Full data view for gene TMX2

Information The variants shown are described using the NM_015959.3 transcript reference sequence.

105 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/. - c.142G>C r.(?) p.(Gly48Arg) Unknown - likely benign g.57480232G>C g.57712760G>C TMX2(NM_015959.4):c.142G>C (p.G48R) - C11orf31_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.157C>T r.157c>u p.Arg53Cys Parent #1 - pathogenic (recessive) g.57480247C>T g.57712775C>T - - TMX2_000004 - PubMed: Vandervore 2019 - - Germline - - - - - DNA, RNA RT-PCR, SEQ, SEQ-NG - WES ID Fam3Pat3 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents F no Australia;United Kingdom (Great Britain) white - - - - 1 Johan den Dunnen
+/. - c.164A>C r.(?) p.(Asp55Ala) Unknown - pathogenic g.57480254A>C g.57712782A>C TMX2(NM_015959.4):c.164A>C (p.D55A) - TMX2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.164A>C r.164a>c p.Asp55Ala Parent #1 - pathogenic (recessive) g.57480254A>C g.57712782A>C - - TMX2_000002 - PubMed: Vandervore 2019 - - Germline - - - - - DNA, RNA RT-PCR, SEQ, SEQ-NG - WES ID Fam1Pat1 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents M no Netherlands - 14d - - - 1 Johan den Dunnen
+/. - c.164A>C r.(?) p.(Asp55Ala) Parent #1 - pathogenic (recessive) g.57480254A>C g.57712782A>C - - TMX2_000002 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam7Pat10 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents M no Netherlands - 7d - - - 1 Johan den Dunnen
+/. - c.166G>C r.(?) p.(Gly56Arg) Both (homozygous) - pathogenic (recessive) g.57480256G>C g.57712784G>C - - TMX2_000006 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam4Pat4 PubMed: Vandervore 2019 2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents M - Puerto Rico - - - - - 2 Johan den Dunnen
+/. - c.166G>C r.(?) p.(Gly56Arg) Both (homozygous) - pathogenic (recessive) g.57480256G>C g.57712784G>C - - TMX2_000006 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam4Pat5 PubMed: Vandervore 2019 - F - Puerto Rico - - - - - 1 Johan den Dunnen
+/. - c.178G>A r.(?) p.(Asp60Asn) Both (homozygous) - pathogenic (recessive) g.57480268G>A g.57712796G>A - - TMX2_000012 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam9Pat13 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents F yes Pakistan - - - - - 1 Johan den Dunnen
?/. - c.180C>G r.(?) p.(Asp60Glu) Unknown - VUS g.57480270C>G g.57712798C>G TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu)) - C11orf31_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.180C>G r.(?) p.(Asp60Glu) Unknown - VUS g.57480270C>G - TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu)) - C11orf31_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.180C>G r.(?) p.(Asp60Glu) Unknown - likely benign g.57480270C>G - TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu)) - C11orf31_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.184G>C r.(?) p.(Asp62His) Both (homozygous) - pathogenic (recessive) g.57480274G>C g.57712802G>C - - TMX2_000011 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam8Pat11 PubMed: Vandervore 2019 2-generation family, 2 affected (2M), unaffected heterozygous carrier parents/relatives M yes Iraq - - - - - 2 Johan den Dunnen
+/. - c.184G>C r.(?) p.(Asp62His) Both (homozygous) - pathogenic (recessive) g.57480274G>C g.57712802G>C - - TMX2_000011 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam8Pat12 PubMed: Vandervore 2019 - M yes Iraq - - - - - 1 Johan den Dunnen
?/. - c.189+11762C>T r.(=) p.(=) Unknown - VUS g.57492041C>T - TMX2(NM_001347891.1):c.196C>T (p.R66C), TMX2(NM_001347891.2):c.196C>T (p.(Arg66Cys)) - C11orf31_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.189+11762C>T r.(=) p.(=) Unknown - likely benign g.57492041C>T - TMX2(NM_001347891.1):c.196C>T (p.R66C), TMX2(NM_001347891.2):c.196C>T (p.(Arg66Cys)) - C11orf31_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.251-7_251-6del r.(=) p.(=) Unknown - VUS g.57505378_57505379del - TMX2(NM_015959.4):c.251-7_251-6del - C11orf31_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.326A>G r.(?) p.(Asp109Gly) Parent #1 - pathogenic (recessive) g.57505460A>G g.57737988A>G - - TMX2_000007 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam5Pat6 PubMed: Vandervore 2019 2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents F no Spain - - - - - 2 Johan den Dunnen
+/. - c.326A>G r.(?) p.(Asp109Gly) Parent #1 - pathogenic (recessive) g.57505460A>G g.57737988A>G - - TMX2_000007 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam5Pat7 PubMed: Vandervore 2019 - M no Spain - - - - - 1 Johan den Dunnen
+/. - c.349A>G r.(?) p.(Ile117Val) Parent #1 - pathogenic (recessive) g.57505483A>G g.57738011A>G - - TMX2_000013 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam10Pat14 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents F - Mexico;Spain - - - - - 1 Johan den Dunnen
+/. - c.391dup r.(?) p.(Leu131ProfsTer6) Unknown - pathogenic g.57505852dup g.57738380dup TMX2(NM_015959.4):c.391dupC (p.L131Pfs*6) - C11orf31_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.391dup r.dup p.Leu131Profs*6 Parent #2 - pathogenic (recessive) g.57505852dup g.57738380dup - - TMX2_000001 RNA expression 0.02-0.03 PubMed: Vandervore 2019 - - Germline - - - - - DNA, RNA RT-PCR, SEQ, SEQ-NG - WES ID Fam1Pat1 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents M no Netherlands - 14d - - - 1 Johan den Dunnen
?/. - c.418T>C r.(?) p.(Tyr140His) Unknown - VUS g.57505879T>C g.57738407T>C TMX2(NM_001144012.2):c.304T>C (p.(Tyr102His)) - TMX2-CTNND1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.532G>A r.(?) p.(Ala178Thr) Both (homozygous) - pathogenic (recessive) g.57506226G>A g.57738754G>A - - TMX2_000009 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam6Pat8 PubMed: Vandervore 2019 2-generation family, 2 affected (2F), unaffected heterozygous carrier parents F yes - Arab 6y - - - 2 Johan den Dunnen
+/. - c.532G>A r.(?) p.(Ala178Thr) Both (homozygous) - pathogenic (recessive) g.57506226G>A g.57738754G>A - - TMX2_000009 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam6Pat9 PubMed: Vandervore 2019 - F yes - Arab - - - - 1 Johan den Dunnen
-?/. - c.603T>C r.(?) p.(Asp201=) Unknown - likely benign g.57506500T>C - TMX2(NM_001347895.1):c.321T>C (p.D107=) - C11orf31_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.609_614+15del r.spl p.? Parent #2 - pathogenic (recessive) g.57506506_57506526del g.57739034_57739054del - - TMX2_000010 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam7Pat10 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents M no Netherlands - 7d - - - 1 Johan den Dunnen
?/. - c.609_614+15del r.spl? p.? Unknown - VUS g.57506506_57506526del - TMX2(NM_015959.3):c.609_614+15delTACGCGGTATGTAAAGACCTG (p.(Ser203_Thr204del)) - TMX2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.614G>A r.[604_614del,549_614del,=] p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A - - TMX2_000003 - PubMed: Vandervore 2019 - - Germline - - - - - DNA, RNA RT-PCR, SEQ, SEQ-NG - WES ID Fam2Pat2 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents M no Portugal - - - - - 1 Johan den Dunnen
+/. - c.614G>A r.(?) p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A 500G>A (Arg205Gln) - TMX2_000003 - PubMed: Ghosh 2020 - - Germline - - - - - DNA SEQ, SEQ-NG - WES microlissencephaly Fam1673PatIII1 PubMed: Ghosh 2020 3-generation family, 1 affected, unaffected heterozygous carrier parents/relatives F yes Saudi Arabia - - - - - 1 Johan den Dunnen
+/. - c.614G>A r.(?) p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A 500G>A (Arg205Gln) - TMX2_000003 - PubMed: Ghosh 2020 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES microlissencephaly Fam2525PatIII2 PubMed: Ghosh 2020 2-generation family, 2 affected sisters, unaffected heterozygous carrier parents/relatives F yes Pakistan - 4y - - - 2 Johan den Dunnen
+/. - c.614G>A r.(?) p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A 500G>A (Arg205Gln) - TMX2_000003 - PubMed: Ghosh 2020 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES microlissencephaly Fam2525PatIII3 PubMed: Ghosh 2020 sister F yes Pakistan - - - - - 1 Johan den Dunnen
+/. - c.614G>A r.(?) p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A 500G>A (Arg205Gln) - TMX2_000003 - PubMed: Ghosh 2020 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES microlissencephaly Fam4984PatIII1 PubMed: Ghosh 2020 3-generation family, 3 affected (F, 2M), unaffected heterozygous carrier parents/relatives M yes Egypt - 5y - - - 3 Johan den Dunnen
+/. - c.614G>A r.(?) p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A 500G>A (Arg205Gln) - TMX2_000003 - PubMed: Ghosh 2020 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES microlissencephaly Fam4984PatIII3 PubMed: Ghosh 2020 sister F yes Egypt - - - - - 1 Johan den Dunnen
+/. - c.614G>A r.(?) p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A 500G>A (Arg205Gln) - TMX2_000003 - PubMed: Ghosh 2020 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES microlissencephaly Fam4984PatIII4 PubMed: Ghosh 2020 brother M yes Egypt - - - - - 1 Johan den Dunnen
+/. - c.614G>A r.(?) p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A 500G>A (Arg205Gln) - TMX2_000003 - PubMed: Ghosh 2020 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES microlissencephaly Fam3501PatIII6 PubMed: Ghosh 2020 2-generation family, affected brother/sister, unaffected heterozygous carrier parents/relatives M yes Kuwait - - - - - 2 Johan den Dunnen
+/. - c.614G>A r.(?) p.(Arg205Gln) Both (homozygous) - pathogenic (recessive) g.57506511G>A g.57739039G>A 500G>A (Arg205Gln) - TMX2_000003 - PubMed: Ghosh 2020 - - Germline yes - - - - DNA SEQ, SEQ-NG - WES microlissencephaly Fam3501PatIII7 PubMed: Ghosh 2020 sister F yes Kuwait - - - - - 1 Johan den Dunnen
-?/. - c.614+7A>G r.(=) p.(=) Unknown - likely benign g.57506518A>G g.57739046A>G TMX2(NM_015959.4):c.614+7A>G - C11orf31_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.691C>T r.(?) p.(Arg231Trp) Parent #2 - pathogenic (recessive) g.57506679C>T g.57739207C>T - - TMX2_000008 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam5Pat6 PubMed: Vandervore 2019 2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents F no Spain - - - - - 2 Johan den Dunnen
+/. - c.691C>T r.(?) p.(Arg231Trp) Parent #2 - pathogenic (recessive) g.57506679C>T g.57739207C>T - - TMX2_000008 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam5Pat7 PubMed: Vandervore 2019 - M no Spain - - - - - 1 Johan den Dunnen
+/. - c.691C>T r.(?) p.(Arg231Trp) Parent #2 - pathogenic (recessive) g.57506679C>T g.57739207C>T - - TMX2_000008 - PubMed: Vandervore 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - WES ID Fam10Pat14 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents F - Mexico;Spain - - - - - 1 Johan den Dunnen
+/. - c.757C>T r.757c>u p.Arg253* Parent #2 - pathogenic (recessive) g.57507583C>T g.57740111C>T - - TMX2_000005 RNA expression 0.23 PubMed: Vandervore 2019 - - Germline - - - - - DNA, RNA RT-PCR, SEQ, SEQ-NG - WES ID Fam3Pat3 PubMed: Vandervore 2019 2-generation family, 1 affected, unaffected heterozygous carrier parents F no Australia;United Kingdom (Great Britain) white - - - - 1 Johan den Dunnen
?/. - c.875dup r.(?) p.(Asn292Lysfs*5) Unknown - VUS g.57507701dup - TMX2(NM_015959.3):c.875dupA (p.(Asn292fs)) - C11orf31_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.876C>G r.(?) p.(Asn292Lys) Unknown - VUS g.57507702C>G - TMX2(NM_015959.3):c.876C>G (p.(Asn292Lys)) - C11orf31_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*51132C>G r.(=) p.(=) Unknown - likely benign g.57558849C>G g.57791377C>G CTNND1(NM_001085458.1):c.-94-8C>G - C11orf31_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*51257G>C r.(=) p.(=) Unknown - likely benign g.57558974G>C g.57791502G>C CTNND1(NM_001085458.1):c.24G>C (p.S8=) - C11orf31_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*51275C>T r.(=) p.(=) Unknown - likely benign g.57558992C>T g.57791520C>T CTNND1(NM_001085458.1):c.42C>T (p.A14=), CTNND1(NM_001085458.2):c.42C>T (p.A14=) - C11orf31_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*51275C>T r.(=) p.(=) Unknown - likely benign g.57558992C>T - CTNND1(NM_001085458.1):c.42C>T (p.A14=), CTNND1(NM_001085458.2):c.42C>T (p.A14=) - C11orf31_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*51333C>G r.(=) p.(=) Unknown - likely benign g.57559050C>G g.57791578C>G CTNND1(NM_001085458.1):c.100C>G (p.R34G) - C11orf31_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*53771C>T r.(=) p.(=) Unknown - likely benign g.57561488C>T - CTNND1(NM_001085458.1):c.202C>T (p.R68W), CTNND1(NM_001085458.2):c.202C>T (p.R68W) - C11orf31_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*53771C>T r.(=) p.(=) Unknown - VUS g.57561488C>T - CTNND1(NM_001085458.1):c.202C>T (p.R68W), CTNND1(NM_001085458.2):c.202C>T (p.R68W) - C11orf31_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.*53826A>G r.(=) p.(=) Unknown - benign g.57561543A>G g.57794071A>G CTNND1(NM_001085458.1):c.257A>G (p.N86S) - C11orf31_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*53827C>T r.(=) p.(=) Unknown - likely benign g.57561544C>T g.57794072C>T CTNND1(NM_001085458.1):c.258C>T (p.N86=) - C11orf31_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*55363C>T r.(=) p.(=) Unknown - likely benign g.57563080C>T g.57795608C>T CTNND1(NM_001085458.1):c.299C>T (p.(Pro100Leu)) - C11orf31_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*55401A>C r.(=) p.(=) Unknown - likely benign g.57563118A>C - CTNND1(NM_001085458.2):c.337A>C (p.(Thr113Pro)) - C11orf31_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*55419G>C r.(=) p.(=) Unknown - VUS g.57563136G>C - CTNND1(NM_001085458.2):c.355G>C (p.G119R) - C11orf31_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*56250A>G r.(=) p.(=) Unknown - likely benign g.57563967A>G - CTNND1(NM_001085458.1):c.459A>G (p.V153=) - C11orf31_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*56356G>A r.(=) p.(=) Unknown - VUS g.57564073G>A - - - C11orf31_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*56409C>G r.(=) p.(=) Unknown - VUS g.57564126C>G - CTNND1(NM_001085458.1):c.618C>G (p.(Phe206Leu)) - C11orf31_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*56425G>A r.(=) p.(=) Unknown - likely benign g.57564142G>A - CTNND1(NM_001085458.1):c.634G>A (p.(Gly212Ser)) - C11orf31_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*56450G>A r.(=) p.(=) Unknown - likely benign g.57564167G>A - CTNND1(NM_001085458.2):c.659G>A (p.G220D) - C11orf31_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.*56575C>T r.(=) p.(=) Unknown - likely pathogenic g.57564292C>T - CTNND1(NM_001085458.1):c.784C>T (p.(Gln262*)) - C11orf31_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*56609A>G r.(=) p.(=) Unknown - likely benign g.57564326A>G - CTNND1(NM_001085458.1):c.818A>G (p.(His273Arg)) - C11orf31_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*56611C>T r.(=) p.(=) Unknown - VUS g.57564328C>T - CTNND1(NM_001085458.2):c.820C>T (p.(Arg274Cys)) - C11orf31_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*56648A>G r.(=) p.(=) Unknown - likely benign g.57564365A>G - CTNND1(NM_001085458.1):c.857A>G (p.(Gln286Arg)) - C11orf31_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*56663A>G r.(=) p.(=) Unknown - VUS g.57564380A>G g.57796908A>G CTNND1(NM_001085458.1):c.872A>G (p.Y291C) - C11orf31_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*56722C>T r.(=) p.(=) Unknown - likely benign g.57564439C>T - CTNND1(NM_001085458.1):c.931C>T (p.(Pro311Ser)) - C11orf31_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*56740C>T r.(=) p.(=) Unknown - VUS g.57564457C>T - CTNND1(NM_001085458.2):c.949C>T (p.R317C) - C11orf31_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*61721A>G r.(=) p.(=) Unknown - VUS g.57569438A>G - CTNND1(NM_001085458.2):c.1190A>G (p.N397S) - C11orf31_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*61740C>T r.(=) p.(=) Unknown - likely benign g.57569457C>T - CTNND1(NM_001085458.1):c.1209C>T (p.D403=) - C11orf31_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*61903C>T r.(=) p.(=) Unknown - pathogenic g.57569620C>T g.57802148C>T CTNND1(NM_001085458.1):c.1372C>T (p.R458*) - CTNND1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*61950C>T r.(=) p.(=) Unknown - likely benign g.57569667C>T - CTNND1(NM_001085458.1):c.1419C>T (p.T473=) - C11orf31_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*63379C>T r.(=) p.(=) Unknown - VUS g.57571096C>T g.57803624C>T CTNND1(NM_001085458.1):c.1424C>T (p.T475I) - C11orf31_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*63492A>G r.(=) p.(=) Unknown - likely benign g.57571209A>G g.57803737A>G CTNND1(NM_001085458.1):c.1537A>G (p.N513D), CTNND1(NM_001085458.2):c.1537A>G (p.N513D) - C11orf31_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*63492A>G r.(=) p.(=) Unknown - likely benign g.57571209A>G - CTNND1(NM_001085458.1):c.1537A>G (p.N513D), CTNND1(NM_001085458.2):c.1537A>G (p.N513D) - C11orf31_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*63510C>T r.(=) p.(=) Unknown - likely benign g.57571227C>T - CTNND1(NM_001085458.2):c.1555C>T (p.(Arg519Cys)) - C11orf31_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*63526A>T r.(=) p.(=) Unknown - likely benign g.57571243A>T - CTNND1(NM_001085458.2):c.1571A>T (p.(Glu524Val)) - C11orf31_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*63529C>T r.(=) p.(=) Unknown - VUS g.57571246C>T - CTNND1(NM_001085458.2):c.1574C>T (p.S525L) - C11orf31_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*64542G>T r.(=) p.(=) Unknown - likely benign g.57572259G>T - CTNND1(NM_001085458.1):c.1722+7G>T - C11orf31_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*65664C>T r.(=) p.(=) Unknown - VUS g.57573381C>T - CTNND1(NM_001085458.1):c.1750C>T (p.(Arg584Trp)) - C11orf31_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.*65676_*65680del r.(=) p.(=) Unknown - pathogenic g.57573393_57573397del - CTNND1(NM_001085458.2):c.1762_1766delTATCA (p.Y588Sfs*38) - C11orf31_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*65737C>G r.(=) p.(=) Unknown - likely benign g.57573454C>G - CTNND1(NM_001085458.1):c.1823C>G (p.A608G) - C11orf31_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*65751C>T r.(=) p.(=) Unknown - likely benign g.57573468C>T - CTNND1(NM_001085458.2):c.1837C>T (p.P613S) - C11orf31_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*66243_*66244insA r.(=) p.(=) Unknown - likely benign g.57573960_57573961insA g.57806488_57806489insA CTNND1(NM_001085458.1):c.1894+10_1894+11insA - C11orf31_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*66724C>T r.(=) p.(=) Unknown - VUS g.57574441C>T g.57806969C>T CTNND1(NM_001085458.1):c.1949C>T (p.T650M), CTNND1(NM_001085458.2):c.1949C>T (p.T650M) - TMX2-CTNND1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*66724C>T r.(=) p.(=) Unknown - VUS g.57574441C>T - CTNND1(NM_001085458.1):c.1949C>T (p.T650M), CTNND1(NM_001085458.2):c.1949C>T (p.T650M) - TMX2-CTNND1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.*67969dup r.(?) p.(=) Unknown - likely pathogenic g.57575686dup - CTNND1(NM_001085458.1):c.2013dupT (p.(Leu672fs)) - C11orf31_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*68037G>C r.(=) p.(=) Unknown - VUS g.57575754G>C - CTNND1(NM_001085458.2):c.2081G>C (p.(Gly694Ala)) - C11orf31_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*68160C>T r.(=) p.(=) Unknown - VUS g.57575877C>T g.57808405C>T CTNND1(NM_001085458.2):c.2107C>T (p.R703C) - TMX2-CTNND1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*68212C>A r.(=) p.(=) Unknown - VUS g.57575929C>A - CTNND1(NM_001085458.1):c.2159C>A (p.T720N) - C11orf31_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*68226C>T r.(=) p.(=) Unknown - likely benign g.57575943C>T - CTNND1(NM_001085458.2):c.2173C>T (p.R725W) - C11orf31_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*69075G>A r.(=) p.(=) Unknown - likely benign g.57576792G>A - CTNND1(NM_001085458.1):c.2289G>A (p.Q763=) - C11orf31_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*69135C>T r.(=) p.(=) Unknown - likely benign g.57576852C>T - CTNND1(NM_001085458.1):c.2349C>T (p.N783=) - C11orf31_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*69227C>G r.(=) p.(=) Unknown - likely benign g.57576944C>G g.57809472C>G CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G - C11orf31_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*69227C>G r.(=) p.(=) Unknown - likely benign g.57576944C>G - CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G - C11orf31_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*69227C>G r.(=) p.(=) Unknown - likely benign g.57576944C>G - CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G - C11orf31_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.*69902T>C r.(=) p.(=) Unknown - VUS g.57577619T>C g.57810147T>C CTNND1(NM_001085458.1):c.2474T>C (p.V825A, p.(Val825Ala)) - TMX2-CTNND1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*69902T>C r.(=) p.(=) Unknown - likely benign g.57577619T>C - CTNND1(NM_001085458.1):c.2474T>C (p.V825A, p.(Val825Ala)) - TMX2-CTNND1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*71147C>T r.(=) p.(=) Unknown - likely benign g.57578864C>T - CTNND1(NM_001085458.2):c.2551-7C>T - C11orf31_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*71226C>T r.(=) p.(=) Unknown - likely benign g.57578943C>T - CTNND1(NM_001085458.1):c.2623C>T (p.R875W), CTNND1(NM_001085458.2):c.2623C>T (p.R875W) - C11orf31_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*71226C>T r.(=) p.(=) Unknown - likely benign g.57578943C>T - CTNND1(NM_001085458.1):c.2623C>T (p.R875W), CTNND1(NM_001085458.2):c.2623C>T (p.R875W) - C11orf31_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query   « First ‹ Prev     1 2     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.