Full data view for gene WDPCP

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_015910.5 transcript reference sequence.

103 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
?/. - c.-16600G>A r.(?) p.(=) Unknown - VUS g.63832005C>T - MDH1(NM_005917.4):c.674C>T (p.T225M) - MDH1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-9136C>T r.(?) p.(=) Unknown - VUS g.63824541G>A g.63597407G>A MDH1(NM_001199111.1):c.262G>A (p.(Ala88Thr)) - MDH1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-6262C>T r.(?) p.(=) Unknown - VUS g.63821667G>A - MDH1(NM_005917.4):c.49G>A (p.A17T) - MDH1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-1111T>A r.(?) p.(=) Unknown - VUS g.63816516A>T g.63589382A>T MDH1(NM_001199111.1):c.55A>T (p.K19*) - MDH1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 1 c.-1012C>T r.(?) p.? Unknown - VUS g.63816417G>A - BBS15: c.-1012C>T - WDPCP_000046 - PubMed: M'hamdi-2014 - - Germline - - - - - DNA SEQ - targeted exon capture strategy retinal disease - PubMed: M'hamdi-2014 - F yes Tunisia Tunisian - - - - 1 LOVD
+/. 1 c.? r.(?) p.? Unknown - pathogenic g.63816417G>A - c.-1012C >T - WDPCP_000046 - PubMed: M'hamdi 2014 - - Unknown - - - - - DNA SEQ blood - retinal disease - PubMed: M'hamdi_2014 - F yes Tunisia Tunisian - - - - 1 LOVD
?/. - c.? r.spl p.(?) Unknown - VUS g.63711458_63720341del - WDPCP chr2:63711458_63720341del - WDPCP_000046 gene associated with BBS, deletion of exons 2-6, of 18. patient has maculopathy, unsolved PubMed: Zampaglione 2020 - - Unknown ? - - - - DNA SEQ-NG-I, PCRq blood - retinal disease OGI1165_002272 PubMed: Zampaglione 2020 - ? - - - - - - - 1 LOVD
-?/. - c.13T>C r.(?) p.(Phe5Leu) Unknown - likely benign g.63815393A>G g.63588259A>G WDPCP(NM_015910.6):c.13T>C (p.F5L) - MDH1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.33C>T r.(?) p.(Ser11=) Unknown - likely benign g.63815373G>A - WDPCP(NM_015910.6):c.33C>T (p.S11=), WDPCP(NM_015910.7):c.33C>T (p.S11=) - MDH1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.33C>T r.(?) p.(Ser11=) Unknown - likely benign g.63815373G>A - WDPCP(NM_015910.6):c.33C>T (p.S11=), WDPCP(NM_015910.7):c.33C>T (p.S11=) - MDH1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.68C>A r.(?) p.(Pro23Gln) Unknown - likely benign g.63815338G>T g.63588204G>T WDPCP(NM_015910.6):c.68C>A (p.P23Q), WDPCP(NM_015910.7):c.68C>A (p.P23Q) - WDPCP_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.68C>A r.(?) p.(Pro23Gln) Unknown - benign g.63815338G>T g.63588204G>T WDPCP(NM_015910.6):c.68C>A (p.P23Q), WDPCP(NM_015910.7):c.68C>A (p.P23Q) - WDPCP_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.68C>A r.(?) p.(Pro23Gln) Unknown - likely benign g.63815338G>T g.63588204G>T WDPCP(NM_015910.6):c.68C>A (p.P23Q), WDPCP(NM_015910.7):c.68C>A (p.P23Q) - WDPCP_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.75+13C>T r.(=) p.(=) Unknown - likely benign g.63815318G>A g.63588184G>A WDPCP(NM_015910.7):c.75+13C>T - WDPCP_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.76-15T>A r.(=) p.(=) Unknown - likely benign g.63720089A>T g.63492955A>T WDPCP(NM_015910.6):c.76-15T>A, WDPCP(NM_015910.7):c.76-15T>A - WDPCP_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.76-15T>A r.(=) p.(=) Unknown - benign g.63720089A>T g.63492955A>T WDPCP(NM_015910.6):c.76-15T>A, WDPCP(NM_015910.7):c.76-15T>A - WDPCP_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.76-15T>A r.(=) p.(=) Unknown - likely benign g.63720089A>T g.63492955A>T WDPCP(NM_015910.6):c.76-15T>A, WDPCP(NM_015910.7):c.76-15T>A - WDPCP_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.76-1G>T r.spl p.? Both (homozygous) - likely pathogenic g.63720075C>A g.63492941C>A WDPCP c.76-1G>T - WDPCP_000057 homozygous PubMed: Kim 2010 - - Germline yes - - - - DNA ? - - BBS AR248 PubMed: Kim 2010 - M - - - - - - - 1 LOVD
-/. - c.83A>T r.(?) p.(Asp28Val) Unknown - benign g.63720067T>A g.63492933T>A WDPCP(NM_015910.6):c.83A>T (p.D28V), WDPCP(NM_015910.7):c.83A>T (p.D28V) - WDPCP_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.83A>T r.(?) p.(Asp28Val) Unknown - likely benign g.63720067T>A g.63492933T>A WDPCP(NM_015910.6):c.83A>T (p.D28V), WDPCP(NM_015910.7):c.83A>T (p.D28V) - WDPCP_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.83A>T r.(?) p.(Asp28Val) Unknown - likely benign g.63720067T>A - WDPCP(NM_015910.6):c.83A>T (p.D28V), WDPCP(NM_015910.7):c.83A>T (p.D28V) - WDPCP_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.116C>A r.(?) p.(Thr39Asn) Unknown - benign g.63720034G>T g.63492900G>T WDPCP(NM_001354044.1):c.44C>A (p.T15N), WDPCP(NM_015910.7):c.116C>A (p.T39N) - WDPCP_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.116C>A r.(?) p.(Thr39Asn) Unknown - VUS g.63720034G>T - WDPCP(NM_001354044.1):c.44C>A (p.T15N), WDPCP(NM_015910.7):c.116C>A (p.T39N) - WDPCP_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.158C>T r.(?) p.(Ala53Val) Unknown - VUS g.63719992G>A - WDPCP(NM_015910.7):c.158C>T (p.(Ala53Val)) - WDPCP_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.159G>A r.(?) p.(Ala53=) Unknown - likely benign g.63719991C>T g.63492857C>T WDPCP(NM_015910.6):c.159G>A (p.A53=) - WDPCP_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.160G>A r.(?) p.(Asp54Asn) Unknown - pathogenic g.63719990C>T g.63492856C>T WDPCP(NM_015910.6):c.160G>A (p.D54N), WDPCP(NM_015910.7):c.160G>A (p.D54N, p.(Asp54Asn)) - WDPCP_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.160G>A r.(?) p.(Asp54Asn) Unknown - likely pathogenic g.63719990C>T g.63492856C>T WDPCP(NM_015910.6):c.160G>A (p.D54N), WDPCP(NM_015910.7):c.160G>A (p.D54N, p.(Asp54Asn)) - WDPCP_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.160G>A r.(?) p.(Asp54Asn) Unknown - VUS g.63719990C>T - WDPCP(NM_015910.6):c.160G>A (p.D54N), WDPCP(NM_015910.7):c.160G>A (p.D54N, p.(Asp54Asn)) - WDPCP_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.160G>A r.(?) p.(Asp54Asn) Unknown - VUS g.63719990C>T - WDPCP(NM_015910.6):c.160G>A (p.D54N), WDPCP(NM_015910.7):c.160G>A (p.D54N, p.(Asp54Asn)) - WDPCP_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.164G>A r.(?) p.(Arg55Lys) Unknown - VUS g.63714625C>T g.63487491C>T WDPCP R55K - WDPCP_000056 no nucleotide annotation, extrapolated from protein and databases; heterozygous PubMed: Kim 2010 - - Unknown ? - - - - DNA ? - - retinal disease MKS142 PubMed: Kim 2010 - ? - - - - - - - 1 LOVD
?/. - c.172G>A r.(?) p.(Gly58Arg) Unknown - VUS g.63714617C>T g.63487483C>T WDPCP(NM_015910.6):c.172G>A (p.G58R) - WDPCP_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.176T>A r.(?) p.(Ile59Asn) Unknown - likely benign g.63714613A>T g.63487479A>T WDPCP(NM_015910.6):c.176T>A (p.I59N), WDPCP(NM_015910.7):c.176T>A (p.I59N) - WDPCP_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.176T>A r.(?) p.(Ile59Asn) Unknown - likely benign g.63714613A>T g.63487479A>T WDPCP(NM_015910.6):c.176T>A (p.I59N), WDPCP(NM_015910.7):c.176T>A (p.I59N) - WDPCP_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.176T>A r.(?) p.(Ile59Asn) Unknown - likely benign g.63714613A>T g.63487479A>T WDPCP(NM_015910.6):c.176T>A (p.I59N), WDPCP(NM_015910.7):c.176T>A (p.I59N) - WDPCP_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.208+1G>A r.spl? p.? Unknown - likely pathogenic g.63714580C>T - WDPCP(NM_015910.7):c.208+1G>A - WDPCP_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.208+3A>G r.spl? p.? Unknown - VUS g.63714578T>C g.63487444T>C WDPCP(NM_015910.6):c.208+3A>G - WDPCP_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.255A>G r.(?) p.(Ser85=) Unknown - likely benign g.63712120T>C g.63484986T>C WDPCP(NM_015910.6):c.255A>G (p.S85=) - WDPCP_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.385-12A>G r.(=) p.(=) Unknown - benign g.63667017T>C g.63439883T>C WDPCP(NM_015910.7):c.385-12A>G - WDPCP_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.385-3del r.spl? p.? Unknown - likely benign g.63667011del g.63439877del WDPCP(NM_015910.6):c.385-3delT, WDPCP(NM_015910.7):c.385-3delT - WDPCP_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.385-3del r.spl? p.? Unknown - likely benign g.63667011del - WDPCP(NM_015910.6):c.385-3delT, WDPCP(NM_015910.7):c.385-3delT - WDPCP_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.385C>G r.(?) p.(Leu129Val) Unknown - VUS g.63667005G>C g.63439871G>C WDPCP(NM_015910.6):c.385C>G (p.L129V), WDPCP(NM_015910.7):c.385C>G (p.L129V) - WDPCP_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.385C>G r.(?) p.(Leu129Val) Unknown - likely benign g.63667005G>C - WDPCP(NM_015910.6):c.385C>G (p.L129V), WDPCP(NM_015910.7):c.385C>G (p.L129V) - WDPCP_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.499+11C>G r.(=) p.(=) Unknown - likely benign g.63666880G>C - WDPCP(NM_001354044.2):c.427+11C>G - WDPCP_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.499+20A>G r.(=) p.(=) Unknown - benign g.63666871T>C g.63439737T>C WDPCP(NM_015910.6):c.499+20A>G - WDPCP_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.500-322C>T r.(=) p.(=) Unknown - VUS g.63665010G>A g.63437876G>A WDPCP(NM_001042692.3):c.8C>T (p.S3L) - WDPCP_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.541C>T r.(?) p.(Gln181*) Unknown - pathogenic g.63664647G>A - WDPCP(NM_001354044.1):c.469C>T (p.Q157*), WDPCP(NM_015910.7):c.541C>T (p.Q181*) - WDPCP_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.541C>T r.(?) p.(Gln181*) Unknown - pathogenic g.63664647G>A - WDPCP(NM_001354044.1):c.469C>T (p.Q157*), WDPCP(NM_015910.7):c.541C>T (p.Q181*) - WDPCP_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.581A>G r.(?) p.(Glu194Gly) Unknown - likely benign g.63664607T>C g.63437473T>C WDPCP(NM_015910.7):c.581A>G (p.E194G) - WDPCP_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.592G>A r.(?) p.(Val198Ile) Unknown - likely benign g.63664596C>T g.63437462C>T WDPCP(NM_015910.5):c.592G>A (p.(Val198Ile)) - WDPCP_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.624G>T r.(?) p.(Leu208Phe) Unknown - VUS g.63664564C>A g.63437430C>A WDPCP L208F - WDPCP_000055 no nucleotide annotation, extrapolated from protein and databases; heterozygous PubMed: Kim 2010 - - Unknown ? - - - - DNA ? - - BBS AR316 PubMed: Kim 2010 - ? - - - - - - - 1 LOVD
?/. - c.633+1G>A r.spl p.(?) Unknown - VUS g.63664554C>T g.63437420C>T WDPCP c.633+1G>A - WDPCP_000049 unsolved PubMed: Zampaglione 2020 - - Unknown ? - - - - DNA SEQ-NG-I, SEQ blood - retinal disease 121-024 PubMed: Zampaglione 2020 - ? - - - - - - - 1 LOVD
?/. - c.661A>G r.(?) p.(Ile221Val) Unknown - VUS g.63661043T>C g.63433909T>C WDPCP(NM_015910.5):c.661A>G (p.(Ile221Val)) - WDPCP_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.708T>C r.(?) p.(Asp236=) Unknown - likely benign g.63660996A>G - WDPCP(NM_015910.7):c.708T>C (p.D236=) - WDPCP_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.760_786del r.(?) p.(Pro254_Ala262del) Unknown - VUS g.63660921_63660947del g.63433787_63433813del WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...) - WDPCP_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.760_786del r.(?) p.(Pro254_Ala262del) Unknown - VUS g.63660921_63660947del g.63433787_63433813del WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...) - WDPCP_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.760_786del r.(?) p.(Pro254_Ala262del) Unknown - VUS g.63660921_63660947del g.63433787_63433813del WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...) - WDPCP_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.760_786del r.(?) p.(Pro254_Ala262del) Unknown - VUS g.63660921_63660947del - WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...) - WDPCP_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.760_786del r.(?) p.(Pro254_Ala262del) Unknown - VUS g.63660921_63660947del - WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...) - WDPCP_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.802G>A r.(?) p.(Gly268Ser) Unknown - benign g.63660902C>T g.63433768C>T WDPCP(NM_015910.6):c.802G>A (p.G268S) - WDPCP_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.826-8C>A r.(=) p.(=) Unknown - benign g.63631800G>T g.63404665G>T WDPCP(NM_015910.7):c.826-8C>A - WDPCP_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.841C>T r.(?) p.(Arg281Cys) Unknown - VUS g.63631777G>A - WDPCP(NM_001354044.1):c.769C>T (p.R257C) - WDPCP_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 10 c.842G>A r.(?) p.(Arg281His) Unknown - VUS g.63631776C>T g.63404641C>T G842A - WDPCP_000045 - PubMed: Katagiri 2014 - - Germline - - - - - DNA SEQ-NG-I - - retinal disease - PubMed: Katagiri 2014 index patient M no Japan Japanese - - - - 1 Rob W.J. Collin
-?/. - c.869G>A r.(?) p.(Arg290His) Unknown - likely benign g.63631749C>T g.63404614C>T WDPCP(NM_015910.7):c.869G>A (p.R290H) - WDPCP_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.878C>G r.(?) p.(Thr293Ser) Unknown - likely benign g.63631740G>C - WDPCP(NM_001354044.1):c.806C>G (p.T269S) - WDPCP_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 10 c.985G>A r.(?) p.(Val329Met) Unknown - VUS g.63631633C>T - WDPCP/BBS15:p.[V329M];= - WDPCP_000048 normal 2nd chromosome PubMed: Redin-2012 - - Germline - - - - - DNA arrayCNV, SEQ blood - retinal disease - PubMed: Redin-2012 - - - France - - - - - 1 LOVD
+?/. - c.1032C>A r.(?) p.(Cys344*) Both (homozygous) ACMG likely pathogenic g.63631586G>T g.63404451G>T WDPCP, c.1032C>A, p.Cys344*, Triallelism - WDPCP_000050 - PubMed: Perea-Romero 2021 - - Unknown ? - - - - DNA ? - clinical exome sequencing retinal disease RP-2966 PubMed: Perea-Romero 2021 - - - Spain - - - - - 1 LOVD
?/. - c.1079C>T r.(?) p.(Ser360Leu) Parent #1 - VUS g.63631539G>A g.63404404G>A - - WDPCP_000042 2 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs141011629 Germline - 2/2794 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 2 Mohammed Faruq
?/. - c.1079C>T r.(?) p.(Ser360Leu) Unknown - VUS g.63631539G>A - WDPCP(NM_015910.7):c.1079C>T (p.(Ser360Leu)) - WDPCP_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1094A>G r.(?) p.(Glu365Gly) Unknown - VUS g.63631524T>C - WDPCP(NM_015910.7):c.1094A>G (p.(Glu365Gly)) - WDPCP_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1103G>A r.(?) p.(Arg368His) Unknown - VUS g.63631515C>T - WDPCP(NM_015910.7):c.1103G>A (p.R368H) - WDPCP_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1194A>G r.(?) p.(Gln398=) Unknown - likely benign g.63631424T>C g.63404289T>C WDPCP(NM_015910.6):c.1194A>G (p.Q398=) - WDPCP_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1228C>T r.(?) p.(Pro410Ser) Unknown - VUS g.63631390G>A - WDPCP(NM_015910.7):c.1228C>T (p.P410S) - WDPCP_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1263A>C r.(?) p.(Leu421Phe) Unknown - likely benign g.63631355T>G - WDPCP(NM_015910.7):c.1263A>C (p.L421F) - WDPCP_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1275T>G r.(?) p.(Thr425=) Unknown - benign g.63631343A>C g.63404208A>C WDPCP(NM_001354044.1):c.1203T>G (p.T401=), WDPCP(NM_015910.7):c.1275T>G (p.T425=) - WDPCP_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1275T>G r.(?) p.(Thr425=) Unknown - likely benign g.63631343A>C - WDPCP(NM_001354044.1):c.1203T>G (p.T401=), WDPCP(NM_015910.7):c.1275T>G (p.T425=) - WDPCP_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1304C>A r.(?) p.(Ser435Tyr) Unknown - VUS g.63631314G>T g.63404179G>T WDPCP(NM_015910.5):c.1304C>A (p.(Ser435Tyr)) - WDPCP_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1310G>T r.(?) p.(Ser437Ile) Unknown - likely benign g.63631308C>A g.63404173C>A WDPCP(NM_001354044.1):c.1238G>T (p.S413I), WDPCP(NM_015910.5):c.1310G>T (p.(Ser437Ile)), WDPCP(NM_015910.7):c.1310G>T (p.S437I) - WDPCP_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1310G>T r.(?) p.(Ser437Ile) Unknown - likely benign g.63631308C>A - WDPCP(NM_001354044.1):c.1238G>T (p.S413I), WDPCP(NM_015910.5):c.1310G>T (p.(Ser437Ile)), WDPCP(NM_015910.7):c.1310G>T (p.S437I) - WDPCP_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1310G>T r.(?) p.(Ser437Ile) Unknown - likely benign g.63631308C>A - WDPCP(NM_001354044.1):c.1238G>T (p.S413I), WDPCP(NM_015910.5):c.1310G>T (p.(Ser437Ile)), WDPCP(NM_015910.7):c.1310G>T (p.S437I) - WDPCP_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1315G>A r.(?) p.(Val439Ile) Unknown - VUS g.63631303C>T g.63404168C>T WDPCP(NM_015910.6):c.1315G>A (p.V439I), WDPCP(NM_015910.7):c.1315G>A (p.V439I) - WDPCP_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1315G>A r.(?) p.(Val439Ile) Unknown - likely benign g.63631303C>T g.63404168C>T WDPCP(NM_015910.6):c.1315G>A (p.V439I), WDPCP(NM_015910.7):c.1315G>A (p.V439I) - WDPCP_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1315G>A r.(?) p.(Val439Ile) Unknown - likely benign g.63631303C>T - WDPCP(NM_015910.6):c.1315G>A (p.V439I), WDPCP(NM_015910.7):c.1315G>A (p.V439I) - WDPCP_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1333G>C r.(?) p.(Ala445Pro) Unknown - benign g.63631285C>G g.63404150C>G WDPCP(NM_015910.6):c.1333G>C (p.A445P), WDPCP(NM_015910.7):c.1333G>C (p.A445P) - WDPCP_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1333G>C r.(?) p.(Ala445Pro) Unknown - VUS g.63631285C>G - WDPCP(NM_015910.6):c.1333G>C (p.A445P), WDPCP(NM_015910.7):c.1333G>C (p.A445P) - WDPCP_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1379A>T r.(?) p.(Asp460Val) Unknown - VUS g.63631239T>A g.63404104T>A WDPCP(NM_015910.7):c.1379A>T (p.D460V) - WDPCP_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1436-3T>C r.spl? p.? Unknown - likely benign g.63609232A>G - WDPCP(NM_001042692.2):c.959-3T>C (p.?) - WDPCP_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1448G>A r.(?) p.(Arg483Gln) Unknown - benign g.63609217C>T g.63382082C>T WDPCP(NM_015910.6):c.1448G>A (p.R483Q), WDPCP(NM_015910.7):c.1448G>A (p.R483Q) - WDPCP_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1448G>A r.(?) p.(Arg483Gln) Unknown - likely benign g.63609217C>T g.63382082C>T WDPCP(NM_015910.6):c.1448G>A (p.R483Q), WDPCP(NM_015910.7):c.1448G>A (p.R483Q) - WDPCP_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1600C>A r.(?) p.(Gln534Lys) Unknown - VUS g.63609065G>T g.63381930G>T WDPCP(NM_001354044.1):c.1528C>A (p.Q510K), WDPCP(NM_015910.7):c.1600C>A (p.Q534K) - WDPCP_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1600C>A r.(?) p.(Gln534Lys) Unknown - VUS g.63609065G>T - WDPCP(NM_001354044.1):c.1528C>A (p.Q510K), WDPCP(NM_015910.7):c.1600C>A (p.Q534K) - WDPCP_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1734C>G r.(?) p.(Phe578Leu) Unknown - VUS g.63605535G>C g.63378400G>C WDPCP(NM_015910.6):c.1734C>G (p.F578L) - WDPCP_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1788C>T r.(?) p.(Asp596=) Unknown - likely benign g.63540407G>A - WDPCP(NM_015910.7):c.1788C>T (p.D596=) - WDPCP_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1888G>A r.(?) p.(Asp630Asn) Unknown - VUS g.63486469C>T - WDPCP(NM_001354044.1):c.1816G>A (p.D606N) - WDPCP_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1915+13G>A r.(=) p.(=) Unknown - benign g.63486429C>T g.63259294C>T WDPCP(NM_015910.6):c.1915+13G>A, WDPCP(NM_015910.7):c.1915+13G>A - WDPCP_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1915+13G>A r.(=) p.(=) Unknown - benign g.63486429C>T g.63259294C>T WDPCP(NM_015910.6):c.1915+13G>A, WDPCP(NM_015910.7):c.1915+13G>A - WDPCP_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1915+13G>A r.(=) p.(=) Unknown - benign g.63486429C>T g.63259294C>T WDPCP(NM_015910.6):c.1915+13G>A, WDPCP(NM_015910.7):c.1915+13G>A - WDPCP_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1916-6C>T r.(=) p.(=) Unknown - benign g.63401973G>A g.63174838G>A WDPCP(NM_015910.6):c.1916-6C>T - WDPCP_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1916-6C>T r.(=) p.(=) Unknown - benign g.63401973G>A g.63174838G>A WDPCP(NM_015910.6):c.1916-6C>T - WDPCP_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2063A>G r.(?) p.(Asn688Ser) Unknown - benign g.63401820T>C g.63174685T>C WDPCP(NM_015910.6):c.2063A>G (p.N688S), WDPCP(NM_015910.7):c.2063A>G (p.N688S) - WDPCP_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2063A>G r.(?) p.(Asn688Ser) Unknown - likely benign g.63401820T>C g.63174685T>C WDPCP(NM_015910.6):c.2063A>G (p.N688S), WDPCP(NM_015910.7):c.2063A>G (p.N688S) - WDPCP_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query   « First ‹ Prev     1 2     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.