Full data view for gene RPL7A

Information The variants shown are described using the NM_000972.2 transcript reference sequence.

63 entries on 1 page. Showing entries 1 - 63.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-/. - c.*567G>A r.(=) p.(=) Unknown - benign g.136218788G>A g.133351933G>A SURF1(NM_003172.3):c.883C>T (p.R295C) - RPL7A_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*608_*609del r.(=) p.(=) Unknown - pathogenic g.136218829_136218830del - SURF1(NM_003172.4):c.845_846delCT (p.S282Cfs*9) - SURF1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*608_*609del r.(=) p.(=) Unknown - pathogenic g.136218829_136218830del - SURF1(NM_003172.4):c.845_846delCT (p.S282Cfs*9) - SURF1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*682G>A r.(=) p.(=) Unknown - benign g.136218903G>A g.133352048G>A SURF1(NM_003172.4):c.833+13C>T - SURF1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*694C>T r.(=) p.(=) Unknown - pathogenic g.136218915C>T - - - SURF1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*705T>A r.(=) p.(=) Unknown - VUS g.136218926T>A g.133352071T>A SURF1(NM_003172.3):c.823A>T (p.I275F) - SURF1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*722T>A r.(=) p.(=) Unknown - VUS g.136218943T>A - SURF1(NM_003172.3):c.806A>T (p.N269I), SURF1(NM_003172.4):c.806A>T (p.(Asn269Ile)) - RPL7A_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*722T>A r.(=) p.(=) Unknown - VUS g.136218943T>A - SURF1(NM_003172.3):c.806A>T (p.N269I), SURF1(NM_003172.4):c.806A>T (p.(Asn269Ile)) - RPL7A_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*777C>G r.(=) p.(=) Unknown - pathogenic g.136218998C>G - SURF1(NM_003172.4):c.752-1G>C - RPL7A_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1074A>G r.(=) p.(=) Unknown - benign g.136219295A>G g.133352440A>G SURF1(NM_003172.4):c.751+6T>C - SURF1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1074A>G r.(=) p.(=) Unknown - benign g.136219295A>G - SURF1(NM_003172.4):c.751+6T>C - SURF1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1086T>C r.(=) p.(=) Unknown - VUS g.136219307T>C g.133352452T>C SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1086T>C r.(=) p.(=) Unknown - VUS g.136219307T>C g.133352452T>C SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1086T>C r.(=) p.(=) Unknown - VUS g.136219307T>C - SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1153G>A r.(=) p.(=) Unknown - likely benign g.136219374G>A - SURF1(NM_003172.3):c.678C>T (p.H226=) - RPL7A_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1227C>G r.(=) p.(=) Unknown - benign g.136219448C>G - SURF1(NM_003172.4):c.604G>C (p.D202H, p.(Asp202His)) - RPL7A_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1227C>G r.(=) p.(=) Unknown - likely benign g.136219448C>G - SURF1(NM_003172.4):c.604G>C (p.D202H, p.(Asp202His)) - RPL7A_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1343G>C r.(=) p.(=) Unknown - benign g.136219564G>C g.133352709G>C SURF1(NM_003172.4):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1343G>C r.(=) p.(=) Unknown - benign g.136219564G>C g.133352709G>C SURF1(NM_003172.4):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1353T>C r.(=) p.(=) Unknown - VUS g.136219574T>C - SURF1(NM_003172.4):c.563A>G (p.(Asn188Ser)) - RPL7A_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*1373G>A r.(=) p.(=) Unknown - benign g.136219594G>A g.133352739G>A SURF1(NM_003172.4):c.543C>T (p.F181=) - RPL7A_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1383T>C r.(=) p.(=) Unknown - VUS g.136219604T>C - SURF1(NM_003172.4):c.533A>G (p.N178S) - RPL7A_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.*1402T>C r.(=) p.(=) Unknown - likely pathogenic g.136219623T>C g.133352768T>C - - SURF1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*2363C>T r.(=) p.(=) Unknown - likely benign g.136220584C>T - SURF1(NM_003172.4):c.515+20G>A - RPL7A_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2400G>C r.(=) p.(=) Unknown - VUS g.136220621G>C g.133353766G>C SURF1(NM_003172.2):c.498C>G (p.(Phe166Leu)) - RPL7A_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2440_*2442del r.(=) p.(=) Unknown - VUS g.136220661_136220663del - SURF1(NM_003172.4):c.462_464delCTC (p.S155del) - RPL7A_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2479A>C r.(=) p.(=) Unknown - VUS g.136220700A>C - SURF1(NM_003172.4):c.419T>G (p.V140G) - RPL7A_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2527C>T r.(=) p.(=) Unknown - VUS g.136220748C>T g.133353893C>T - - RPL7A_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2548T>G r.(=) p.(=) Unknown - VUS g.136220769T>G g.133353914T>G SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)), SURF1(NM_003172.4):c.350A>C (p.Y117S) - RPL7A_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2548T>G r.(=) p.(=) Unknown - VUS g.136220769T>G - SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)), SURF1(NM_003172.4):c.350A>C (p.Y117S) - RPL7A_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2563A>G r.(=) p.(=) Unknown - VUS g.136220784A>G - SURF1(NM_003172.4):c.335T>C (p.(Leu112Pro)) - RPL7A_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.*2576T>C r.(=) p.(=) Unknown - likely pathogenic g.136220797T>C - SURF1(NM_003172.4):c.324-2A>G - RPL7A_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*3295G>A r.(=) p.(=) Unknown - likely benign g.136221516G>A - SURF1(NM_003172.4):c.321C>T (p.A107=) - RPL7A_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3295_*3303del r.(=) p.(=) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3295_*3303del r.(=) p.(=) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3295_*3303del r.(=) p.(=) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3295_*3303del r.(=) p.(=) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3304_*3305insT r.(=) p.(=) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3304_*3305insT r.(=) p.(=) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3304_*3305insT r.(=) p.(=) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3304_*3305insT r.(=) p.(=) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*3336A>G r.(=) p.(=) Unknown - benign g.136221557A>G g.133354702A>G SURF1(NM_003172.4):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*3336A>G r.(=) p.(=) Unknown - benign g.136221557A>G g.133354702A>G SURF1(NM_003172.4):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3347A>G r.(=) p.(=) Unknown - pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.*3347A>G r.(=) p.(=) Unknown - likely pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.*3347A>G r.(=) p.(=) Unknown - likely pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.*3347A>G r.(=) p.(=) Unknown - likely pathogenic g.136221568A>G - SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*3437A>G r.(=) p.(=) Unknown - likely benign g.136221658A>G g.133354803A>G SURF1(NM_003172.4):c.240+21T>C - SURF1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*3449G>A r.(=) p.(=) Unknown - likely benign g.136221670G>A - SURF1(NM_003172.4):c.240+9C>T - RPL7A_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3457C>A r.(=) p.(=) Unknown - pathogenic g.136221678C>A g.133354823C>A SURF1(NM_003172.4):c.240+1G>T - RPL7A_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3457C>A r.(=) p.(=) Unknown - pathogenic g.136221678C>A - SURF1(NM_003172.4):c.240+1G>T - RPL7A_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*3488_*3489del r.(=) p.(=) Unknown - pathogenic g.136221709_136221710del g.133354854_133354855del SURF1(NM_003172.4):c.209_210delCT (p.P70Rfs*31) - SURF1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*3531G>C r.(=) p.(=) Unknown - benign g.136221752G>C g.133354897G>C SURF1(NM_003172.4):c.167C>G (p.A56G) - SURF1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*3558G>C r.(=) p.(=) Unknown - VUS g.136221779G>C g.133354924G>C SURF1(NM_003172.4):c.140C>G (p.S47C) - RPL7A_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*3568A>T r.(=) p.(=) Unknown - likely benign g.136221789A>T - SURF1(NM_003172.3):c.130T>A (p.C44S) - RPL7A_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*4822C>G r.(=) p.(=) Unknown - benign g.136223043C>G - SURF1(NM_003172.4):c.106+81G>C - RPL7A_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*4911G>A r.(=) p.(=) Unknown - VUS g.136223132G>A - SURF1(NM_003172.4):c.98C>T (p.P33L) - RPL7A_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*5025_*5045del r.(=) p.(=) Unknown - benign g.136223246_136223266del g.133356370_133356390del SURF1(NM_003172.4):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG - SURF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*5025_*5045del r.(=) p.(=) Unknown - benign g.136223246_136223266del - SURF1(NM_003172.4):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG - SURF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*5039_*5045del r.(=) p.(=) Unknown - benign g.136223260_136223266del - SURF1(NM_003172.4):c.54+48_55-47delTGCGGGG - RPL7A_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5045C>T r.(=) p.(=) Unknown - likely benign g.136223266C>T g.133356390C>T SURF1(NM_003172.4):c.54+10G>A - RPL7A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5045C>T r.(=) p.(=) Unknown - likely benign g.136223266C>T - SURF1(NM_003172.4):c.54+10G>A - RPL7A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*5046G>C r.(=) p.(=) Unknown - likely benign g.136223267G>C - SURF1(NM_003172.3):c.54+9C>G - RPL7A_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.