Full data view for gene SURF2

Information The variants shown are described using the NM_017503.3 transcript reference sequence.

47 entries on 1 page. Showing entries 1 - 47.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-/. - c.-4681G>A r.(?) p.(=) Unknown - benign g.136218788G>A g.133351933G>A SURF1(NM_003172.3):c.883C>T (p.R295C) - RPL7A_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-4566G>A r.(?) p.(=) Unknown - benign g.136218903G>A g.133352048G>A SURF1(NM_003172.4):c.833+13C>T - SURF1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-4543T>A r.(?) p.(=) Unknown - VUS g.136218926T>A g.133352071T>A SURF1(NM_003172.3):c.823A>T (p.I275F) - SURF1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-4174A>G r.(?) p.(=) Unknown - benign g.136219295A>G g.133352440A>G SURF1(NM_003172.4):c.751+6T>C - SURF1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-4174A>G r.(?) p.(=) Unknown - benign g.136219295A>G - SURF1(NM_003172.4):c.751+6T>C - SURF1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-4162T>C r.(?) p.(=) Unknown - VUS g.136219307T>C g.133352452T>C SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-4162T>C r.(?) p.(=) Unknown - VUS g.136219307T>C g.133352452T>C SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-4162T>C r.(?) p.(=) Unknown - VUS g.136219307T>C - SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-4095G>A r.(?) p.(=) Unknown - likely benign g.136219374G>A - SURF1(NM_003172.3):c.678C>T (p.H226=) - RPL7A_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-3905G>C r.(?) p.(=) Unknown - benign g.136219564G>C g.133352709G>C SURF1(NM_003172.4):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-3905G>C r.(?) p.(=) Unknown - benign g.136219564G>C g.133352709G>C SURF1(NM_003172.4):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-3875G>A r.(?) p.(=) Unknown - benign g.136219594G>A g.133352739G>A SURF1(NM_003172.4):c.543C>T (p.F181=) - RPL7A_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-3865T>C r.(?) p.(=) Unknown - VUS g.136219604T>C - SURF1(NM_003172.4):c.533A>G (p.N178S) - RPL7A_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.-3846T>C r.(?) p.(=) Unknown - likely pathogenic g.136219623T>C g.133352768T>C - - SURF1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-2848G>C r.(?) p.(=) Unknown - VUS g.136220621G>C g.133353766G>C SURF1(NM_003172.2):c.498C>G (p.(Phe166Leu)) - RPL7A_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-2721C>T r.(?) p.(=) Unknown - VUS g.136220748C>T g.133353893C>T - - RPL7A_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-2700T>G r.(?) p.(=) Unknown - VUS g.136220769T>G g.133353914T>G SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)), SURF1(NM_003172.4):c.350A>C (p.Y117S) - RPL7A_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-2700T>G r.(?) p.(=) Unknown - VUS g.136220769T>G - SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)), SURF1(NM_003172.4):c.350A>C (p.Y117S) - RPL7A_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1953_-1945del r.(?) p.(=) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1953_-1945del r.(?) p.(=) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1953_-1945del r.(?) p.(=) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1953_-1945del r.(?) p.(=) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1944_-1943insT r.(?) p.(=) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1944_-1943insT r.(?) p.(=) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1944_-1943insT r.(?) p.(=) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1944_-1943insT r.(?) p.(=) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-1912A>G r.(?) p.(=) Unknown - benign g.136221557A>G g.133354702A>G SURF1(NM_003172.4):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-1912A>G r.(?) p.(=) Unknown - benign g.136221557A>G g.133354702A>G SURF1(NM_003172.4):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1901A>G r.(?) p.(=) Unknown - pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.-1901A>G r.(?) p.(=) Unknown - likely pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.-1901A>G r.(?) p.(=) Unknown - likely pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.-1901A>G r.(?) p.(=) Unknown - likely pathogenic g.136221568A>G - SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-1811A>G r.(?) p.(=) Unknown - likely benign g.136221658A>G g.133354803A>G SURF1(NM_003172.4):c.240+21T>C - SURF1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1791C>A r.(?) p.(=) Unknown - pathogenic g.136221678C>A g.133354823C>A SURF1(NM_003172.4):c.240+1G>T - RPL7A_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1791C>A r.(?) p.(=) Unknown - pathogenic g.136221678C>A - SURF1(NM_003172.4):c.240+1G>T - RPL7A_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.-1760_-1759del r.(?) p.(=) Unknown - pathogenic g.136221709_136221710del g.133354854_133354855del SURF1(NM_003172.4):c.209_210delCT (p.P70Rfs*31) - SURF1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-1717G>C r.(?) p.(=) Unknown - benign g.136221752G>C g.133354897G>C SURF1(NM_003172.4):c.167C>G (p.A56G) - SURF1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-1690G>C r.(?) p.(=) Unknown - VUS g.136221779G>C g.133354924G>C SURF1(NM_003172.4):c.140C>G (p.S47C) - RPL7A_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-1680A>T r.(?) p.(=) Unknown - likely benign g.136221789A>T - SURF1(NM_003172.3):c.130T>A (p.C44S) - RPL7A_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-426C>G r.(?) p.(=) Unknown - benign g.136223043C>G - SURF1(NM_003172.4):c.106+81G>C - RPL7A_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-223_-203del r.(?) p.(=) Unknown - benign g.136223246_136223266del g.133356370_133356390del SURF1(NM_003172.4):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG - SURF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-223_-203del r.(?) p.(=) Unknown - benign g.136223246_136223266del - SURF1(NM_003172.4):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG - SURF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-209_-203del r.(?) p.(=) Unknown - benign g.136223260_136223266del - SURF1(NM_003172.4):c.54+48_55-47delTGCGGGG - RPL7A_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-203C>T r.(?) p.(=) Unknown - likely benign g.136223266C>T g.133356390C>T SURF1(NM_003172.4):c.54+10G>A - RPL7A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-203C>T r.(?) p.(=) Unknown - likely benign g.136223266C>T - SURF1(NM_003172.4):c.54+10G>A - RPL7A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.73C>T r.(?) p.(Arg25Cys) Unknown - likely benign g.136223541C>T g.133356665C>T SURF2(NM_001278928.1):c.73C>T (p.(Arg25Cys)) - SURF1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.662G>A r.(?) p.(Arg221Gln) Unknown - likely benign g.136227285G>A g.133360409G>A SURF2(NM_001278928.1):c.662G>A (p.(Arg221Gln)) - SURF1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.