Full data view for gene SOX3

Information The variants shown are described using the NM_005634.2 transcript reference sequence.

51 entries on 1 page. Showing entries 1 - 51.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/. - c.14G>A r.(?) p.(Arg5Gln) Unknown - likely benign g.139587212C>T g.140505047C>T SOX3(NM_005634.2):c.14G>A (p.R5Q, p.(Arg5Gln)) - SOX3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.14G>A r.(?) p.(Arg5Gln) Unknown - likely benign g.139587212C>T g.140505047C>T SOX3(NM_005634.2):c.14G>A (p.R5Q, p.(Arg5Gln)) - SOX3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.14G>A r.(?) p.(Arg5Gln) Unknown - likely benign g.139587212C>T g.140505047C>T SOX3(NM_005634.2):c.14G>A (p.R5Q, p.(Arg5Gln)) - SOX3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.14G>A r.(?) p.(Arg5Gln) Unknown - likely benign g.139587212C>T g.140505047C>T SOX3(NM_005634.2):c.14G>A (p.R5Q, p.(Arg5Gln)) - SOX3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.77T>C r.(?) p.(Ile26Thr) Unknown - likely benign g.139587149A>G g.140504984A>G SOX3(NM_005634.2):c.77T>C (p.I26T) - SOX3_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.127G>A r.(?) p.(Ala43Thr) Unknown - benign g.139587099C>T g.140504934C>T SOX3(NM_005634.2):c.127G>A (p.A43T) - SOX3_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.127G>A r.(?) p.(Ala43Thr) Unknown - benign g.139587099C>T g.140504934C>T SOX3(NM_005634.2):c.127G>A (p.A43T) - SOX3_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.157G>C r.(?) p.(Val53Leu) Maternal (confirmed) - pathogenic g.139587069C>G g.140504904C>G NM_005634: c.G157C; p.V53L - SOX3_000003 - PubMed: Karaca 2015 - - Germline - - - 0 - DNA SEQ-NG-I - WES ? 26539891-FamBAB5021 PubMed: Karaca 2015 - - - - - - 0 family structure in paper - 3 Johan den Dunnen
-/. - c.157G>C r.(?) p.(Val53Leu) Unknown - benign g.139587069C>G g.140504904C>G SOX3(NM_005634.2):c.157G>C (p.V53L, p.(Val53Leu)) - SOX3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.157G>C r.(?) p.(Val53Leu) Unknown - likely benign g.139587069C>G g.140504904C>G SOX3(NM_005634.2):c.157G>C (p.V53L, p.(Val53Leu)) - SOX3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.157G>C r.(?) p.(Val53Leu) Unknown - benign g.139587069C>G g.140504904C>G SOX3(NM_005634.2):c.157G>C (p.V53L, p.(Val53Leu)) - SOX3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.157G>C r.(?) p.(Val53Leu) Unknown - benign g.139587069C>G g.140504904C>G SOX3(NM_005634.2):c.157G>C (p.V53L, p.(Val53Leu)) - SOX3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.157G>C r.(?) p.(Val53Leu) Unknown - likely benign g.139587069C>G - SOX3(NM_005634.2):c.157G>C (p.V53L, p.(Val53Leu)) - SOX3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.234C>T r.(?) p.(Ser78=) Unknown - likely benign g.139586992G>A - SOX3(NM_005634.2):c.234C>T (p.S78=) - SOX3_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.307C>A r.(?) p.(Pro103Thr) Unknown - benign g.139586919G>T g.140504754G>T SOX3(NM_005634.2):c.307C>A (p.P103T) - SOX3_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.307C>A r.(?) p.(Pro103Thr) Unknown - benign g.139586919G>T g.140504754G>T SOX3(NM_005634.2):c.307C>A (p.P103T) - SOX3_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.310G>A r.(?) p.(Gly104Arg) Parent #1 - VUS g.139586916C>T g.140504751C>T - - SOX3_000020 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 2 Lucy Raymond
-?/. - c.310G>A r.(?) p.(Gly104Arg) Unknown - likely benign g.139586916C>T g.140504751C>T SOX3(NM_005634.2):c.310G>A (p.(Gly104Arg)) - SOX3_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.319G>A r.(?) p.(Gly107Ser) Unknown - VUS g.139586907C>T - SOX3(NM_005634.2):c.319G>A (p.G107S) - SOX3_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.333G>A r.(?) p.(Ala111=) Unknown - benign g.139586893C>T - SOX3(NM_005634.2):c.333G>A (p.A111=) - SOX3_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.353dup r.(?) p.(Asn118LysfsTer51) Unknown - likely pathogenic g.139586874dup g.140504709dup - - SOX3_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.426C>A r.(?) p.(Pro142=) Unknown - likely benign g.139586800G>T g.140504635G>T SOX3(NM_005634.2):c.426C>A (p.P142=) - SOX3_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.598A>C r.(?) p.(Met200Leu) Unknown - VUS g.139586628T>G g.140504463T>G SOX3(NM_005634.2):c.598A>C (p.M200L) - SOX3_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.603G>A r.(?) p.(Lys201=) Unknown - likely benign g.139586623C>T - SOX3(NM_005634.2):c.603G>A (p.K201=) - SOX3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.603G>A r.(?) p.(Lys201=) Unknown - benign g.139586623C>T - SOX3(NM_005634.2):c.603G>A (p.K201=) - SOX3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.609T>C r.(?) p.(Tyr203=) Unknown - benign g.139586617A>G g.140504452A>G SOX3(NM_005634.2):c.609T>C (p.Y203=) - SOX3_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.609T>C r.(?) p.(Tyr203=) Unknown - benign g.139586617A>G g.140504452A>G SOX3(NM_005634.2):c.609T>C (p.Y203=) - SOX3_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.609T>C r.(=) p.(=) Parent #1 - likely benign g.139586617A>G g.140504452A>G Y203Y - SOX3_000014 recurrent, found 7 times PubMed: Tarpey 2009 - - Germline - 7/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 7 Lucy Raymond
?/. - c.662_666del r.(?) p.(Asp221ValfsTer155) Unknown - VUS g.139586563_139586567del g.140504398_140504402del - - SOX3_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.696C>A r.(?) p.(Pro232=) Unknown - VUS g.139586530G>T g.140504365G>T - - SOX3_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.705_710dup r.(?) p.(Ala247_Ala248dup) Unknown - likely benign g.139586521_139586526dup g.140504356_140504361dup SOX3(NM_005634.2):c.705_710dupGGCCGC (p.A247_A248dup) - SOX3_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.708dup r.(?) p.(Ala237Argfs*141) Unknown - VUS g.139586519dup g.140504354dup - - SOX3_000002 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. - c.711_731del r.(?) p.(Ala242_Ala248del) Unknown - benign g.139586507_139586527del g.140504342_140504362del SOX3(NM_005634.2):c.711_731delCGCCGCCGCTGCCGCGGCCGC (p.A242_A248del) - SOX3_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.711_731del r.(?) p.(Ala242_Ala248del) Unknown - benign g.139586507_139586527del g.140504342_140504362del SOX3(NM_005634.2):c.711_731delCGCCGCCGCTGCCGCGGCCGC (p.A242_A248del) - SOX3_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.711_737del r.(?) p.(Ala240_Ala248del) Unknown - likely benign g.139586494_139586520del g.140504329_140504355del SOX3(NM_005634.2):c.711_737delCGCCGCCGCTGCCGCGGCCGCAGCCGC (p.A240_A248del) - SOX3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.717_737del r.(?) p.(Ala242_Ala248del) Unknown - VUS g.139586494_139586514del g.140504329_140504349del SOX3(NM_005634.2):c.717_737delCGCTGCCGCGGCCGCAGCCGC (p.A242_A248del) - SOX3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.717_737del r.(?) p.(Ala242_Ala248del) Unknown - likely benign g.139586494_139586514del g.140504329_140504349del SOX3(NM_005634.2):c.717_737delCGCTGCCGCGGCCGCAGCCGC (p.A242_A248del) - SOX3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.717_737del r.(?) p.(Ala242_Ala248del) Unknown - likely benign g.139586494_139586514del g.140504329_140504349del SOX3(NM_005634.2):c.717_737delCGCTGCCGCGGCCGCAGCCGC (p.A242_A248del) - SOX3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.721_722del r.(?) p.(Ala241Argfs*136) Unknown - VUS g.139586504_139586505del g.140504339_140504340del - - SOX3_000001 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.729_731dup r.(?) p.(Ala248dup) Unknown - VUS g.139586497_139586499dup g.140504332_140504334dup SOX3(NM_005634.2):c.729_731dupCGC (p.A248dup) - SOX3_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.732A>C r.(?) p.(Ala244=) Unknown - benign g.139586494T>G g.140504329T>G SOX3(NM_005634.2):c.732A>C (p.A244=) - SOX3_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.732A>C r.(?) p.(Ala244=) Unknown - benign g.139586494T>G g.140504329T>G SOX3(NM_005634.2):c.732A>C (p.A244=) - SOX3_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.735_737dup r.(?) p.(Ala248dup) Unknown - VUS g.139586491_139586493dup g.140504326_140504328dup SOX3(NM_005634.2):c.737_738insCGC (p.(Ala246dup)) - SOX3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.760G>A r.(?) p.(Val254Met) Unknown - VUS g.139586466C>T g.140504301C>T SOX3(NM_005634.2):c.760G>A (p.V254M) - SOX3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.854C>G r.(?) p.(Pro285Arg) Unknown - VUS g.139586372G>C g.140504207G>C SOX3(NM_005634.2):c.854C>G (p.(Pro285Arg)) - SOX3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.912G>A r.(?) p.(Met304Ile) Unknown - VUS g.139586314C>T g.140504149C>T SOX3(NM_005634.2):c.912G>A (p.M304I) - SOX3_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.946G>A r.(?) p.(Gly316Ser) Unknown - likely benign g.139586280C>T - SOX3(NM_005634.2):c.946G>A (p.G316S) - SOX3_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1002G>A r.(?) p.(Gly334=) Unknown - likely benign g.139586224C>T g.140504059C>T SOX3(NM_005634.2):c.1002G>A (p.G334=) - SOX3_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1008G>A r.(?) p.(Met336Ile) Unknown - VUS g.139586218C>T g.140504053C>T SOX3(NM_005634.2):c.1008G>A (p.M336I) - SOX3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1098C>T r.(?) p.(Ser366=) Unknown - likely benign g.139586128G>A - SOX3(NM_005634.2):c.1098C>T (p.S366=) - SOX3_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1297G>T r.(?) p.(Ala433Ser) Unknown - VUS g.139585929C>A g.140503764C>A SOX3(NM_005634.2):c.1297G>T (p.A433S) - SOX3_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query