Full data view for gene RUNX2

Information The variants shown are described using the NM_001024630.3 transcript reference sequence.

64 entries on 1 page. Showing entries 1 - 64.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
?/. - c.58+97T>C r.(=) p.(=) Unknown - VUS g.45296618T>C g.45328881T>C SUPT3H(NM_181356.3):c.-51-5914A>G - SUPT3H_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.61C>A r.(?) p.(Pro21Thr) Unknown - VUS g.45390332C>A - RUNX2(NM_001024630.4):c.61C>A (p.(Pro21Thr)) - SUPT3H_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.159_170del r.(?) p.(Gln68_Gln71del) Unknown - VUS g.45390430_45390441del - RUNX2(NM_001015051.3):c.144_155del (p.(Gln68_Gln71del)) - SUPT3H_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.171G>T r.(?) p.(Gln57His) Unknown - likely benign g.45390442G>T - RUNX2(NM_001024630.3):c.171G>T (p.(Gln57His)) - SUPT3H_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.172C>G r.(?) p.(Gln58Glu) Unknown - likely benign g.45390443C>G - RUNX2(NM_001024630.3):c.172C>G (p.(Gln58Glu)) - SUPT3H_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.174_185dup r.(?) p.(Gln68_Gln71dup) Unknown - likely benign g.45390445_45390456dup - RUNX2(NM_001024630.4):c.174_185dupACAGCAGCAGCA (p.Q68_Q71dup) - SUPT3H_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.174_206del r.(?) p.(Gln61_Gln71del) Unknown - likely benign g.45390445_45390477del g.45422708_45422740del RUNX2(NM_001015051.3):c.163_195del (p.(Gln61_Gln71del)) - SUPT3H_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.189_194dup r.(?) p.(Gln70_Gln71dup) Unknown - likely benign g.45390460_45390465dup - RUNX2(NM_001024630.4):c.189_194dup (p.(Gln70_Gln71dup)) - SUPT3H_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.192_194del r.(?) p.(Gln71del) Unknown - likely benign g.45390463_45390465del - RUNX2(NM_001024630.3):c.192_194delGCA (p.Q71del) - SUPT3H_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.193_213del r.(?) p.(Gln65_Gln71del) Unknown - likely benign g.45390464_45390484del - RUNX2(NM_001024630.4):c.193_213delCAACAGCAGCAGCAGCAGCAG (p.Q65_Q71del) - SUPT3H_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.193_213dup r.(?) p.(Gln65_Gln71dup) Unknown - likely benign g.45390464_45390484dup - RUNX2(NM_001024630.4):c.193_213dup (p.(Gln65_Gln71dup)) - SUPT3H_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.240G>A r.(?) p.(Ala80=) Unknown - benign g.45390511G>A g.45422774G>A RUNX2(NM_001024630.4):c.240G>A (p.A80=) - RUNX2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.243_248dup r.(?) p.(Ala88_Ala89dup) Unknown - VUS g.45390514_45390519dup - RUNX2(NM_001024630.4):c.243_248dup (p.(Ala88_Ala89dup)) - SUPT3H_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.243_260del r.(?) p.(Ala84_Ala89del) Unknown - benign g.45390514_45390531del g.45422777_45422794del RUNX2(NM_001015051.3):c.216_233del (p.(Ala84_Ala89del)), RUNX2(NM_001024630.4):c.243_260delGGCGGCTGCGGCGGCGGC (p.A84_A89del) - RUNX2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.243_260del r.(?) p.(Ala84_Ala89del) Unknown - likely benign g.45390514_45390531del g.45422777_45422794del RUNX2(NM_001015051.3):c.216_233del (p.(Ala84_Ala89del)), RUNX2(NM_001024630.4):c.243_260delGGCGGCTGCGGCGGCGGC (p.A84_A89del) - RUNX2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.249_260dup r.(?) p.(Ala86_Ala89dup) Unknown - VUS g.45390520_45390531dup - RUNX2(NM_001024630.4):c.249_260dup (p.(Ala86_Ala89dup)) - SUPT3H_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.319_320del r.(?) p.(Ala107Argfs*53) Unknown - pathogenic g.45390590_45390591del - RUNX2(NM_001369405.1):c.277_278delGC (p.A93Rfs*53) - SUPT3H_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.346A>G r.(?) p.(Thr116Ala) Unknown - likely pathogenic g.45390617A>G g.45422880A>G RUNX2(NM_001024630.4):c.346A>G (p.T116A) - RUNX2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.368G>A r.(?) p.(Cys123Tyr) Unknown - pathogenic g.45390639G>A g.45422902G>A RUNX2(NM_001024630.4):c.368G>A (p.C123Y) - RUNX2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 3 c.400A>G r.(?) p.(Lys134Glu) Parent #1 - pathogenic g.45390671A>G g.45422934A>G - - RUNX2_000002 - - - - Germline - - - - - DNA SEQ - - CCD ? - - - - Argentina Latin American - - - - 1 Ariel I Suarez
-/. - c.423+39G>C r.(=) p.(=) Unknown - benign g.45390733G>C g.45422996G>C RUNX2(NM_001024630.4):c.423+39G>C - SUPT3H_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 3i_4i c.(423+1_424-1)_(580+1_581-1)del r.? p.? Unknown - pathogenic g.(45390695_45399599)_(45399757_45405683)del - - - RUNX2_000012 - - - - Germline/De novo (untested) - - - - - DNA SEQ - - CCD - - - - - - - - - - - 1 Gemeinschaftspraxis für Humangenetik Dresden
+/. - c.436G>A r.(?) p.(Gly146Arg) Unknown - pathogenic g.45399612G>A - - - SUPT3H_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 4 c.436G>T r.(?) p.(Gly146*) Unknown ACMG pathogenic g.45399612G>T g.45431875G>T - - RUNX2_000020 - - ClinVar-3362884 - Germline yes - - - - DNA SEQ-NG-I peripheral blood WES ? - - - F - - (not applicable) white - - - - 1 Marketa Wayhelova
?/. - c.506G>C r.(?) p.(Arg169Pro) Unknown ACMG likely pathogenic (dominant) g.45399682G>C - - - RUNX2_000015 - - - - Unknown - - - - - DNA SEQ - - CCD - - - - - (Brazil) - - - - - 1 Cynthia Silveira
?/. - c.523A>G r.(?) p.(Met175Val) Unknown - VUS g.45399699A>G - RUNX2(NM_001024630.4):c.523A>G (p.(Met175Val)) - SUPT3H_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.560T>C r.(?) p.(Phe187Ser) Unknown - pathogenic g.45399736T>C - - - SUPT3H_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.568C>T r.(?) p.(Arg190Trp) Unknown - pathogenic g.45399744C>T - - - RUNX2_000018 - - - - Unknown - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.578G>A r.(?) p.(Arg193Gln) Unknown - pathogenic g.45399754G>A - - - SUPT3H_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.581-9T>C r.(=) p.(=) Unknown - likely benign g.45405675T>C - RUNX2(NM_001024630.4):c.581-9T>C - SUPT3H_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.625C>T r.(?) p.(Gln209Ter) Unknown - pathogenic g.45405728C>T g.45437991C>T - - SUPT3H_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.656T>A r.(?) p.(Val219Asp) Unknown ACMG likely pathogenic (dominant) g.45405759T>A - - - RUNX2_000016 - - - - Unknown - - - - - DNA SEQ - - CCD - - - - - (Brazil) - - - - - 1 Cynthia Silveira
+/. - c.659C>T r.(?) p.(Thr220Ile) Unknown - pathogenic g.45405762C>T - RUNX2(NM_001024630.4):c.659C>T (p.T220I) - SUPT3H_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.673C>T r.(?) p.(Arg225Trp) Unknown - pathogenic g.45405776C>T - RUNX2(NM_001024630.3):c.673C>T (p.R225W) - SUPT3H_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.674G>A r.(?) p.(Arg225Gln) Unknown - pathogenic g.45405777G>A g.45438040G>A RUNX2(NM_001024630.4):c.674G>A (p.R225Q) - RUNX2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.674G>A r.(?) p.(Arg225Gln) Unknown - pathogenic g.45405777G>A - RUNX2(NM_001024630.4):c.674G>A (p.R225Q) - RUNX2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.685+2T>A r.spl? p.? Unknown - pathogenic g.45405790T>A - RUNX2(NM_001024630.3):c.685+2T>A (p.?) - SUPT3H_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.747del r.(?) p.(Arg251Alafs*7) Unknown ACMG pathogenic (dominant) g.45459739del g.45492002del - - RUNX2_000017 - - - - Unknown - - - - - DNA SEQ - - CCD - - - - - (Brazil) - - - - - 1 Cynthia Silveira
-?/. - c.799C>T r.(?) p.(Arg267Trp) Unknown - likely benign g.45459791C>T - RUNX2(NM_001024630.4):c.799C>T (p.(Arg267Trp)) - SUPT3H_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.859G>A r.(?) p.(Asp287Asn) Unknown - likely pathogenic g.45459851G>A - - - SUPT3H_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.859+5G>A r.spl? p.? Unknown - VUS g.45459856G>A g.45492119G>A RUNX2(NM_001024630.4):c.859+5G>A - SUPT3H_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.877T>C r.(?) p.(Ser293Pro) Unknown - VUS g.45480000T>C - RUNX2(NM_001024630.4):c.877T>C (p.(Ser293Pro)) - SUPT3H_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.887C>T r.(?) p.(Pro296Leu) Unknown - likely benign g.45480010C>T - RUNX2(NM_001024630.4):c.887C>T (p.P296L) - SUPT3H_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 7 c.896A>G r.(?) p.(Tyr299Cys) Unknown - VUS g.45480019A>G g.45512282A>G NM_004348.3:c.854A>G (Tyr285Cys) - RUNX2_000001 - - - - Germline - - - - - DNA SEQ - - CCD - - - - - Germany - - - - - 1 Gemeinschaftspraxis für Humangenetik Dresden
-?/. - c.932C>T r.(?) p.(Thr311Met) Unknown - likely benign g.45480055C>T - RUNX2(NM_001024630.4):c.932C>T (p.T311M) - SUPT3H_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1002T>A r.(?) p.(Asp334Glu) Unknown - VUS g.45480125T>A - RUNX2(NM_001024630.4):c.1002T>A (p.(Asp334Glu)) - SUPT3H_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1021+46G>A r.(=) p.(=) Unknown - likely benign g.45480190G>A g.45512453G>A RUNX2(NM_001024630.4):c.1021+46G>A - RUNX2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1064C>T r.(?) p.(Thr355Ile) Unknown - likely benign g.45512996C>T - RUNX2(NM_001024630.3):c.1064C>T (p.(Thr355Ile)) - SUPT3H_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1087+17T>C r.(=) p.(=) Unknown - benign g.45513036T>C g.45545299T>C RUNX2(NM_001024630.4):c.1087+17T>C - RUNX2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1088-1G>A r.spl? p.? Unknown - likely pathogenic g.45514563G>A g.45546826G>A - - SUPT3H_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1171C>T r.(?) p.(Arg391*) Unknown - pathogenic g.45514647C>T - RUNX2(NM_001024630.3):c.1171C>T (p.R391*) - SUPT3H_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1174A>T r.(?) p.(Met392Leu) Unknown - VUS g.45514650A>T - RUNX2(NM_001024630.4):c.1174A>T (p.(Met392Leu)) - SUPT3H_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1187C>A r.(?) p.(Ala396Asp) Unknown - VUS g.45514663C>A - RUNX2(NM_001024630.4):c.1187C>A (p.(Ala396Asp)) - SUPT3H_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1208dup r.(?) p.(Val404Serfs*86) Unknown - pathogenic g.45514684dup g.45546947dup 1208dupC - RUNX2_000013 - - - - Unknown - - - - - DNA SEQ - - ? - - - ? - - - - - - - 1 IMGAG
?/. - c.1259C>T r.(?) p.(Thr420Ile) Unknown - VUS g.45514735C>T - - - RUNX2_000019 - - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1259C>T r.(?) p.(Thr420Ile) Unknown - VUS g.45514735C>T - - - RUNX2_000019 - - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1264del r.(?) p.(Leu422Cysfs*62) Unknown - pathogenic g.45514740del g.45547003del 1264delC - RUNX2_000003 - - - - Germline/De novo (untested) - - - - - DNA SEQ - - CCD - - - - - Germany - - - - - 1 Gemeinschaftspraxis für Humangenetik Dresden
?/. - c.1357T>C r.(?) p.(Ser453Pro) Unknown - VUS g.45514833T>C g.45547096T>C - - RUNX2_000014 - - - - Unknown - - - - - DNA SEQ - - ? - - - F - - - - - - - 1 IMGAG
?/. - c.1427C>T r.(?) p.(Thr476Ile) Unknown - VUS g.45514903C>T - RUNX2(NM_001024630.3):c.1427C>T (p.(Thr476Ile)) - SUPT3H_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1461G>T r.(?) p.(Leu487Phe) Unknown - VUS g.45514937G>T g.45547200G>T RUNX2(NM_001024630.3):c.1461G>T (p.L487F) - SUPT3H_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1471A>G r.(?) p.(Asn491Asp) Unknown - VUS g.45514947A>G - RUNX2(NM_001024630.3):c.1471A>G (p.(Asn491Asp)) - SUPT3H_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1531G>A r.(?) p.(Gly511Ser) Unknown - likely benign g.45515007G>A g.45547270G>A RUNX2(NM_001015051.3):c.1465G>A (p.(Gly489Ser)), RUNX2(NM_001024630.4):c.1531G>A (p.G511S) - SUPT3H_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1531G>A r.(?) p.(Gly511Ser) Parent #1 - likely benign g.45515007G>A g.45547270G>A - - SUPT3H_000008 8 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs11498198 Germline - 8/2794 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 8 Mohammed Faruq
-?/. - c.1531G>A r.(?) p.(Gly511Ser) Unknown - likely benign g.45515007G>A - RUNX2(NM_001015051.3):c.1465G>A (p.(Gly489Ser)), RUNX2(NM_001024630.4):c.1531G>A (p.G511S) - SUPT3H_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.