Full data view for gene SERPINH1


Osteogenesis Imperfecta Variant Database
Information The variants shown are described using the NM_001207014.1 transcript reference sequence.

48 entries on 1 page. Showing entries 1 - 48.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/-? 1 c.-211G>A r.(?) p.? Unknown - likely benign g.75273232G>A - - - SERPINH1_000018 - PubMed: Barbirato 2016 - - Germline - - - - - DNA SEQ - - OI P.6 PubMed: Barbirato 2016 - - - Brazil - - - - - 1 Raymond Dalgleish
-?/+? 1 c.-190A>G r.(?) p.? Unknown - likely benign g.75273253A>G - - - SERPINH1_000017 - PubMed: Barbirato 2016 - - Germline - - - - - DNA SEQ - - OI P.5 PubMed: Barbirato 2016 - - - Brazil - - - - - 1 Raymond Dalgleish
+/+ _1_5_ c.? r.? p.? Paternal (confirmed) - pathogenic g.? - NC_000011.9:g.75265452_75270725del - SERPINH1_000016 - PubMed: Schwarze et al.,2019 - - Germline - - - - - DNA SEQ - - OI - PubMed: Schwarze et al.,2019 The patient is described as having a moderate form of osteogenesis imperfecta. - - - - - - - - 1 Raymond Dalgleish
?/- 2 c.121G>C r.(?) p.(Ala41Pro) Unknown - VUS g.75277515G>C - - - SERPINH1_000001 - - - rs7105528 Germline - - - - - ? ? - - ? - - - - - - - - - - - 1 Raymond Dalgleish
+/+? 2 c.149T>G r.(?) p.(Leu50Arg) Maternal (confirmed) - pathogenic g.75277543T>G - - - SERPINH1_000011 - PubMed: Li 2019, Journal: Li 2019 - - Germline - - - - - DNA PCR, SEQ, SEQ-NG - WES OI - PubMed: Li 2019, Journal: Li 2019 - - - China - - - - - 1 Xiuli Zhao
?/. - c.154T>C r.(?) p.(Phe52Leu) Unknown - VUS g.75277548T>C - SERPINH1(NM_001207014.1):c.154T>C (p.(Phe52Leu)) - SERPINH1_000115 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.227C>T r.(?) p.(Ser76Leu) Unknown - VUS g.75277621C>T - SERPINH1(NM_001207014.1):c.227C>T (p.(Ser76Leu)) - SERPINH1_000117 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 2 c.233T>C r.(?) p.(Leu78Pro) Both (homozygous) - pathogenic g.75277627T>C - - - SERPINH1_000007 - PubMed: Christiansen 2010 - - Germline - - - - - DNA PCR, SEQ - - OI - PubMed: Christiansen 2010 - - - Saudi Arabia - - - - - 1 Peter Byers
-/. - c.234A>G r.(?) p.(Leu78=) Unknown - benign g.75277628A>G g.75566583A>G SERPINH1(NM_001207014.3):c.234A>G (p.L78=), SERPINH1(NM_001235.5):c.234A>G (p.L78=) - SERPINH1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.234A>G r.(?) p.(Leu78=) Unknown - benign g.75277628A>G g.75566583A>G SERPINH1(NM_001207014.3):c.234A>G (p.L78=), SERPINH1(NM_001235.5):c.234A>G (p.L78=) - SERPINH1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/- 2 c.234A>G r.(?) p.(=) Unknown - VUS g.75277628A>G - - - SERPINH1_000002 - - - rs584961 Germline - - - - - ? ? - - ? - - - - - - - - - - - 1 Raymond Dalgleish
-?/. - c.240C>T r.(?) p.(Leu80=) Unknown - likely benign g.75277634C>T g.75566589C>T SERPINH1(NM_001235.5):c.240C>T (p.L80=) - SERPINH1_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.267G>A r.(?) p.(Thr89=) Unknown - likely benign g.75277661G>A g.75566616G>A SERPINH1(NM_001235.5):c.267G>A (p.T89=) - SERPINH1_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/? 3 c.314_325del r.(?) p.(Glu105_His108del) Both (homozygous) - likely pathogenic g.75277708_75277719del - - - SERPINH1_000010 - PubMed: Essawi 2018 - - Germline - - - - - DNA PCR, SEQ - - OI AN_005832 PubMed: Essawi 2018 - - - Palestine - - - - - 1 Sofie Symoens
+/+ 2 c.338_357delinsTGCAACGTGACCCACGCACGTG r.(?) p.(Glu113Valfs*8) Both (homozygous) - pathogenic g.75277732_75277751delinsTGCAACGTGACCCACGCACGTG - - - SERPINH1_000009 The inserted bases were later confirmed by the authors to be:; TGCAACGTGACCCACGCACGTG PubMed: Marshall 2016 - - Germline - - - - - DNA SEQ-NG - custom gene panel OI - PubMed: Marshall 2016 - - - Mexico - - - - - 1 Raymond Dalgleish
-/. - c.363C>G r.(?) p.(Ser121=) Unknown - benign g.75277757C>G g.75566712C>G SERPINH1(NM_001207014.3):c.363C>G (p.S121=), SERPINH1(NM_001235.5):c.363C>G (p.S121=) - SERPINH1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.363C>G r.(?) p.(Ser121=) Unknown - benign g.75277757C>G g.75566712C>G SERPINH1(NM_001207014.3):c.363C>G (p.S121=), SERPINH1(NM_001235.5):c.363C>G (p.S121=) - SERPINH1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/- 2 c.363C>G r.(?) p.(=) Unknown - VUS g.75277757C>G - - - SERPINH1_000003 - - - rs650241 Germline - - - - - ? ? - - ? - - - - - - - - - - - 1 Raymond Dalgleish
?/. - c.486C>G r.(?) p.(Asn162Lys) Unknown - VUS g.75277880C>G - SERPINH1(NM_001235.5):c.486C>G (p.(Asn162Lys)) - SERPINH1_000123 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.580C>A r.(?) p.(Arg194Ser) Unknown - VUS g.75277974C>A g.75566929C>A SERPINH1(NM_001207014.1):c.580C>A (p.(Arg194Ser)) - SERPINH1_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.581G>A r.(?) p.(Arg194His) Unknown - likely benign g.75277975G>A - SERPINH1(NM_001235.5):c.581G>A (p.(Arg194His)) - SERPINH1_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+? 2 c.589G>C r.(?) p.(Gly197Arg) Paternal (confirmed) - pathogenic g.75277983G>C - - - SERPINH1_000013 - PubMed: Li 2019, Journal: Li 2019 - - Germline - - - - - DNA PCR, SEQ - - OI - PubMed: Li 2019, Journal: Li 2019 - - - China - - - - - 1 Xiuli Zhao
-/. - c.598C>T r.(?) p.(Leu200=) Unknown - benign g.75277992C>T g.75566947C>T SERPINH1(NM_001207014.3):c.598C>T (p.L200=), SERPINH1(NM_001235.5):c.598C>T (p.L200=) - SERPINH1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.598C>T r.(?) p.(Leu200=) Unknown - benign g.75277992C>T g.75566947C>T SERPINH1(NM_001207014.3):c.598C>T (p.L200=), SERPINH1(NM_001235.5):c.598C>T (p.L200=) - SERPINH1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/- 2 c.598C>T r.(?) p.(=) Unknown - VUS g.75277992C>T - - - SERPINH1_000004 - - - rs651581 Germline - - - - - ? ? - - ? - - - - - - - - - - - 1 Raymond Dalgleish
?/. - c.689A>G r.(?) p.(Tyr230Cys) Unknown - VUS g.75279842A>G g.75568797A>G - - SERPINH1_000109 - PubMed: Rauch 2015 - - Germline - - - - - DNA, RNA RT-PCR, SEQ, SEQ-NG - WES CLCRP 25683117-Pat1 PubMed: Rauch 2015, PubMed: Cole 1987 2-generation family, 1 affected, unaffected parents M no Canada - - - - - 1 Johan den Dunnen
-/. - c.693C>T r.(?) p.(Thr231=) Unknown - benign g.75279846C>T g.75568801C>T SERPINH1(NM_001207014.3):c.693C>T (p.T231=), SERPINH1(NM_001235.5):c.693C>T (p.T231=) - SERPINH1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.693C>T r.(?) p.(Thr231=) Unknown - benign g.75279846C>T g.75568801C>T SERPINH1(NM_001207014.3):c.693C>T (p.T231=), SERPINH1(NM_001235.5):c.693C>T (p.T231=) - SERPINH1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/- 3 c.693C>T r.(?) p.(=) Unknown - VUS g.75279846C>T - - - SERPINH1_000005 - - - rs649257 Germline - - - - - ? ? - - ? - - - - - - - - - - - 1 Raymond Dalgleish
+/+ 3 c.710T>C r.(?) p.(Met237Thr) Both (homozygous) - pathogenic g.75279863T>C - - - SERPINH1_000008 - PubMed: Duran 2014 - - Germline - - - - - DNA PCR, SEQ - - OI - PubMed: Duran 2014 The OI phenotype is described as moderately severe. The parents are third cousins. - - - - - - - - 1 Raymond Dalgleish
-?/. - c.721+9T>C r.(=) p.(=) Unknown - likely benign g.75279883T>C - SERPINH1(NM_001235.5):c.721+9T>C - SERPINH1_000120 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.722-13G>A r.(=) p.(=) Unknown - likely benign g.75279971G>A - SERPINH1(NM_001235.5):c.722-13G>A - SERPINH1_000116 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.744C>T r.(?) p.(Asp248=) Unknown - likely benign g.75280006C>T g.75568961C>T SERPINH1(NM_001235.5):c.744C>T (p.D248=) - SERPINH1_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 5 c.781dup r.(?) p.(Ala261GlyfsTer22) Unknown ACMG likely pathogenic (recessive) g.75280043dup g.75568998dup - - SERPINH1_000119 - - - - Germline - - - - - DNA SEQ-NG-I - WES Healthy/Control - - - F ? Russian Federation - - - - - 1 Viktoriia Zabnenkova
+/+? 4 c.800T>C r.(?) p.(Leu267Pro) Maternal (confirmed) - pathogenic g.75280062T>C - - - SERPINH1_000014 - PubMed: Li 2019, Journal: Li 2019 - - Germline - - - - - DNA PCR, SEQ - - OI - PubMed: Li 2019, Journal: Li 2019 - - - China - - - - - 1 Xiuli Zhao
?/. - c.932T>C r.(?) p.(Val311Ala) Unknown - VUS g.75280194T>C - SERPINH1(NM_001235.5):c.932T>C (p.(Val311Ala)) - SERPINH1_000124 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.955-6C>A r.(=) p.(=) Unknown - benign g.75282820C>A g.75571775C>A SERPINH1(NM_001207014.1):c.955-6C>A (p.(=)), SERPINH1(NM_001235.5):c.955-6C>A - SERPINH1_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.955-6C>A r.(=) p.(=) Unknown - benign g.75282820C>A - SERPINH1(NM_001207014.1):c.955-6C>A (p.(=)), SERPINH1(NM_001235.5):c.955-6C>A - SERPINH1_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.976C>G r.(?) p.(Leu326Val) Unknown - VUS g.75282847C>G - SERPINH1(NM_001207014.1):c.976C>G (p.(Leu326Val)) - SERPINH1_000118 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1011G>A r.(?) p.(Leu337=) Unknown - benign g.75282882G>A g.75571837G>A SERPINH1(NM_001207014.3):c.1011G>A (p.L337=), SERPINH1(NM_001235.5):c.1011G>A (p.L337=) - SERPINH1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1011G>A r.(?) p.(Leu337=) Unknown - benign g.75282882G>A g.75571837G>A SERPINH1(NM_001207014.3):c.1011G>A (p.L337=), SERPINH1(NM_001235.5):c.1011G>A (p.L337=) - SERPINH1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/- 5 c.1011G>A r.(?) p.(=) Unknown - VUS g.75282882G>A - - - SERPINH1_000006 - - - rs585821 Germline - - - - - ? ? - - ? - - - - - - - - - - - 1 Raymond Dalgleish
-?/. - c.1020G>A r.(?) p.(Met340Ile) Unknown - likely benign g.75282891G>A - SERPINH1(NM_001207014.1):c.1020G>A (p.(Met340Ile)) - SERPINH1_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1118G>A r.(?) p.(Arg373His) Unknown - VUS g.75282989G>A g.75571944G>A SERPINH1(NM_001235.5):c.1118G>A (p.R373H) - SERPINH1_000108 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1119C>T r.(?) p.(Arg373=) Unknown - likely benign g.75282990C>T g.75571945C>T SERPINH1(NM_001235.5):c.1119C>T (p.R373=) - SERPINH1_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1191C>T r.(?) p.(Ser397=) Unknown - likely benign g.75283062C>T g.75572017C>T SERPINH1(NM_001235.5):c.1191C>T (p.S397=) - SERPINH1_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+? 5 c.1214G>A r.(?) p.(Arg405His) Paternal (confirmed) - pathogenic g.75283085G>A - - - SERPINH1_000012 - PubMed: Li 2019, Journal: Li 2019 - - Germline - - - - - DNA PCR, SEQ, SEQ-NG - WES OI - PubMed: Li 2019, Journal: Li 2019 - - - China - - - - - 1 Xiuli Zhao
+/+ 5 c.1233dup r.(?) p.Asp412* Maternal (confirmed) - pathogenic g.75283104dup - 1233dupT - SERPINH1_000015 - PubMed: Schwarze 2019 - - Germline - - - - - DNA SEQ - - OI - PubMed: Schwarze et al.,2019 The patient is described as having a moderate form of osteogenesis imperfecta. - - - - - - - - 1 Raymond Dalgleish
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.