Full data view for gene RBP4

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_006744.3 transcript reference sequence.

46 entries on 1 page. Showing entries 1 - 46.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
?/? 1 c.-679G>A r.(=) p.(=) Unknown - VUS g.95361588C>T g.93601831C>T - - RBP4_000006 - - - rs3758539 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - F - Portugal - - - - - 1 Carolina Lemos
?/? 1 c.-679G>A r.(=) p.(=) Both (homozygous) - VUS g.95361588C>T g.93601831C>T - - RBP4_000006 - - - rs3758539 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - M - Portugal - - - - - 1 Carolina Lemos
-?/. - c.-517G>A r.(?) p.(=) Unknown - likely benign g.95361426C>T - RBP4(NM_001323518.2):c.48G>A (p.T16=) - RBP4_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-7G>C r.(?) p.(=) Unknown - likely benign g.95360792C>G - RBP4(NM_001323517.1):c.-7G>C - RBP4_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-5del r.(?) p.(=) Unknown - benign g.95360792del g.93601035del RBP4(NM_001323517.1):c.-5delG - RBP4_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.50G>T r.(?) p.(Arg17Leu) Unknown - benign g.95360736C>A g.93600979C>A RBP4(NM_006744.4):c.50G>T (p.R17L) - RBP4_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.67C>T r.(?) p.(Arg23*) Unknown ACMG likely pathogenic g.95360719G>A g.93600962G>A RP1 c.2690_2695del, p.(Ser897*), RBP4 c.67C>T, p.(Arg23*) - RBP4_000015 - PubMed: Jespersgaar 2019 - - Germline ? - - - - DNA SEQ-NG-I blood 125 genes associated with inherited retinal disorders, see paper supplemental data retinal disease 234 PubMed: Jespersgaar 2019 - ? - Denmark - - - - - 1 LOVD
+/. - c.67C>T r.(?) p.(Arg23*) Both (homozygous) - pathogenic (recessive) g.95360719G>A g.93600962G>A - - RBP4_000015 - PubMed: Cehajic-Kapetanovic 2020 - - Germline yes - - - - DNA SEQ, SEQ-NG - 111 gene panel RP patient PubMed: Cehajic-Kapetanovic 2020 4-generation family, 2 affected brothers, unaffected parents M - Wales - - - - - 2 Johan den Dunnen
+/. 2i c.111+1G>A r.(111_112ins[a;111+1_112-1]) p.(Arg37_Phe38insX[38]) Both (homozygous) - pathogenic (recessive) g.95360674C>T g.93600917C>T - - RBP4_000023 insertion intron predicted from larger protein band on WB (reduced expression) PubMed: Cukras 2012 - - Germline yes - - - - DNA SEQ, SEQ-NG - - RD FamPatIV2/4 PubMed: Cukras 2012 6-generation family, affected brother/sister, unaffected heterozygous parents/relatives F;M yes United States white - - - - 2 Johan den Dunnen
+/. 2i c.112-2A>G r.spl p.? Both (homozygous) ACMG pathogenic (recessive) g.95360562T>C g.93600805T>C - - RBP4_000026 ACMG PVS1, PM2_sup, PM3_sup PubMed: Kessel 2022 - - Germline yes - - - - DNA SEQ - - RP FamPatIV1/2 PubMed: Kessel 2022 5-generation family, 2 affected (brother/sister), unaffected non-carrier mother/relatives F;M - Denmark - - - - - 2 Johan den Dunnen
?/. - c.172A>G r.(?) p.(Asn58Asp) Unknown - VUS g.95360500T>C g.93600743T>C RBP4(NM_001323517.1):c.172A>G (p.N58D) - RBP4_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.176T>A r.(?) p.(Ile59Asn) Maternal (confirmed) - pathogenic (recessive) g.95360496A>T g.93600739A>T Ile41Asn - RBP4_000021 - PubMed: Seeliger 1999 - - Germline yes - - - - DNA arraySNP, SEQ - - RD FamPatBR/MT PubMed: Seeliger 1999 2-generation family, 2 affected sisters, unaffected heterozygous parents F - Germany - - - - - 2 Johan den Dunnen
+/. - c.217G>A r.(?) p.(Ala73Thr) Maternal (confirmed) - likely pathogenic g.95360455C>T g.93600698C>T - - RBP4_000025 - PubMed: Chou 2015 - - Germline - - - - - DNA SEQ - - ? Fam2 PubMed: Chou 2015 2-generation family, 1 affected, unaffected carrier mother M - United States - - - - - 1 Johan den Dunnen
+/. - c.217G>A r.(?) p.(Ala73Thr) Maternal (confirmed) - likely pathogenic g.95360455C>T g.93600698C>T - - RBP4_000025 - PubMed: Chou 2015 - - Germline - - - - - DNA SEQ - - MCOP Fam3 PubMed: Chou 2015 2-generation family, 1 affected, unaffected carrier mother F - United States - - - - - 1 Johan den Dunnen
+/. - c.217G>A r.(?) p.(Ala73Thr) Maternal (confirmed) - pathogenic (maternal) g.95360455C>T g.93600698C>T - - RBP4_000025 maternal transmission PubMed: Kaur 2023 - - Germline - - - - - DNA SEQ-NG - WES ? Fam PubMed: Kaur 2023 2-generation family, 2 affected, fetuses unaffected carrier mother - - India - - - - - 2 Johan den Dunnen
+/. - c.217G>A r.(?) p.(Ala73Thr) Maternal (confirmed) - pathogenic (!) g.95360455C>T g.93600698C>T - - RBP4_000025 - PubMed: Plaisancie 2023 - - Germline - - - - - DNA SEQ, SEQ-NG - gene panel MCOP Fam1 PubMed: Plaisancie 2023 2-generation family, 2 affected fetuses (brother/sister), unaffected carrier mother F;M - France - <0d - - - 2 Johan den Dunnen
+?/. - c.218C>T r.(?) p.(Ala73Val) Maternal (confirmed) - likely pathogenic (!) g.95360454G>A g.93600697G>A - - RBP4_000033 - PubMed: Plaisancie 2023 - - Germline - - - - - DNA SEQ, SEQ-NG - gene panel MCOP Fam2 PubMed: Plaisancie 2023 2-generation family, 2 affected (brother/sister), unaffected carrier mother F;M - France - - - - - 2 Johan den Dunnen
+/. - c.223G>A r.(?) p.(Ala75Thr) Parent #1 - likely pathogenic (!) g.95360449C>T g.93600692C>T - - RBP4_000024 10/11 inherited from asymptomatic mother, reduced penetrance PubMed: Chou 2015 - - Germline yes - - - - DNA arraySNP, SEQ - - MCOP Fam1 PubMed: Chou 2015 7-generation family, 4 affected (3F, 8M) F;M - United States - - - - - 11 Johan den Dunnen
?/. - c.239G>C r.(?) p.(Arg80Pro) Unknown - VUS g.95360433C>G - RBP4(NM_001323517.1):c.239G>C (p.R80P) - RBP4_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.248+1G>A r.spl? p.? Both (homozygous) - pathogenic (recessive) g.95360423C>T - 10:95360423C>T ENST00000371467.1:c.248+1G>A - RBP4_000014 - PubMed: Carss 2017 - - Germline - - - - - DNA SEQ-NG - WGS retinal disease G001053 PubMed: Carss 2017 - F - United Kingdom (Great Britain) Europe - - - - 1 LOVD
+?/. - c.248+1G>A r.spl p.(?) Both (homozygous) - likely pathogenic g.95360423C>T g.93600666C>T RBP4 c.248+1G>A, - RBP4_000014 homozygous PubMed: Turro 2020 - - Germline/De novo (untested) ? - - - - DNA SEQ-NG-I blood whole genome sequencing retinal disease G001053 PubMed: Turro 2020 only individuals with mutations in retinal disease genes from this publication were inserted into LOVD ? - (United Kingdom (Great Britain)) - - - - - 1 LOVD
+/. 3i c.248+1G>A r.spl p.? Both (homozygous) - pathogenic (recessive) g.95360423C>T g.93600666C>T - - RBP4_000014 - PubMed: Khan 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WGS RD patient PubMed: Khan 2017 2-generation family, 1 affected, unaffected parents F yes Iran - - - - - 1 Johan den Dunnen
+?/. - c.271A>G r.(?) p.(Met91Val) Maternal (confirmed) - likely pathogenic (!) g.95360234T>C g.93600477T>C - - RBP4_000032 - PubMed: Plaisancie 2023 - - Germline - - - - - DNA SEQ, SEQ-NG - WGS MCOP Fam3 PubMed: Plaisancie 2023 3-generation family, 2 affected (grandmother/girl), unaffected carrier mother F - United Kingdom (Great Britain) - - - - - 2 Johan den Dunnen
+/. - c.278G>A r.(?) p.(Gly93Asp) Paternal (inferred) - pathogenic (recessive) g.95360227C>T g.93600470C>T GIy75Asp - RBP4_000022 father not available PubMed: Seeliger 1999 - - Germline yes - - - - DNA arraySNP, SEQ - - RD FamPatBR/MT PubMed: Seeliger 1999 2-generation family, 2 affected sisters, unaffected heterozygous parents F - Germany - - - - - 2 Johan den Dunnen
-?/. - c.333A>G r.(?) p.(Val111=) Unknown - likely benign g.95360172T>C g.93600415T>C RBP4(NM_001323517.1):c.333A>G (p.V111=) - RBP4_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/? 4i c.355+1697A>G r.(=) p.(=) Unknown - VUS g.95358453T>C g.93598696T>C - - RBP4_000005 - - - rs28383574 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - F - Portugal - - - - - 1 Carolina Lemos
?/? 4i c.355+1697A>G r.(=) p.(=) Both (homozygous) - VUS g.95358453T>C g.93598696T>C - - RBP4_000005 - - - rs28383574 Germline - - - - - DNA PCRm - - amyloidosis, hereditary, transthyretin-related - - - M - Portugal - - - - - 1 Carolina Lemos
?/? 4i c.355+3045T>C r.(=) p.(=) Unknown - VUS g.95357105A>G g.93597348A>G - - RBP4_000004 - - - rs11187545 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - F - Portugal - - - - - 1 Carolina Lemos
?/? 4i c.355+3045T>C r.(=) p.(=) Both (homozygous) - VUS g.95357105A>G g.93597348A>G - - RBP4_000004 - - - rs11187545 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - F - Portugal - - - - - 1 Carolina Lemos
?/? 4i c.356-1825C>T r.(=) p.(=) Unknown - VUS g.95355617G>A g.93595860G>A - - RBP4_000003 - - - rs7094671 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - M - Portugal - - - - - 1 Carolina Lemos
?/? 4i c.356-1825C>T r.(=) p.(=) Both (homozygous) - VUS g.95355617G>A g.93595860G>A - - RBP4_000003 - - - rs7094671 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - F - Portugal - - - - - 1 Carolina Lemos
?/? 4i c.356-1606C>T r.(=) p.(=) Unknown - VUS g.95355398G>A g.93595641G>A - - RBP4_000002 - - - rs7091052 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - F - Portugal - - - - - 1 Carolina Lemos
?/? 4i c.356-1606C>T r.(=) p.(=) Both (homozygous) - VUS g.95355398G>A g.93595641G>A - - RBP4_000002 - - - rs7091052 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - F - Portugal - - - - - 1 Carolina Lemos
+?/. - c.358G>C r.(?) p.(Asp120His) Unknown - likely pathogenic g.95353790C>G g.93594033C>G - - RBP4_000031 - PubMed: Plaisancie 2023 - - Germline - - - - - DNA SEQ, SEQ-NG - gene panel MCOP Fam5 PubMed: Plaisancie 2023 2-generation family, 1 affected, unaffected parents F - France - - - - - 1 Johan den Dunnen
+?/. - c.358G>T r.(?) p.(Asp120Tyr) Maternal (confirmed) - likely pathogenic (!) g.95353790C>A g.93594033C>A - - RBP4_000030 - PubMed: Plaisancie 2023 - - Germline - - - - - DNA SEQ, SEQ-NG - gene panel MCOP Fam4 PubMed: Plaisancie 2023 2-generation family, 3 affected fetuses (3M), unaffected carrier mother M - France - <0d - - - 3 Johan den Dunnen
+?/. - c.383A>G r.(?) p.(Asp128Gly) Maternal (confirmed) - likely pathogenic (!) g.95353765T>C g.93594008T>C - - RBP4_000029 - PubMed: Plaisancie 2023 - - Germline - - - - - DNA SEQ, SEQ-NG - gene panel ? Fam6 PubMed: Plaisancie 2023 3-generation family, 2 affected (mother/daughter), unaffected parents F - France - - - - - 2 Johan den Dunnen
+/. - c.394T>A r.(?) p.(Tyr132Asn) Unknown - pathogenic (dominant) g.95353754A>T g.93593997A>T - - RBP4_000027 - PubMed: Riera 2017 - - Germline/De novo (untested) - - - - - DNA SEQ, SEQ-NG - gene panel MCOP FamMA_3 PubMed: Riera 2017 4-generation family, 1 affected, unaffected parents/relatives M - Spain - - - - - 1 Johan den Dunnen
+?/. - c.394T>A r.(?) p.(Tyr132Asn) Maternal (confirmed) - likely pathogenic (!) g.95353754A>T g.93593997A>T - - RBP4_000027 - PubMed: Plaisancie 2023 - - Germline - - - - - DNA SEQ, SEQ-NG - gene panel MCOP Fam7 PubMed: Plaisancie 2023 2-generation family, 1 affected, unaffected carrier mother/3 carrier brothers F - France - - - - - 1 Johan den Dunnen
+?/. 4 c.457_459del r.(?) p.(Ala153del) Both (homozygous) - likely pathogenic (recessive) g.95353689_95353691del - RBP4:c.457_459del - RBP4_000017 - PubMed: Colombo-2020 - - Germline yes - - - - DNA SEQ - - retinal disease - PubMed: Colombo-2020 - F yes - - - - - - 1 LOVD
-?/. - c.471G>A r.(?) p.(Arg157=) Unknown - likely benign g.95353677C>T g.93593920C>T RBP4(NM_006744.3):c.471G>A (p.R157=) - RBP4_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.480C>T r.(?) p.(Asn160=) Unknown - benign g.95353668G>A g.93593911G>A RBP4(NM_006744.4):c.480C>T (p.N160=) - RBP4_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.524_543del r.(?) p.(Glu175Alafs*27) Unknown - likely pathogenic g.95353609_95353628del - RBP4(NM_006744.4):c.524_543delAGGAGCTGTGCCTGGCCAGG (p.E175Afs*27) - RBP4_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.544C>A r.(?) p.(Gln182Lys) Unknown - VUS g.95353604G>T g.93593847G>T RBP4(NM_006744.3):c.544C>A (p.Q182K) - RBP4_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/? 5i c.568+268T>C r.(=) p.(=) Unknown - VUS g.95353312A>G g.93593555A>G - - RBP4_000001 - - - rs17484721 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - F - Portugal - - - - - 1 Carolina Lemos
?/? 5i c.568+268T>C r.(=) p.(=) Both (homozygous) - VUS g.95353312A>G g.93593555A>G - - RBP4_000001 - - - rs17484721 Germline - - - - - DNA PCRm - - Healthy/Control, amyloidosis, hereditary, transthyretin-related - - - M - Portugal - - - - - 1 Carolina Lemos
+?/. - c.569-1G>A r.spl p.? Unknown ACMG likely pathogenic (dominant) g.95351870C>T g.93592113C>T - - RBP4_000028 ACMG PVS1, PM2 PubMed: Aubert-Mucca 2021 SCV001364582 - Germline/De novo (untested) - - - - - DNA SEQ, SEQ-NG - gene panel OCCO SG102327 PubMed: Aubert-Mucca 2021 2-generation family, 1 affected M - France - - - - - 1 Johan den Dunnen
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.