Full data view for gene SPG7

A database from the MITOchondrial DYNamics variation portal.
Information The variants shown are described using the NM_003119.2 transcript reference sequence.

296 entries on 3 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-/. - c.-660C>G r.(?) p.(=) Unknown - benign g.89574166C>G g.89507758C>G SPG7(NM_003119.4):c.-660C>G - SPG7_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.c.(?_-1)_(1324+1_?)del r.0? p.0? Unknown - VUS g.(88700001_89371838)_(89607414_qter)del - - arr[hg19] 16q24.3(89,371,838-89,607,414)x1 dn ANKRD11_000024 deletion affecting ANKRD11 and part of SPG7 PubMed: Spengler 2012, PubMed: Spengler 2013, for EUCID-SRS consortium - - De novo - - - - normal methylation H19/IGF2:IG-DMR, KCNQ1OT1:TSS-DMR DNA arrayCNV, PCRq - - ?, SRS;RSS 22683032-PatSR596/07 PubMed: Spengler 2012, PubMed: Spengler 2013, for EUCID-SRS consortium - M - - - - - - - 1 Zeynep Tümer
+/. - c.3G>A r.(?) p.(Met1?) Unknown - pathogenic g.89574828G>A g.89508420G>A - - SPG7_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.3G>C r.(?) p.(Met1?) Unknown - pathogenic g.89574828G>C - SPG7(NM_003119.4):c.3G>C (p.M1?) - SPG7_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.9G>T r.(?) p.(Val3=) Unknown - likely benign g.89574834G>T g.89508426G>T SPG7(NM_003119.4):c.9G>T (p.V3=) - SPG7_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.9G>T r.(?) p.(Val3=) Unknown - benign g.89574834G>T g.89508426G>T SPG7(NM_003119.4):c.9G>T (p.V3=) - SPG7_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.20_25dup r.(?) p.(Leu7_Leu8dup) Unknown - VUS g.89574845_89574850dup - SPG7(NM_003119.4):c.20_25dupTGCTCC (p.L7_L8dup) - SPG7_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.21_23dup r.(?) p.(Leu8dup) Unknown - VUS g.89574846_89574848dup - SPG7(NM_003119.4):c.21_23dup (p.(Leu8dup)) - SPG7_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.69G>C r.(?) p.(Trp23Cys) Unknown ACMG VUS g.89574894G>C g.89508486G>C - - SPG7_000084 - - - - Germline - - - - - DNA SEQ-NG-S - - ? - - - M - - - - - - - 1 Andreas Laner
-?/. - c.120G>A r.(?) p.(=) Unknown - likely benign g.89574945G>A - - - chr16_007819 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.183+600T>A r.(=) p.(=) Unknown - benign g.89575608T>A - SPG7(NM_003119.4):c.183+600T>A - SPG7_000100 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.184-132T>C r.(=) p.(=) Unknown - benign g.89576766T>C - SPG7(NM_003119.4):c.184-132T>C - SPG7_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/-? - c.184-4del r.spl? p.? Unknown - benign g.89576894del g.89510486del SPG7(NM_003119.4):c.184-4delT - SPG7_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.184-4del r.spl? p.? Unknown - benign g.89576894del g.89510486del SPG7(NM_003119.4):c.184-4delT - SPG7_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.184-4del r.spl? p.? Unknown - benign g.89576894del - SPG7(NM_003119.4):c.184-4delT - SPG7_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.184-4dup r.spl? p.? Unknown - likely benign g.89576894dup g.89510486dup SPG7(NM_003119.4):c.184-3delCinsTC, SPG7(NM_003119.4):c.184-4dupT - SPG7_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.184-4dup r.spl? p.? Unknown - benign g.89576894dup g.89510486dup SPG7(NM_003119.4):c.184-3delCinsTC, SPG7(NM_003119.4):c.184-4dupT - SPG7_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.184-3C>A r.spl? p.? Unknown - likely benign g.89576895C>A g.89510487C>A SPG7(NM_003119.4):c.184-3C>A - SPG7_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.184-3C>T r.spl? p.? Unknown - likely benign g.89576895C>T g.89510487C>T SPG7(NM_003119.3):c.184-3C>T - SPG7_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.186C>T r.(?) p.(Ser62=) Unknown - likely benign g.89576900C>T g.89510492C>T SPG7(NM_003119.3):c.186C>T (p.S62=) - SPG7_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.199C>T r.(?) p.(Leu67=) Unknown - likely benign g.89576913C>T g.89510505C>T SPG7(NM_003119.3):c.199C>T (p.L67=) - SPG7_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.233T>A r.(?) p.(Leu78Ter) Unknown - pathogenic g.89576947T>A g.89510539T>A SPG7(NM_001363850.1):c.233T>A (p.L78*), SPG7(NM_003119.3):c.233T>A (p.L78*), SPG7(NM_003119.4):c.233T>A (p.(Leu78Ter), p.L78*) - SPG7_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.233T>A r.(?) p.(Leu78*) Parent #1 - VUS g.89576947T>A g.89510539T>A - - SPG7_000015 conflicting interpretations of pathogenicity; 9 heterozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs121918358 Germline - 9/2789 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 9 Mohammed Faruq
+?/. - c.233T>A r.(?) p.(Leu78*) Unknown ACMG likely pathogenic g.89576947T>A g.89510539T>A - - SPG7_000015 ACMG grading: PVS1,PM2 no second path variant detected in SPG7, patient at age 26 affected by paraspastic, positive family history of spastic paraplegia - - rs121918358 Germline - - - - - DNA SEQ-NG-S - - ? - - - F - - - - - - - 1 Andreas Laner
?/. - c.233T>A r.(?) p.(Leu78*) Both (homozygous) - VUS g.89576947T>A g.89510539T>A - - SPG7_000015 conflicting interpretations of pathogenicity; 1 homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs121918358 Germline - 1/2789 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 1 Mohammed Faruq
+?/. - c.233T>A r.(?) p.(Leu78*) Unknown - VUS g.89576947T>A - - - SPG7_000015 - PubMed: Thomas 2022 - - Germline/De novo (untested) - - - - - DNA SEQ-NG - - ? Pat29 PubMed: Thomas 2022 patient and affected brother - - France - - - - - 1 Johan den Dunnen
+/. - c.233T>A r.(?) p.(Leu78Ter) Unknown - pathogenic g.89576947T>A - SPG7(NM_001363850.1):c.233T>A (p.L78*), SPG7(NM_003119.3):c.233T>A (p.L78*), SPG7(NM_003119.4):c.233T>A (p.(Leu78Ter), p.L78*) - SPG7_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.233T>A r.(?) p.(Leu78Ter) Unknown - pathogenic g.89576947T>A - SPG7(NM_001363850.1):c.233T>A (p.L78*), SPG7(NM_003119.3):c.233T>A (p.L78*), SPG7(NM_003119.4):c.233T>A (p.(Leu78Ter), p.L78*) - SPG7_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.233T>A r.(?) p.(Leu78Ter) Both (homozygous) - pathogenic (recessive) g.89576947T>A g.89510539T>A - - SPG7_000015 - PubMed: Salinas 2020 VCV000006816.9 - Germline - - - - - DNA SEQ-NG - gene panel ? Pat47 PubMed: Salinas 2020 patient M - - - - - - - 1 Johan den Dunnen
+/. - c.233T>A r.(?) p.(Leu78Ter) Parent #1 - pathogenic (recessive) g.89576947T>A g.89510539T>A - - SPG7_000015 - PubMed: Salinas 2020 VCV000006816.9 - Germline - - - - - DNA SEQ-NG - gene panel ? Pat52 PubMed: Salinas 2020 patient F - - - - - - - 1 Johan den Dunnen
+/. - c.233T>A r.(?) p.(Leu78Ter) Unknown - pathogenic g.89576947T>A - SPG7(NM_001363850.1):c.233T>A (p.L78*), SPG7(NM_003119.3):c.233T>A (p.L78*), SPG7(NM_003119.4):c.233T>A (p.(Leu78Ter), p.L78*) - SPG7_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.246A>G r.(?) p.(Gln82=) Unknown - likely benign g.89576960A>G g.89510552A>G SPG7(NM_003119.4):c.246A>G (p.Q82=) - SPG7_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.286+3A>G r.spl? p.? Unknown - VUS g.89577003A>G - SPG7(NM_003119.4):c.286+3A>G - SPG7_000132 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.286+46C>T r.(=) p.(=) Unknown - benign g.89577046C>T - SPG7(NM_003119.4):c.286+46C>T - SPG7_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.335_336insTA r.(?) p.(Glu112AspfsTer42) Unknown - pathogenic g.89579404_89579405insTA g.89512996_89512997insTA - - SPG7_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.377-354G>A r.(=) p.(=) Unknown - benign g.89590060G>A - SPG7(NM_003119.4):c.377-354G>A - SPG7_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.377-245_377-244insTCTCA r.(=) p.(=) Unknown - benign g.89590169_89590170insTCTCA g.89523761_89523762insTCTCA SPG7(NM_003119.4):c.377-245_377-244insTCTCA - SPG7_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.377-245_377-244insTCTCA r.(=) p.(=) Unknown - benign g.89590169_89590170insTCTCA - SPG7(NM_003119.4):c.377-245_377-244insTCTCA - SPG7_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.377-171G>A r.(=) p.(=) Unknown - benign g.89590243G>A g.89523835G>A SPG7(NM_003119.4):c.377-171G>A - SPG7_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.377-171G>A r.(=) p.(=) Unknown - benign g.89590243G>A - SPG7(NM_003119.4):c.377-171G>A - SPG7_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.414C>G r.(?) p.(Tyr138*) Unknown - pathogenic g.89590451C>G - - - SPG7_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.423G>T r.(?) p.(Arg141=) Unknown - benign g.89590460G>T g.89524052G>T - - SPG7_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.428G>A r.(?) p.(Arg143His) Unknown - VUS g.89590465G>A - SPG7(NM_003119.4):c.428G>A (p.(Arg143His)) - SPG7_000133 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 4 c.473_474del r.(?) p.(Leu158Glnfs*30) Paternal (confirmed) - pathogenic g.89590510_89590511del g.89524102_89524103del 473_474delTC - SPG7_000005 - - - - Germline - - - - - DNA SEQ, SEQ-NG-I - - SCAR - ATX529 - M - France - - - - - 1 Claire Guissart
-?/. - c.474C>T r.(?) p.(Leu158=) Unknown - likely benign g.89590511C>T g.89524103C>T SPG7(NM_003119.3):c.474C>T (p.L158=) - SPG7_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.547G>A r.(?) p.(Val183Ile) Unknown - likely benign g.89590584G>A g.89524176G>A SPG7(NM_003119.3):c.547G>A (p.V183I) - SPG7_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.611G>T r.(?) p.(Gly204Val) Unknown - VUS g.89590648G>T g.89524240G>T SPG7(NM_003119.4):c.611G>T (p.(Gly204Val)) - SPG7_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.611G>T r.(?) p.(Gly204Val) Unknown - VUS g.89590648G>T - SPG7(NM_003119.4):c.611G>T (p.(Gly204Val)) - SPG7_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 4 c.614G>A r.(?) p.(Arg205Gln) Parent #1 - VUS g.89590651G>A g.89524243G>A - - SPG7_000092 - PubMed: Ganapathy 2019 - rs760639086 Germline - - - - - DNA SEQ-NG - TruSight One panel ? S-4359 PubMed: Ganapathy 2019 - - - India - - - - - 1 Johan den Dunnen
-/. - c.618+12T>C r.(=) p.(=) Unknown - benign g.89590667T>C g.89524259T>C SPG7(NM_003119.3):c.618+12T>C, SPG7(NM_003119.4):c.618+12T>C - SPG7_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.618+12T>C r.(=) p.(=) Unknown - benign g.89590667T>C g.89524259T>C SPG7(NM_003119.3):c.618+12T>C, SPG7(NM_003119.4):c.618+12T>C - SPG7_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.618+12T>C r.(=) p.(=) Unknown - benign g.89590667T>C g.89524259T>C SPG7(NM_003119.3):c.618+12T>C, SPG7(NM_003119.4):c.618+12T>C - SPG7_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.618+14_618+36del r.(=) p.(=) Unknown - likely benign g.89590669_89590691del g.89524261_89524283del SPG7(NM_001363850.1):c.614_618+18delGGCCTGTGAGTGAGGGTGCGGGA, SPG7(NM_003119.4):c.614_618+18delGGCCTGTGAGTGAGGGTGCGGGA - SPG7_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.618+14_618+36del r.(=) p.(=) Unknown - likely benign g.89590669_89590691del - SPG7(NM_001363850.1):c.614_618+18delGGCCTGTGAGTGAGGGTGCGGGA, SPG7(NM_003119.4):c.614_618+18delGGCCTGTGAGTGAGGGTGCGGGA - SPG7_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.618+170C>T r.(=) p.(=) Unknown - benign g.89590825C>T - SPG7(NM_003119.4):c.618+170C>T - SPG7_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.619-115C>T r.(=) p.(=) Unknown - benign g.89592622C>T - SPG7(NM_003119.4):c.619-115C>T - SPG7_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.619-47G>A r.(=) p.(=) Unknown - benign g.89592690G>A - SPG7(NM_003119.4):c.619-47G>A - SPG7_000107 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.680dup r.(?) p.(Ala228Serfs*3) Unknown - pathogenic g.89592798dup - - - chr16_007820 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.694del r.(?) p.(Glu232SerfsTer2) Unknown - pathogenic g.89592812del g.89526404del - - SPG7_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.730T>G r.(?) p.(Ser244Ala) Unknown - VUS g.89592848T>G - SPG7(NM_003119.4):c.730T>G (p.(Ser244Ala)) - SPG7_000134 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.739C>T r.(?) p.(Arg247*) Unknown - pathogenic g.89592857C>T - SPG7(NM_001363850.1):c.739C>T (p.R247*) - SPG7_000118 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.756A>G r.(?) p.(Gly252=) Unknown - likely benign g.89592874A>G g.89526466A>G SPG7(NM_003119.2):c.756A>G (p.(Gly252Gly)), SPG7(NM_003119.4):c.756A>G (p.G252=) - SPG7_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.756A>G r.(?) p.(Gly252=) Unknown - VUS g.89592874A>G - SPG7(NM_003119.2):c.756A>G (p.(Gly252Gly)), SPG7(NM_003119.4):c.756A>G (p.G252=) - SPG7_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 5i c.759-2A>G r.spl p.? Unknown - likely pathogenic g.89595883A>G g.89529475A>G - - SPG7_000060 - - - - Unknown - - - - - DNA SEQ - - ? - - - M - (Germany) - - - - - 1 IMGAG
+/. - c.851del r.(?) p.(Phe284SerfsTer45) Unknown - pathogenic g.89595977del g.89529569del SPG7(NM_003119.3):c.851delT (p.F284Sfs*45) - SPG7_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.851T>C r.(?) p.(Phe284Ser) Unknown - likely benign g.89595977T>C g.89529569T>C SPG7(NM_003119.3):c.851T>C (p.F284S) - SPG7_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 6 c.853A>G r.(?) p.(Ser285Gly) Parent #2 - VUS g.89595979A>G g.89529571A>G - - SPG7_000093 - - - rs763745195 Germline - - - - - DNA SEQ-NG - TruSight One panel ? S-4359 PubMed: Ganapathy 2019 - - - India - - - - - 1 Johan den Dunnen
+?/. - c.861dup r.(?) p.Asn288* Unknown ACMG likely pathogenic g.89595987dup g.89529579dup - - SPG7_000022 reported in van Gassem 2012. Brain 135: 2994 - - rs797046003 Germline - - - - - DNA SEQ-NG-S - - - - - - F - - - - - - - 1 Andreas Laner
+/. - c.861dup r.(?) p.(Asn288*) Unknown ACMG pathogenic g.89595987dup g.89529579dup - - SPG7_000022 van Gassem et al. 2012. Brain 135: 2994 - - rs797046003 Germline - - - - - DNA SEQ-NG-S - - ? - - - F - - - - - - - 1 Andreas Laner
+/. - c.861dup r.(?) p.(Asn288*) Unknown ACMG pathogenic g.89595987dup g.89529579dup - - SPG7_000022 van Gassem et al. 2012. Brain 135: 2994 - - rs797046003 Germline - - - - - DNA SEQ-NG-S - - ? - - - F - - - - - - - 1 Andreas Laner
+/. - c.861dup r.(?) p.(Asn288*) Paternal (confirmed) - pathogenic (recessive) g.89595987dup - NM_003119.3:c.861dup - SPG7_000022 - Pennings et al. 2022, in progress - - Germline - - - - - DNA SEQ, SEQ-NG blood WES Healthy/Control AR19 Pennings et al. 2022, in progress - M - Netherlands - - - - - 1 Maartje Pennings
+/. - c.861+2dup r.spl? p.? Unknown - pathogenic g.89595989dup g.89529581dup SPG7(NM_003119.4):c.861+2dupT - SPG7_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.861+2dup r.spl? p.? Unknown - pathogenic g.89595989dup g.89529581dup SPG7(NM_003119.4):c.861+2dupT - SPG7_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.861+8C>G r.(=) p.(=) Unknown - likely benign g.89595995C>G - SPG7(NM_003119.4):c.861+8C>G - SPG7_000127 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.861+119C>T r.(=) p.(=) Unknown - benign g.89596106C>T - SPG7(NM_003119.4):c.861+119C>T - SPG7_000108 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.862-34G>T r.(=) p.(=) Unknown - benign g.89597057G>T - SPG7(NM_003119.4):c.862-34G>T - SPG7_000109 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.862-3C>T r.spl? p.? Unknown - likely benign g.89597088C>T - SPG7(NM_001363850.1):c.862-3C>T - SPG7_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.881G>A r.(?) p.(Arg294His) Unknown - benign g.89597110G>A - SPG7(NM_003119.4):c.881G>A (p.R294H) - SPG7_000115 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.898G>A r.(?) p.(Gly300Arg) Paternal (confirmed) - pathogenic (recessive) g.89597127G>A - - - SPG7_000091 - PubMed: Covone 2016 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ? patient;Pat27 PubMed: Covone 2016, PubMed: Neuser 2021 2-generation family, 1 affected, unaffected heterozygous carrier parents F - Italy - - - - - 1 Johan den Dunnen
?/. - c.920_925del r.(?) p.(Ser307_Phe308del) Unknown - VUS g.89597149_89597154del - SPG7(NM_003119.4):c.920_925delGCTTCA (p.S307_F308del) - SPG7_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.946G>A r.(?) p.(Glu316Lys) Unknown ACMG VUS g.89597175G>A g.89530767G>A - - SPG7_000088 ACMG grading: PM2,PP3 no second variant detected in SPG7, no dosis change; Infantile cerebral palsy symmetric leg-stressed at age 2y, GMFCS stage 1 unclear etiology, hydrocephalus prenatally diagnosed, no intracranial pressure signs, MRI: plexus choroideus left attached to the left lateral ventricle, ventriculomegaly, signal changes of the adjacent cerebral parenchyma decreasing - - - Germline - - - - - DNA SEQ-NG-S - - ? - - - M - - - - - - - 1 Andreas Laner
-/. - c.987+5A>G r.spl? p.? Unknown - benign g.89597221A>G g.89530813A>G SPG7(NM_003119.3):c.987+5A>G, SPG7(NM_003119.4):c.987+5A>G - SPG7_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.987+5A>G r.spl? p.? Unknown - benign g.89597221A>G g.89530813A>G SPG7(NM_003119.3):c.987+5A>G, SPG7(NM_003119.4):c.987+5A>G - SPG7_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.987+5A>G r.spl? p.? Unknown - benign g.89597221A>G g.89530813A>G SPG7(NM_003119.3):c.987+5A>G, SPG7(NM_003119.4):c.987+5A>G - SPG7_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.987+19G>A r.(=) p.(=) Unknown - benign g.89597235G>A g.89530827G>A - - SPG7_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.987+151T>C r.(=) p.(=) Unknown - likely benign g.89597367T>C - SPG7(NM_003119.4):c.987+151T>C - SPG7_000125 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1032C>T r.(?) p.(Gly344=) Unknown - likely benign g.89598356C>T g.89531948C>T SPG7(NM_003119.3):c.1032C>T (p.G344=), SPG7(NM_003119.4):c.1032C>T (p.G344=) - SPG7_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1032C>T r.(?) p.(Gly344=) Unknown - likely benign g.89598356C>T - SPG7(NM_003119.3):c.1032C>T (p.G344=), SPG7(NM_003119.4):c.1032C>T (p.G344=) - SPG7_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1045G>A r.(?) p.(Gly349Ser) Unknown - pathogenic g.89598369G>A g.89531961G>A SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S) - SPG7_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1045G>A r.(?) p.(Gly349Ser) Unknown - pathogenic g.89598369G>A g.89531961G>A SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S) - SPG7_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1045G>A r.(?) p.(Gly349Ser) Unknown - likely pathogenic g.89598369G>A g.89531961G>A SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S) - SPG7_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1045G>A r.(?) p.Gly349Ser Unknown ACMG pathogenic g.89598369G>A g.89531961G>A - - SPG7_000025 ACMG grading: PM3,PS3,PP5,PP3,PM2,PP1; reported in Bonn 2010. HumMut 31: 617. Brugman 2008. Neurology 71: 1500 Fogel 2014. JAMA 71: 1237 - - rs141659620 Germline - - - - - DNA SEQ-NG - - - - - - F - Germany - - - - - 1 Andreas Laner
+/. - c.1045G>A r.(?) p.(Gly349Ser) Unknown - pathogenic g.89598369G>A g.89531961G>A SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S) - SPG7_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ - c.1045G>A r.(?) p.(Gly349Ser) Unknown ACMG pathogenic g.89598369G>A g.89531961G>A - - SPG7_000025 primarily chronic progressive MS, differential diagnosis of hereditary neurological diseases Bonn et al. 2010. HumMut 31: 617; Brugman et al. 2008. Neurology 71: 1500; Fogel et al. 2014. JAMA 71: 1237 - rs141659620 Germline - - - - - DNA SEQ-NG-S - - - - - - F - - - - - - - 1 Andreas Laner
+?/. - c.1045G>A r.(?) p.(Gly349Ser) Parent #1 - likely pathogenic g.89598369G>A g.89531961G>A - - SPG7_000025 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs141659620 Germline - 1/2795 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 1 Mohammed Faruq
+/. - c.1045G>A r.(?) p.(Gly349Ser) Unknown ACMG pathogenic g.89598369G>A g.89531961G>A - - SPG7_000025 Bonn et al. 2010. HumMut 31: 617; Brugman et al. 2008. Neurology 71: 1500; Fogel et al. 2014. JAMA 71: 1237 - - rs141659620 Germline - - - - - DNA SEQ-NG-S - - ? - - - M - - - - - - - 1 Andreas Laner
+/. - c.1045G>A r.(?) p.(Gly349Ser) Unknown ACMG pathogenic g.89598369G>A g.89531961G>A - - SPG7_000025 no second varinat detected in SPG7; Bonn et al. 2010. HumMut 31: 617; Brugman et al. 2008. Neurology 71: 1500; Fogel et al. 2014. JAMA 71: 1237 - - rs141659620 Germline - - - - - DNA SEQ-NG-S - - ? - - - M - - - - - - - 1 Andreas Laner
-/-? - c.1045G>A r.(?) p.(Gly349Ser) Unknown - likely benign g.89598369G>A - - - SPG7_000025 - - - - Germline/De novo (untested) - - - - - DNA SEQ-NG Blood - OPA - - - F - (France) - - - - - 1 Marc Ferre
+/. - c.1045G>A r.(?) p.(Gly349Ser) Unknown - pathogenic g.89598369G>A - SPG7(NM_003119.2):c.1045G>A (p.(Gly349Ser)), SPG7(NM_003119.3):c.1045G>A (p.G349S), SPG7(NM_003119.4):c.1045G>A (p.G349S) - SPG7_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1045G>A r.(?) p.(Gly349Ser) Unknown - likely pathogenic (recessive) g.89598369G>A - NM_003119.4:c.1045G>A - SPG7_000025 - Pennings et al. 2022, in progress - - Germline/De novo (untested) - - - - - DNA SEQ, SEQ-NG blood WES Healthy/Control AR18 Pennings et al. 2022, in progress - F - Netherlands - - - - - 1 Maartje Pennings
Legend   How to query   « First ‹ Prev     1 2 3     Next › Last »

alias: paraplegin (PGN)


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.