH(NM_021076.4):c.1055G>A (p.R352H, p.(Arg352His)) - NEFH_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1055G>A r.(?) p.(Arg352His) Unknown - VUS g.29879535G>A - NEFH(NM_021076.4):c.1055G>A (p.R352H, p.(Arg352His)) - NEFH_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1055G>A r.(?) p.(Arg352His) Unknown - VUS g.29879535G>A - NEFH(NM_021076.4):c.1055G>A (p.R352H, p.(Arg352His)) - NEFH_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1116G>A r.(?) p.(Arg372=) Unknown - likely benign g.29881744G>A g.29485755G>A NEFH(NM_021076.4):c.1116G>A (p.R372=) - NEFH_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1169A>C r.(?) p.(Asn390Thr) Unknown - likely benign g.29881797A>C - NEFH(NM_021076.3):c.1169A>C (p.N390T), NEFH(NM_021076.4):c.1169A>C (p.N390T) - NEFH_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1169A>C r.(?) p.(Asn390Thr) Unknown - VUS g.29881797A>C - NEFH(NM_021076.3):c.1169A>C (p.N390T), NEFH(NM_021076.4):c.1169A>C (p.N390T) - NEFH_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1200C>T r.(?) p.(Ala400=) Unknown - benign g.29881828C>T g.29485839C>T NEFH(NM_021076.3):c.1200C>T (p.A400=), NEFH(NM_021076.4):c.1200C>T (p.A400=) - NEFH_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1200C>T r.(?) p.(Ala400=) Unknown - benign g.29881828C>T g.29485839C>T NEFH(NM_021076.3):c.1200C>T (p.A400=), NEFH(NM_021076.4):c.1200C>T (p.A400=) - NEFH_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1200C>T r.(?) p.(Ala400=) Unknown - benign g.29881828C>T g.29485839C>T NEFH(NM_021076.3):c.1200C>T (p.A400=), NEFH(NM_021076.4):c.1200C>T (p.A400=) - NEFH_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 4 c.1337T>C r.(?) p.(Val446Ala) Unknown ACMG VUS g.29884966T>C g.29488977T>C - - NEFH_000052 - - - - Germline - - - - - DNA SEQ-NG - - CMT - - - M - (Neutral Zone (Saudia Arabia/Iraq)) - - - - - 1 Gemeinschaftspraxis für Humangenetik Dresden
?/. - c.1337T>C r.(?) p.(Val446Ala) Unknown - VUS g.29884966T>C - NEFH(NM_021076.4):c.1337T>C (p.(Val446Ala)) - NEFH_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1387G>A r.(?) p.(Glu463Lys) Unknown - benign g.29885016G>A g.29489027G>A NEFH(NM_021076.3):c.1387G>A (p.E463K), NEFH(NM_021076.4):c.1387G>A (p.E463K) - NEFH_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1387G>A r.(?) p.(Glu463Lys) Unknown - benign g.29885016G>A g.29489027G>A NEFH(NM_021076.3):c.1387G>A (p.E463K), NEFH(NM_021076.4):c.1387G>A (p.E463K) - NEFH_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1387G>A r.(?) p.(Glu463Lys) Unknown - benign g.29885016G>A g.29489027G>A NEFH(NM_021076.3):c.1387G>A (p.E463K), NEFH(NM_021076.4):c.1387G>A (p.E463K) - NEFH_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1446G>A r.(?) p.(=) Unknown - benign g.29885075G>A - NEFH(NM_021076.4):c.1446G>A (p.E482=) - NEFH_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1446G>A r.(?) p.(=) Unknown - likely benign g.29885075G>A - NEFH(NM_021076.4):c.1446G>A (p.E482=) - NEFH_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1575G>C r.(?) p.(Lys525Asn) Unknown - likely benign g.29885204G>C - NEFH(NM_021076.3):c.1575G>C (p.K525N), NEFH(NM_021076.4):c.1575G>C (p.K525N) - NEFH_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1575G>C r.(?) p.(Lys525Asn) Unknown - VUS g.29885204G>C - NEFH(NM_021076.3):c.1575G>C (p.K525N), NEFH(NM_021076.4):c.1575G>C (p.K525N) - NEFH_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1653G>A r.(?) p.(=) Unknown - likely benign g.29885282G>A - NEFH(NM_021076.4):c.1653G>A (p.K551=) - NEFH_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 4 c.1656_1697del r.(?) p.(Ala554_Pro567del) Unknown - VUS g.29885285_29885326del g.29489296_29489337del c.1646_1687delAGGCCAAGTCTCCAGCAAAGGAAGAGGCAAAGTCACCGCCTG - NEFH_000038 - PubMed: Karthikeyan 2024 - - Germline/De novo (untested) - - - - - DNA SEQ-NG - screened DMD, SGCB, DMD, NEFH, COL6A1, COL6A2, COL6A3, CAPN3, DYSF, FLNC, LAMA2, SGCA, SGCD, SGCG, PLEC, SYNE1 DMD MDCRC/0167/B-172 PubMed: Karthikeyan 2024 - M yes India - - - yes - 1 Lakshmi Bremadesam
?/. - c.1665G>C r.(?) p.(Lys555Asn) Unknown - VUS g.29885294G>C - NEFH(NM_021076.4):c.1665G>C (p.K555N) - NEFH_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1667A>C r.(?) p.(Glu556Ala) Unknown - VUS g.29885296A>C - NEFH(NM_021076.4):c.1667A>C (p.E556A) - NEFH_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1723C>T r.(?) p.(Pro575Ser) Unknown - likely benign g.29885352C>T - NEFH(NM_021076.4):c.1723C>T (p.P575S) - NEFH_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1723C>T r.(?) p.(Pro575Ser) Unknown - likely benign g.29885352C>T - NEFH(NM_021076.4):c.1723C>T (p.P575S) - NEFH_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1740C>T r.(?) p.(Ser580=) Unknown - likely benign g.29885369C>T g.29489380C>T NEFH(NM_021076.3):c.1740C>T (p.S580=), NEFH(NM_021076.4):c.1740C>T (p.S580=) - NEFH_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1740C>T r.(?) p.(Ser580=) Unknown - likely benign g.29885369C>T g.29489380C>T NEFH(NM_021076.3):c.1740C>T (p.S580=), NEFH(NM_021076.4):c.1740C>T (p.S580=) - NEFH_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1740C>T r.(?) p.(Ser580=) Unknown - benign g.29885369C>T g.29489380C>T NEFH(NM_021076.3):c.1740C>T (p.S580=), NEFH(NM_021076.4):c.1740C>T (p.S580=) - NEFH_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1743C>T r.(?) p.(Pro581=) Unknown - likely benign g.29885372C>T - NEFH(NM_021076.4):c.1743C>T (p.P581=) - NEFH_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1777_1778del r.(?) p.(Lys593ValfsTer4) Unknown - VUS g.29885406_29885407del - NEFH(NM_021076.3):c.1776_1777del (p.(Lys593ValfsTer4)) - NEFH_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1783C>T r.(?) p.(Pro595Ser) Unknown - likely benign g.29885412C>T - NEFH(NM_021076.4):c.1783C>T (p.P595S) - NEFH_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1783C>T r.(?) p.(Pro595Ser) Unknown - likely benign g.29885412C>T - NEFH(NM_021076.4):c.1783C>T (p.P595S) - NEFH_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1844C>T r.(?) p.(Pro615Leu) Unknown - benign g.29885473C>T g.29489484C>T NEFH(NM_021076.3):c.1844C>T (p.P615L), NEFH(NM_021076.4):c.1844C>T (p.P615L) - NEFH_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1844C>T r.(?) p.(Pro615Leu) Unknown - benign g.29885473C>T g.29489484C>T NEFH(NM_021076.3):c.1844C>T (p.P615L), NEFH(NM_021076.4):c.1844C>T (p.P615L) - NEFH_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1844C>T r.(?) p.(Pro615Leu) Unknown - benign g.29885473C>T g.29489484C>T NEFH(NM_021076.3):c.1844C>T (p.P615L), NEFH(NM_021076.4):c.1844C>T (p.P615L) - NEFH_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1941G>C r.(?) p.(Lys647Asn) Unknown - likely benign g.29885570G>C - NEFH(NM_021076.4):c.1941G>C (p.K647N) - NEFH_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1941G>C r.(?) p.(Lys647Asn) Unknown - benign g.29885570G>C - NEFH(NM_021076.4):c.1941G>C (p.K647N) - NEFH_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1947_1964dup r.(?) p.(Ala652_Lys657dup) Unknown - benign g.29885576_29885593dup g.29489587_29489604dup NEFH(NM_021076.3):c.1947_1964dupTGAGAAGGCCAAGTCCCC (p.A652_K657dup), NEFH(NM_021076.4):c.1947_1964dupTGAGAAGGCCAAGTCCCC (p.A652_K657dup) - NEFH_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1947_1964dup r.(?) p.(Ala652_Lys657dup) Unknown - benign g.29885576_29885593dup g.29489587_29489604dup NEFH(NM_021076.3):c.1947_1964dupTGAGAAGGCCAAGTCCCC (p.A652_K657dup), NEFH(NM_021076.4):c.1947_1964dupTGAGAAGGCCAAGTCCCC (p.A652_K657dup) - NEFH_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1947_1964dup r.(?) p.(Ala652_Lys657dup) Unknown - benign g.29885576_29885593dup g.29489587_29489604dup NEFH(NM_021076.3):c.1947_1964dupTGAGAAGGCCAAGTCCCC (p.A652_K657dup), NEFH(NM_021076.4):c.1947_1964dupTGAGAAGGCCAAGTCCCC (p.A652_K657dup) - NEFH_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1996_1997insAAGAGG r.(?) p.(Lys665_Ala666insGluGlu) Unknown - VUS g.29885625_29885626insAAGAGG - NEFH(NM_021076.4):c.1996_1997insAAGAGG (p.(Lys665_Ala666insGluGlu)) - NEFH_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2157T>C r.(?) p.(Pro719=) Unknown - likely benign g.29885786T>C g.29489797T>C NEFH(NM_021076.4):c.2157T>C (p.P719=) - NEFH_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2232T>C r.(?) p.(Ala744=) Unknown - benign g.29885861T>C g.29489872T>C NEFH(NM_021076.3):c.2232T>C (p.A744=), NEFH(NM_021076.4):c.2232T>C (p.A744=) - NEFH_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2232T>C r.(?) p.(Ala744=) Unknown - benign g.29885861T>C g.29489872T>C NEFH(NM_021076.3):c.2232T>C (p.A744=), NEFH(NM_021076.4):c.2232T>C (p.A744=) - NEFH_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2232T>C r.(?) p.(Ala744=) Unknown - benign g.29885861T>C g.29489872T>C NEFH(NM_021076.3):c.2232T>C (p.A744=), NEFH(NM_021076.4):c.2232T>C (p.A744=) - NEFH_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2232T>C r.(?) p.(Ala744=) Unknown - benign g.29885861T>C g.29489872T>C NEFH(NM_021076.3):c.2232T>C (p.A744=), NEFH(NM_021076.4):c.2232T>C (p.A744=) - NEFH_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2232_2249del r.(?) p.(Ser752_Lys757del) Unknown - likely benign g.29885861_29885878del g.29489872_29489889del NEFH(NM_021076.4):c.2232_2249delTAAGTCCCCAGAGAAGGC (p.S752_K757del) - NEFH_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2232_2249del r.(?) p.(Ser752_Lys757del) Unknown - benign g.29885861_29885878del g.29489872_29489889del NEFH(NM_021076.4):c.2232_2249delTAAGTCCCCAGAGAAGGC (p.S752_K757del) - NEFH_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2232_2249del r.(?) p.(Ser752_Lys757del) Unknown - likely benign g.29885861_29885878del - NEFH(NM_021076.4):c.2232_2249delTAAGTCCCCAGAGAAGGC (p.S752_K757del) - NEFH_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2307A>C r.(?) p.(=) Unknown - likely benign g.29885936A>C - NEFH(NM_021076.4):c.2307A>C (p.P769=) - NEFH_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2339A>G r.(?) p.(Lys780Arg) Unknown - VUS g.29885968A>G g.29489979A>G - - NEFH_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2368_2370del r.(?) p.(Lys790del) Unknown - likely benign g.29885997_29885999del g.29490008_29490010del NEFH(NM_021076.4):c.2368_2370delAAG (p.K790del) - NEFH_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2414A>C r.(?) p.(Glu805Ala) Unknown - benign g.29886043A>C g.29490054A>C NEFH(NM_021076.3):c.2414A>C (p.E805A), NEFH(NM_021076.4):c.2414A>C (p.E805A) - NEFH_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2414A>C r.(?) p.(Glu805Ala) Unknown - benign g.29886043A>C g.29490054A>C NEFH(NM_021076.3):c.2414A>C (p.E805A), NEFH(NM_021076.4):c.2414A>C (p.E805A) - NEFH_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2414A>C r.(?) p.(Glu805Ala) Unknown - benign g.29886043A>C g.29490054A>C NEFH(NM_021076.3):c.2414A>C (p.E805A), NEFH(NM_021076.4):c.2414A>C (p.E805A) - NEFH_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2465C>T r.(?) p.(Ser822Phe) Unknown - VUS g.29886094C>T g.29490105C>T NEFH(NM_021076.4):c.2465C>T (p.S822F) - NEFH_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2712C>T r.(?) p.(Pro904=) Unknown - benign g.29886341C>T g.29490352C>T NEFH(NM_021076.4):c.2712C>T (p.P904=) - NEFH_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2757C>T r.(?) p.(Asp919=) Unknown - benign g.29886386C>T g.29490397C>T NEFH(NM_021076.4):c.2757C>T (p.D919=) - NEFH_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2784A>G r.(?) p.(Val928=) Unknown - benign g.29886413A>G g.29490424A>G NEFH(NM_021076.3):c.2784A>G (p.V928=), NEFH(NM_021076.4):c.2784A>G (p.V928=) - NEFH_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2784A>G r.(?) p.(Val928=) Unknown - benign g.29886413A>G g.29490424A>G NEFH(NM_021076.3):c.2784A>G (p.V928=), NEFH(NM_021076.4):c.2784A>G (p.V928=) - NEFH_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2784A>G r.(?) p.(Val928=) Unknown - benign g.29886413A>G g.29490424A>G NEFH(NM_021076.3):c.2784A>G (p.V928=), NEFH(NM_021076.4):c.2784A>G (p.V928=) - NEFH_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2786C>A r.(?) p.(Ala929Asp) Unknown - VUS g.29886415C>A - NEFH(NM_021076.4):c.2786C>A (p.A929D) - NEFH_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.2948C>G r.(?) p.(Ser983*) Unknown - likely pathogenic g.29886577C>G - NEFH(NM_021076.4):c.2948C>G (p.(Ser983*)) - NEFH_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.3017_3020dup r.(?) p.(Pro1008AlafsTer56) Unknown - pathogenic g.29886646_29886649dup g.29490657_29490660dup - - NEFH_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.3023dup r.(?) p.(Glu1009Argfs*54) Maternal (confirmed) ACMG likely pathogenic g.29886652dup g.29490663dup - - NEFH_000001 - PubMed: Trujillano 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - - ALS1 - PubMed: Trujillano 2017 unaffected heterozygous carrier mother, father not available - - - - - - - - 1 Daniel Trujillano
-?/. - c.*2G>T r.(=) p.(=) Unknown - likely benign g.29886694G>T - NEFH(NM_021076.4):c.*2G>T - NEFH_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.