Full data view for gene REST

Information The variants shown are described using the NM_005612.4 transcript reference sequence.

64 entries on 1 page. Showing entries 1 - 64.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+?/. 1 c.99_100insT r.(?) p.(Arg34Serfs*41) Maternal (confirmed) - pathogenic g.216595579_216595580insA g.216422237_216422238insA USH2A c.99_100insT (p.Arg34Serfs*41) - USH2A_000889 apparent homozygosity - uniparental (maternal) isodisomy PubMed: Fu 2020 - - Germline yes - - - - DNA SEQ-NG-I, arraySNP, STR, SEQ blood whole exome sequencing USH II:1 PubMed: Fu 2020 - M - China - - - - - 1 LOVD
-?/. - c.186_188del r.(?) p.(Cys63del) Unknown - likely benign g.57776990_57776992del - REST(NM_005612.5):c.186_188del (p.(Cys63del)) - REST_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.234G>T r.(?) p.(Pro78=) Unknown - benign g.57777038G>T - REST(NM_005612.5):c.234G>T (p.P78=) - REST_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.274G>A r.(?) p.(Gly92Arg) Unknown - likely benign g.57777078G>A g.56910912G>A REST(NM_005612.4):c.274G>A (p.G92R), REST(NM_005612.5):c.274G>A (p.G92R) - REST_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.274G>A r.(?) p.(Gly92Arg) Unknown - likely benign g.57777078G>A - REST(NM_005612.4):c.274G>A (p.G92R), REST(NM_005612.5):c.274G>A (p.G92R) - REST_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.367C>G r.(?) p.(Pro123Ala) Unknown - VUS g.57777171C>G g.56911005C>G REST(NM_005612.4):c.367C>G (p.P123A), REST(NM_005612.5):c.367C>G (p.P123A) - REST_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.367C>G r.(?) p.(Pro123Ala) Unknown - likely benign g.57777171C>G - REST(NM_005612.4):c.367C>G (p.P123A), REST(NM_005612.5):c.367C>G (p.P123A) - REST_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.422C>G r.(?) p.(Pro141Arg) Unknown - VUS g.57777226C>G g.56911060C>G REST(NM_001363453.1):c.422C>G (p.P141R), REST(NM_005612.4):c.422C>G (p.P141R), REST(NM_005612.5):c.422C>G (p.P141R) - REST_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.422C>G r.(?) p.(Pro141Arg) Unknown - likely benign g.57777226C>G - REST(NM_001363453.1):c.422C>G (p.P141R), REST(NM_005612.4):c.422C>G (p.P141R), REST(NM_005612.5):c.422C>G (p.P141R) - REST_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2 c.479G>C r.(?) p.(Arg160Pro) Unknown - pathogenic g.57777283G>C g.56911117G>C - - REST_000003 DNA from parents unavailable PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Unknown - - - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 2 Generation family, 1 affected F no (United Kingdom (Great Britain)) - >00y11m - - - 1 Tamara Hettipathirana
+/. 2 c.645del r.(?) p.(Ile216Phefs*20) Unknown - pathogenic g.57777449del g.56911283del 642delC - REST_000006 paternal DNA unavailable PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Unknown - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 2 generation family, 1 affected M no (United Kingdom (Great Britain)) - >03y11m - - - 1 Tamara Hettipathirana
+/. 2 c.736C>T r.(?) p.(Arg246*) Maternal (confirmed) - pathogenic g.57777540C>T g.56911374C>T - - REST_000004 - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Germline - - - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 2-generation family, 1 affected, unaffected carrier mother M no (United Kingdom (Great Britain)) - >03y04m - - - 1 Tamara Hettipathirana
+/. 2 c.831_832del r.(?) p.(Cys278Trpfs*18) Paternal (confirmed) - pathogenic g.57777635_57777636del g.56911469_56911470del 831_832delAT - REST_000002 - PubMed: Mahamdallie 2015, Journal: Mahamdallie 2015 - - Germline - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015, Journal: Mahamdallie 2015 2-generation family, 1 affected, unaffected carrier father M no (United Kingdom (Great Britain)) - >03y02m - - - 1 Tamara Hettipathirana
+/. 2 c.831_832del r.(?) p.(Cys278Trpfs*18) Maternal (confirmed) - pathogenic g.57777635_57777636del g.56911469_56911470del 831_832delAT - REST_000002 - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Germline - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 2-generation family, 2 affected sisters, unaffected carrier mother F no (United Kingdom (Great Britain)) - >03y08m - - - 2 Tamara Hettipathirana
+/. 2 c.831_832del r.(?) p.(Cys278Trpfs*18) Maternal (confirmed) - pathogenic g.57777635_57777636del g.56911469_56911470del - - REST_000002 - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Germline - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 sister of FAM0482 F no (United Kingdom (Great Britain)) - >06y00m - - - 1 Tamara Hettipathirana
?/. - c.877C>T r.(?) p.(Gln293*) Unknown - VUS g.57777681C>T - - - REST_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2i c.899-2A>G r.spl p.? Unknown - pathogenic g.57785951A>G g.56919785A>G - - REST_000005 - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Unknown - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamadallie 2015 Journal: Mahamdallie 2015 2 generation family, 1 affected M no (United Kingdom (Great Britain)) - >02y10m - - - 1 Tamara Hettipathirana
+/. 3 c.965A>G r.(?) p.(His322Arg) Unknown - pathogenic g.57786019A>G g.56919853A>G - - REST_000010 - PubMed: Mahamdallie 2015, Journal: Mahamdallie 2015 - - Unknown - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 2 generation family, 1 affected M no (United Kingdom (Great Britain)) - >00y06m - - - 1 Tamara Hettipathirana
+/. 3 c.965A>G r.(?) p.(His322Arg) Paternal (confirmed) - pathogenic g.57786019A>G g.56919853A>G - - REST_000010 - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Germline - 3/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 3-generation family, 3 affected first cousins, 2 unaffected carrier females, 1 unaffected carrier male F no (United Kingdom (Great Britain)) - >03y00m - - - 3 Tamara Hettipathirana
+/. 3 c.965A>G r.(?) p.(His322Arg) Maternal (confirmed) - pathogenic g.57786019A>G g.56919853A>G - - REST_000010 - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Germline - 3/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 first cousin of FAM0481 M no (United Kingdom (Great Britain)) - >00y06m - - - 1 Tamara Hettipathirana
?/. - c.968T>G r.(?) p.(Met323Arg) Unknown - VUS g.57786022T>G - - - REST_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 3 c.977dup r.(?) p.(His326Glnfs*4) Unknown - pathogenic g.57786031dup g.56919865dup - - REST_000009 - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - De novo - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 2 generation family, 1 affected M no (United Kingdom (Great Britain)) - >03y07m - - - 1 Tamara Hettipathirana
+/. - c.983-2247C>G r.982_983ins983-2246_983-2177 p.? Parent #1 - pathogenic (dominant) g.57793760C>G g.56927594C>G - - REST_000036 mapping LOD score 4.67 PubMed: Nakano 2018 - - Germline yes - - - - DNA, RNA arraySNP, RT-PCR, SEQ - - DFNA FamLMG2 PubMed: Peters 2008, PubMed: Nakano 2018 2-generation family, 12 affected (6F, 6M) F;M no United States - - - - - 12 Johan den Dunnen
-?/. - c.1095C>T r.(?) p.(His365=) Unknown - likely benign g.57796119C>T - REST(NM_005612.4):c.1095C>T (p.H365=), REST(NM_005612.5):c.1095C>T (p.H365=) - REST_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1095C>T r.(?) p.(His365=) Unknown - likely benign g.57796119C>T - REST(NM_005612.4):c.1095C>T (p.H365=), REST(NM_005612.5):c.1095C>T (p.H365=) - REST_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1151T>G r.(?) p.(Val384Gly) Unknown - VUS g.57796175T>G g.56930009T>G REST(NM_005612.4):c.1151T>G (p.V384G) - REST_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 4 c.1236T>A r.(?) p.(His412Gln) Unknown - pathogenic g.57796260T>A g.56930094T>A - - REST_000008 paternal DNA unavailable PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Unknown - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 2 generation family, 1 affected F no (United Kingdom (Great Britain)) - >04y06m - - - 1 Tamara Hettipathirana
+/. - c.1244G>C r.(?) p.(Cys415Ser) Maternal (confirmed) ACMG pathogenic (dominant) g.57796268G>C g.56930102G>C - - REST_000032 variant not found in 206 control chromosomes PubMed: Manyisa 2021 - - Germline yes - - - - DNA SEQ, SEQ-NG-I Blood - DFNA FamPatIV3 PubMed: Manyisa 2021 4-generation family, 2 affected, mother/son, (F, M), 2 unaffected (half sister and maternal grandmother) M no South Africa Africa >12y - - - 2 Yacouba Dia
+/. - c.1310T>A r.(?) p.(Leu437Ter) Maternal (confirmed) - pathogenic (dominant) g.57796334T>A g.56930168T>A - - REST_000037 - PubMed: Bayram 2017, Journal: Bayram 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WES GINGF BAB4235 PubMed: Bayram 2017, Journal: Bayram 2017 3-generation family, 7 affected (2F, 5M) M - Turkey - - - - - 7 Johan den Dunnen
+/. - c.1310T>A r.(?) p.(Leu437Ter) Paternal (confirmed) - pathogenic (dominant) g.57796334T>A g.56930168T>A - - REST_000037 - PubMed: Bayram 2017, Journal: Bayram 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WES GINGF BAB4236 PubMed: Bayram 2017, Journal: Bayram 2017 mother F - Turkey - - - - - 1 Johan den Dunnen
+/. - c.1310T>A r.(?) p.(Leu437Ter) Maternal (confirmed) - pathogenic (dominant) g.57796334T>A g.56930168T>A - - REST_000037 - PubMed: Bayram 2017, Journal: Bayram 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WES GINGF BAB4237 PubMed: Bayram 2017, Journal: Bayram 2017 sister F - Turkey - - - - - 1 Johan den Dunnen
+/. - c.1310T>A r.(?) p.(Leu437Ter) Maternal (confirmed) - pathogenic (dominant) g.57796334T>A g.56930168T>A - - REST_000037 - PubMed: Bayram 2017, Journal: Bayram 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WES GINGF BAB4238 PubMed: Bayram 2017, Journal: Bayram 2017 brother M - Turkey - - - - - 1 Johan den Dunnen
+/. - c.1310T>A r.(?) p.(Leu437Ter) Paternal (confirmed) - pathogenic (dominant) g.57796334T>A g.56930168T>A - - REST_000037 - PubMed: Bayram 2017, Journal: Bayram 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WES GINGF BAB4239 PubMed: Bayram 2017, Journal: Bayram 2017 uncle M - Turkey - - - - - 1 Johan den Dunnen
-?/. - c.1452A>G r.(?) p.(=) Unknown - likely benign g.57796476A>G - REST(NM_005612.5):c.1452A>G (p.S484=) - REST_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1493_1494del r.(?) p.(Glu498Glyfs*17) Parent #1 - pathogenic (dominant) g.57796517_57796518del g.56930351_56930352del 1491_1492delAG - REST_000035 - PubMed: Machado 2022, Journal: Machado 2022 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES GINGF FamC PubMed: Machado 2022, Journal: Machado 2022 3-generation family, 4 affected (2F, 2M) F;M - Brazil - - - - - 4 Johan den Dunnen
-?/. - c.1615T>C r.(?) p.(Ser539Pro) Unknown - likely benign g.57796639T>C g.56930473T>C REST(NM_001193508.1):c.1615T>C (p.(Ser539Pro)) - REST_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1860G>T r.(?) p.(Ala620=) Unknown - likely benign g.57796884G>T - REST(NM_001363453.1):c.1860G>T (p.A620=) - REST_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1993G>A r.(?) p.(Glu665Lys) Unknown - VUS g.57797017G>A g.56930851G>A REST(NM_001193508.1):c.1993G>A (p.(Glu665Lys)) - REST_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2013G>T r.(?) p.(Glu671Asp) Unknown - likely benign g.57797037G>T g.56930871G>T REST(NM_005612.4):c.2013G>T (p.E671D), REST(NM_005612.5):c.2013G>T (p.E671D) - REST_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2013G>T r.(?) p.(Glu671Asp) Unknown - benign g.57797037G>T - REST(NM_005612.4):c.2013G>T (p.E671D), REST(NM_005612.5):c.2013G>T (p.E671D) - REST_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2206C>T r.(?) p.(Pro736Ser) Unknown - likely benign g.57797230C>T g.56931064C>T REST(NM_005612.4):c.2206C>T (p.P736S) - REST_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2229_2276del r.(?) p.(Gln746_Val761del) Unknown - benign g.57797253_57797300del g.56931087_56931134del REST(NM_005612.4):c.2229_2276del (p.Q746_V761del) - REST_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2241A>G r.(?) p.(Ile747Met) Unknown - VUS g.57797265A>G - REST(NM_005612.5):c.2241A>G (p.(Ile747Met)) - REST_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2326C>G r.(?) p.(Pro776Ala) Unknown - likely benign g.57797350C>G - REST(NM_005612.5):c.2326C>G (p.P776A) - REST_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.2350C>T r.(?) p.(Pro784Ser) Maternal (confirmed) - VUS g.57797374C>T g.56931208C>T - - REST_000043 - PubMed: Redfield 2023, Journal: Redfield 2023 - - Germline no - - - - DNA SEQ, SEQ-NG - WES HL Fam2 PubMed: Redfield 2024, PubMed: Redfield 2023, Journal: Redfield 2023 2-generation family, 1 affected, unaffected heterozygous parents M yes United States - - - - - 1 Johan den Dunnen
?/. 4 c.2390C>T r.(?) p.(Pro797Leu) Parent #1 - VUS g.57797414C>T g.56931248C>T - - REST_000001 - PubMed: Almomani 2011 - rs3796529 Germline - - - - - DNA SEQ-NG - - - - PubMed: Almomani 2011 - - - - - - - - - 1 Global Variome, with Curator vacancy
+/. - c.2413del r.(?) p.(Leu805PhefsTer38) Unknown - pathogenic (dominant) g.57797437del g.56931271del 2413delC - REST_000038 - PubMed: Bayram 2017, Journal: Bayram 2017 - - De novo - - - - - DNA SEQ, SEQ-NG - WES GINGF Fam3Pat PubMed: Bayram 2017, Journal: Bayram 2017 2-generation family, 1 affected, unaffected parents F - Turkey - - - - - 1 Johan den Dunnen
-/. - c.2443C>T r.(?) p.(Pro815Ser) Unknown - benign g.57797467C>T - REST(NM_005612.5):c.2443C>T (p.P815S) - REST_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.2449C>T r.(?) p.(Arg817*) Paternal (confirmed) - pathogenic (dominant) g.57797473C>T - - - REST_000033 - PubMed: Chen 2021, Journal: Chen 2021 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES GINGF PamPatIII3 PubMed: Chen 2021, Journal: Chen 2021 3-generation family, 7 affected (3F, 4M) M no Taiwan - - - - - 1 Johan den Dunnen
?/. - c.2509C>G r.(?) p.(Leu837Val) Unknown - VUS g.57797533C>G - REST(NM_001363453.1):c.2509C>G (p.L837V) - REST_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2556G>A r.(?) p.(Lys852=) Unknown - benign g.57797580G>A - REST(NM_005612.5):c.2556G>A (p.K852=) - REST_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2590_2598del r.(?) p.(Ser864_Pro866del) Unknown - VUS g.57797614_57797622del - REST(NM_005612.5):c.2590_2598del (p.(Ser864_Pro866del)) - REST_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.2645T>G r.(?) p.(Leu882*) Unknown - pathogenic g.57797669T>G - REST(NM_001363453.1):c.2645T>G (p.L882*) - REST_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.2670_2673del r.(?) p.(Glu891Profs*6) Paternal (confirmed) ACMG pathogenic (dominant) g.57797694_57797697del g.56931528_56931531del - - REST_000030 - PubMed: Rahikkala 2022, Journal: Rahikkala 2022 - - Germline yes - - - - DNA SEQ-NG-I - WES GINGF5 FamPat1 PubMed: Rahikkala 2022, Journal: Rahikkala 2022 2-generation family, 3 affected (father/2 daughters) F no Finland - - - - - 3 Elisa Rahikkala
+?/. - c.2670_2673del r.(?) p.(Glu891Profs*6) Paternal (confirmed) ACMG pathogenic (dominant) g.57797694_57797697del g.56931528_56931531del - - REST_000030 - PubMed: Rahikkala 2022, Journal: Rahikkala 2022 - - Germline yes - - - - DNA SEQ-NG - - GINGF5 FamPat2 PubMed: Rahikkala 2022, Journal: Rahikkala 2022 sister F no Finland - - - - - 1 Elisa Rahikkala
+/. - c.2670_2673del r.(?) p.(Glu891Profs*6) Unknown ACMG pathogenic (dominant) g.57797694_57797697del g.56931528_56931531del - - REST_000030 - PubMed: Rahikkala 2022, Journal: Rahikkala 2022 - - Germline/De novo (untested) yes - - - - DNA SEQ-NG - - GINGF5 FamPat3 PubMed: Rahikkala 2022, Journal: Rahikkala 2022 father M no Finland - - - - - 1 Elisa Rahikkala
+/. 4 c.2770C>T r.(?) p.(Gln924*) Maternal (confirmed) - pathogenic g.57797794C>T g.56931628C>T - - REST_000007 - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 - - Germline - 1/519 WT cases - - - DNA SEQ - - WT - PubMed: Mahamdallie 2015 Journal: Mahamdallie 2015 2 generation family, 1 affected, unaffected carrier mother F no (United Kingdom (Great Britain)) - >03y05m - - - 1 Tamara Hettipathirana
+/. - c.2771_2793dup r.(?) p.(Glu932Lysfs*3) Unknown - pathogenic (dominant) g.57797795_57797817dup g.56931629_56931651dup dupAAAACTTGAATACGCCAGAGGGT - REST_000034 - PubMed: Chen 2021, Journal: Chen 2021 - - De novo - - - - - DNA SEQ, SEQ-NG - WES GINGF Fam2PatII2 PubMed: Chen 2021, Journal: Chen 2021 2-generation family, 1 affected, unaffected non carrier parents F no Taiwan - - - - - 1 Johan den Dunnen
?/. - c.2810A>G r.(?) p.(Lys937Arg) Unknown - VUS g.57797834A>G - REST(NM_005612.5):c.2810A>G (p.K937R) - REST_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.2865_2866del r.(?) p.(Asn958SerfsTer9) Paternal (confirmed) - pathogenic (dominant) g.57797889_57797890del g.56931723_56931724del 2865_2866delAA - REST_000039 - PubMed: Bayram 2017, Journal: Bayram 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WES GINGF BAB4122 PubMed: Bayram 2017, Journal: Bayram 2017 2-generation family, 2 affected brothers and mildly affected father M - Turkey - - - - - 3 Johan den Dunnen
+/. - c.2865_2866del r.(?) p.(Asn958SerfsTer9) Unknown - pathogenic (dominant) g.57797889_57797890del g.56931723_56931724del 2865_2866delAA - REST_000039 - PubMed: Bayram 2017, Journal: Bayram 2017 - - Germline/De novo (untested) - - - - - DNA SEQ, SEQ-NG - WES GINGF BAB4124 PubMed: Bayram 2017, Journal: Bayram 2017 father M - Turkey - - - - - 1 Johan den Dunnen
+/. - c.2865_2866del r.(?) p.(Asn958SerfsTer9) Paternal (confirmed) - pathogenic (dominant) g.57797889_57797890del g.56931723_56931724del 2865_2866delAA - REST_000039 - PubMed: Bayram 2017, Journal: Bayram 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - WES GINGF BAB4125 PubMed: Bayram 2017, Journal: Bayram 2017 brother M - Turkey - - - - - 1 Johan den Dunnen
?/. - c.3007C>A r.(?) p.(Gln1003Lys) Unknown - VUS g.57798031C>A - REST(NM_005612.4):c.3007C>A (p.Q1003K) - REST_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.3120A>G r.(?) p.(Gln1040=) Unknown - likely benign g.57798144A>G - REST(NM_005612.5):c.3120A>G (p.Q1040=) - REST_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.