Full data view for gene SF3B2

Information The variants shown are described using the NM_006842.2 transcript reference sequence.

35 entries on 1 page. Showing entries 1 - 35.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-/. - c.-31784C>T r.(?) p.(=) Unknown - benign g.65788072C>T g.66020601C>T CATSPER1(NM_053054.4):c.1954G>A (p.V652I) - CATSPER1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-29491C>G r.(?) p.(=) Unknown - likely benign g.65790365C>G g.66022894C>G CATSPER1(NM_053054.3):c.1384G>C (p.V462L) - CATSPER1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-29329G>T r.(?) p.(=) Unknown - benign g.65790527G>T g.66023056G>T CATSPER1(NM_053054.4):c.1222C>A (p.R408=) - CATSPER1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-26402C>T r.(?) p.(=) Unknown - benign g.65793454C>T g.66025983C>T CATSPER1(NM_053054.4):c.397G>A (p.G133S) - CATSPER1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-8908C>T r.(?) p.(=) Unknown - likely benign g.65810948C>T g.66043477C>T GAL3ST3(NM_033036.2):c.326G>A (p.(Arg109His)) - GAL3ST3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.301C>G r.(?) p.(Pro101Ala) Unknown - VUS g.65822589C>G - SF3B2(NM_006842.3):c.301C>G (p.(Pro101Ala)) - CATSPER1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.302C>G r.(?) p.(Pro101Arg) Unknown - likely benign g.65822590C>G - SF3B2(NM_006842.2):c.302C>G (p.(Pro101Arg)) - CATSPER1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.318G>A r.(?) p.(Pro106=) Unknown - likely benign g.65822606G>A - SF3B2(NM_006842.3):c.318G>A (p.P106=) - CATSPER1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.357T>C r.(?) p.(Phe119=) Unknown - likely benign g.65822645T>C - SF3B2(NM_006842.3):c.357T>C (p.F119=) - CATSPER1_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.628A>G r.(?) p.(Met210Val) Unknown - likely benign g.65824387A>G - SF3B2(NM_006842.3):c.628A>G (p.(Met210Val)) - CATSPER1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.696C>T r.(?) p.(Pro232=) Unknown - likely benign g.65824765C>T - SF3B2(NM_006842.3):c.696C>T (p.P232=) - CATSPER1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.739C>T r.(?) p.(Arg247Cys) Unknown - VUS g.65824808C>T - NM_006842:c.C739T (R247C) - SF3B2_000005 - PubMed: Hamdan 2017 - - De novo - - - - - DNA SEQ, SEQ-NG - WGS DEE HSC0096 PubMed: Hamdan 2017 WGS analysis 197 individuals with unexplained DEE (unaffected parents) - - Canada - - - - pharmaco-resistant seizures 1 Johan den Dunnen
?/. - c.1005G>T r.(?) p.(Lys335Asn) Unknown - VUS g.65826339G>T - - - SF3B2_000002 - PubMed: Ziegler 2022, Journal: Ziegler 2022 - - De novo no - - - - DNA SEQ, SEQ-NG - WES NDD Fam2Pat3 PubMed: Ziegler 2022, Journal: Ziegler 2022 brother M - Bosnia and Herzegovina;Croatia (Hrvatska) Bosnia - - - - 1 Johan den Dunnen
-/. - c.1797A>G r.(?) p.(Thr599=) Unknown - benign g.65829174A>G - SF3B2(NM_006842.3):c.1797A>G (p.T599=) - SF3B2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1965G>A r.(?) p.(Ser655=) Unknown - likely benign g.65829457G>A - SF3B2(NM_006842.3):c.1965G>A (p.S655=) - SF3B2_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1977+10G>T r.(=) p.(=) Unknown - likely benign g.65829479G>T - SF3B2(NM_006842.3):c.1977+10G>T - SF3B2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2085+1G>A r.spl? p.? Unknown - VUS g.65830588G>A - SF3B2(NM_006842.2):c.2085+1G>A (p.?) - SF3B2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.2087C>T r.(?) p.(Thr696Ile) Paternal (confirmed) ACMG likely pathogenic g.65830872C>T g.66063401C>T - - SF3B2_000007 - - - - Germline no - - - - DNA SEQ-NG - WES (whole exome sequencing) CLP CLP-972-3 CLP-972-3 - M no - - - - - - 1 Miikka Vikkula
-?/. - c.2431-7T>C r.(=) p.(=) Unknown - likely benign g.65835612T>C - SF3B2(NM_006842.3):c.2431-7T>C - PACS1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2487G>A r.(?) p.(Ala829=) Unknown - benign g.65835675G>A - SF3B2(NM_006842.3):c.2487G>A (p.A829=) - PACS1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2616+7G>A r.(=) p.(=) Unknown - likely benign g.65835811G>A - SF3B2(NM_006842.2):c.2616+7G>A (p.?) - PACS1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1842C>A r.(=) p.(=) Unknown - likely benign g.65838058C>A - PACS1(NM_018026.4):c.101C>A (p.(Pro34Gln)) - PACS1_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1843G>A r.(=) p.(=) Unknown - likely benign g.65838059G>A - PACS1(NM_018026.4):c.102G>A (p.(Pro34=)) - PACS1_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1845A>C r.(=) p.(=) Unknown - likely benign g.65838061A>C g.66070590A>C PACS1(NM_018026.3):c.104A>C (p.Q35P, p.(Gln35Pro)) - PACS1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1845A>C r.(=) p.(=) Unknown - likely benign g.65838061A>C - PACS1(NM_018026.3):c.104A>C (p.Q35P, p.(Gln35Pro)) - PACS1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1845_*1865dup r.(=) p.(=) Unknown - VUS g.65838061_65838081dup - PACS1(NM_018026.4):c.104_124dupAGCAGCAGCAGCAGCAGCCGC (p.Q35_P41dup) - PACS1_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1857_*1862dup r.(=) p.(=) Unknown - likely benign g.65838073_65838078dup g.66070602_66070607dup PACS1(NM_018026.3):c.101_102insGCAGCA (p.(Gln39_Gln40dup)) - PACS1_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1860_*1862del r.(=) p.(=) Unknown - likely benign g.65838076_65838078del - PACS1(NM_018026.3):c.119_121delAGC (p.(Gln40del)) - PACS1_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1880C>A r.(=) p.(=) Unknown - likely benign g.65838096C>A - PACS1(NM_018026.3):c.139C>A (p.(Pro47Thr)) - PACS1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*1899C>T r.(=) p.(=) Unknown - likely benign g.65838115C>T - PACS1(NM_018026.3):c.158C>T (p.(Ala53Val)) - PACS1_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*1947C>T r.(=) p.(=) Unknown - VUS g.65838163C>T - PACS1(NM_018026.4):c.206C>T (p.S69F) - PACS1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*2013G>C r.(=) p.(=) Unknown - likely benign g.65838229G>C g.66070758G>C PACS1(NM_018026.3):c.272G>C (p.(Gly91Ala)) - PACS1_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*2018G>C r.(=) p.(=) Unknown - likely benign g.65838234G>C - PACS1(NM_018026.4):c.277G>C (p.(Gly93Arg)) - PACS1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2047C>A r.(=) p.(=) Unknown - VUS g.65838263C>A g.66070792C>A PACS1(NM_018026.3):c.306C>A (p.N102K) - PACS1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*2090G>A r.(=) p.(=) Unknown - VUS g.65838306G>A - PACS1(NM_018026.3):c.349G>A (p.(Val117Met)) - PACS1_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.