collagen, type II, alpha 1 (COL2A1) - coding DNA reference sequence

(used for variant description)

(last modified November 16, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_001844.4 in the COL2A1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008072.1, covering COL2A1 transcript NM_001844.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5001
                                                            a       c.-181

 .         .         .         .         .         .                g.5061
 acgggcgccgcggcggggagaagacgcagagcgctgctgggctgccgggtctcccgcttc       c.-121

 .         .         .         .         .         .                g.5121
 cccctcctgctccaagggcctcctgcatgagggcgcggtagagacccggacccgcgccgt       c.-61

 .         .         .         .         .         .                g.5181
 gctcctgccgtttcgctgcgctccgcccgggcccggctcagccaggccccgcggtgagcc       c.-1

          .         .         .         .         .         .       g.5241
 ATGATTCGCCTCGGGGCTCCCCAGACGCTGGTGCTGCTGACGCTGCTCGTCGCCGCTGTC       c.60
 M  I  R  L  G  A  P  Q  T  L  V  L  L  T  L  L  V  A  A  V         p.20

          .         .      | 02  .         .         .         .    g.9412
 CTTCGGTGTCAGGGCCAGGATGTCC | AGGAGGCTGGCAGCTGTGTGCAGGATGGGCAGAGG    c.120
 L  R  C  Q  G  Q  D  V  Q |   E  A  G  S  C  V  Q  D  G  Q  R      p.40

          .         .         .         .         .         .       g.9472
 TATAATGATAAGGATGTGTGGAAGCCGGAGCCCTGCCGGATCTGTGTCTGTGACACTGGG       c.180
 Y  N  D  K  D  V  W  K  P  E  P  C  R  I  C  V  C  D  T  G         p.60

          .         .         .         .         .         .       g.9532
 ACTGTCCTCTGCGACGACATAATCTGTGAAGACGTGAAAGACTGCCTCAGCCCTGAGATC       c.240
 T  V  L  C  D  D  I  I  C  E  D  V  K  D  C  L  S  P  E  I         p.80

          .         .         .         .         .   | 03     .    g.11079
 CCCTTCGGAGAGTGCTGCCCCATCTGCCCAACTGACCTCGCCACTGCCAGTG | GGCAACCA    c.300
 P  F  G  E  C  C  P  I  C  P  T  D  L  A  T  A  S  G |   Q  P      p.100

           | 04        .         .         .   | 05     .         . g.11456
 GGACCAAAG | GGACAGAAAGGAGAACCTGGAGACATCAAGGAT | ATTGTAGGACCCAAAGGA c.360
 G  P  K   | G  Q  K  G  E  P  G  D  I  K  D   | I  V  G  P  K  G   p.120

          .      | 06  .         .         .         .         .    g.11623
 CCTCCTGGGCCTCAG | GGACCTGCAGGGGAACAAGGACCCAGAGGGGATCGTGGTGACAAA    c.420
 P  P  G  P  Q   | G  P  A  G  E  Q  G  P  R  G  D  R  G  D  K      p.140

           | 07        .         .         .         .         .    g.11846
 GGTGAAAAA | GGTGCCCCTGGACCTCGTGGCAGAGATGGAGAACCTGGGACCCCTGGAAAT    c.480
 G  E  K   | G  A  P  G  P  R  G  R  D  G  E  P  G  T  P  G  N      p.160

          .         .         .         .         .  | 08      .    g.12886
 CCTGGCCCCCCTGGTCCTCCCGGCCCCCCTGGTCCCCCTGGTCTTGGTGGA | AACTTTGCT    c.540
 P  G  P  P  G  P  P  G  P  P  G  P  P  G  L  G  G   | N  F  A      p.180

          .         .         .         .         .         .       g.12946
 GCCCAGATGGCTGGAGGATTTGATGAAAAGGCTGGTGGCGCCCAGTTGGGAGTAATGCAA       c.600
 A  Q  M  A  G  G  F  D  E  K  A  G  G  A  Q  L  G  V  M  Q         p.200

           | 09        .         .         .         .     | 10   . g.13745
 GGACCAATG | GGCCCCATGGGACCTCGAGGACCTCCAGGCCCTGCAGGTGCTCCT | GGGCCT c.660
 G  P  M   | G  P  M  G  P  R  G  P  P  G  P  A  G  A  P   | G  P   p.220

          .         .         .         .         | 11         .    g.14206
 CAAGGATTTCAAGGCAATCCTGGTGAACCTGGTGAACCTGGTGTCTCT | GGTCCCATGGGT    c.720
 Q  G  F  Q  G  N  P  G  E  P  G  E  P  G  V  S   | G  P  M  G      p.240

          .         .         .         .   | 12     .         .    g.15043
 CCCCGTGGTCCTCCTGGTCCCCCTGGAAAGCCTGGTGATGAT | GGTGAAGCTGGAAAACCT    c.780
 P  R  G  P  P  G  P  P  G  K  P  G  D  D   | G  E  A  G  K  P      p.260

          .         .         .       | 13 .         .         .    g.15479
 GGAAAAGCTGGTGAAAGGGGTCCGCCTGGTCCTCAG | GGTGCTCGTGGTTTCCCAGGAACC    c.840
 G  K  A  G  E  R  G  P  P  G  P  Q   | G  A  R  G  F  P  G  T      p.280

          .         .         . | 14       .         .         .    g.15670
 CCAGGCCTTCCTGGTGTCAAAGGTCACAGA | GGTTATCCAGGCCTGGACGGTGCTAAGGGA    c.900
 P  G  L  P  G  V  K  G  H  R   | G  Y  P  G  L  D  G  A  K  G      p.300

          .         .     | 15   .         .         .         .    g.16036
 GAGGCGGGTGCTCCTGGTGTGAAG | GGTGAGAGTGGTTCCCCGGGTGAGAACGGATCTCCG    c.960
 E  A  G  A  P  G  V  K   | G  E  S  G  S  P  G  E  N  G  S  P      p.320

           | 16        .         .         .         .         .    g.16622
 GGCCCAATG | GGTCCTCGTGGCCTGCCTGGTGAAAGAGGACGGACTGGCCCTGCTGGCGCT    c.1020
 G  P  M   | G  P  R  G  L  P  G  E  R  G  R  T  G  P  A  G  A      p.340

     | 17    .         .         .         .         | 18         . g.20233
 GCG | GGTGCCCGAGGCAACGATGGTCAGCCAGGCCCCGCAGGGCCTCCG | GGTCCTGTCGGT c.1080
 A   | G  A  R  G  N  D  G  Q  P  G  P  A  G  P  P   | G  P  V  G   p.360

          .         .         .         .   | 19     .         .    g.21811
 CCTGCTGGTGGTCCTGGCTTCCCTGGTGCTCCTGGAGCCAAG | GGTGAAGCCGGCCCCACT    c.1140
 P  A  G  G  P  G  F  P  G  A  P  G  A  K   | G  E  A  G  P  T      p.380

          .         .         .         .         .         .       g.21871
 GGTGCCCGTGGTCCTGAAGGTGCTCAAGGTCCTCGCGGTGAACCTGGTACTCCTGGGTCC       c.1200
 G  A  R  G  P  E  G  A  Q  G  P  R  G  E  P  G  T  P  G  S         p.400

          .         .  | 20      .         .         .         .    g.22228
 CCTGGGCCTGCTGGTGCCTCC | GGTAACCCTGGAACAGATGGAATTCCTGGAGCCAAAGGA    c.1260
 P  G  P  A  G  A  S   | G  N  P  G  T  D  G  I  P  G  A  K  G      p.420

        | 21 .         .         .         .         .         .    g.22380
 TCTGCT | GGTGCTCCTGGCATTGCTGGTGCTCCTGGCTTCCCTGGGCCACGGGGCCCTCCT    c.1320
 S  A   | G  A  P  G  I  A  G  A  P  G  F  P  G  P  R  G  P  P      p.440

          .         .         .         .      | 22  .         .    g.22629
 GGCCCTCAAGGTGCAACTGGTCCTCTGGGCCCGAAAGGTCAGACG | GGTGAACCTGGTATT    c.1380
 G  P  Q  G  A  T  G  P  L  G  P  K  G  Q  T   | G  E  P  G  I      p.460

          .         .         .          | 23        .         .    g.23080
 GCTGGCTTCAAAGGTGAACAAGGCCCCAAGGGAGAACCT | GGCCCTGCTGGCCCCCAGGGA    c.1440
 A  G  F  K  G  E  Q  G  P  K  G  E  P   | G  P  A  G  P  Q  G      p.480

          .         .         .         .         .         .       g.23140
 GCCCCTGGACCCGCTGGTGAAGAAGGCAAGAGAGGTGCCCGTGGAGAGCCTGGTGGCGTT       c.1500
 A  P  G  P  A  G  E  E  G  K  R  G  A  R  G  E  P  G  G  V         p.500

          .         .        | 24.         .         .         .    g.23570
 GGGCCCATCGGTCCCCCTGGAGAAAGA | GGTGCTCCCGGCAACCGCGGTTTCCCAGGTCAA    c.1560
 G  P  I  G  P  P  G  E  R   | G  A  P  G  N  R  G  F  P  G  Q      p.520

          .         .  | 25      .         .         .         .    g.23715
 GATGGTCTGGCAGGTCCCAAG | GGAGCCCCTGGAGAGCGAGGGCCCAGTGGTCTTGCTGGC    c.1620
 D  G  L  A  G  P  K   | G  A  P  G  E  R  G  P  S  G  L  A  G      p.540

          .         .         .         .         .         .       g.23775
 CCCAAGGGAGCCAACGGTGACCCTGGCCGTCCTGGAGAACCTGGCCTTCCTGGAGCCCGG       c.1680
 P  K  G  A  N  G  D  P  G  R  P  G  E  P  G  L  P  G  A  R         p.560

  | 26       .         .         .         .         .     | 27   . g.24415
  | GGTCTCACTGGCCGCCCTGGTGATGCTGGTCCTCAAGGCAAAGTTGGCCCTTCT | GGAGCC c.1740
  | G  L  T  G  R  P  G  D  A  G  P  Q  G  K  V  G  P  S   | G  A   p.580

          .         .         .         .         .         .       g.24475
 CCTGGTGAAGATGGTCGTCCTGGACCTCCAGGTCCTCAGGGGGCTCGTGGGCAGCCTGGT       c.1800
 P  G  E  D  G  R  P  G  P  P  G  P  Q  G  A  R  G  Q  P  G         p.600

          .         .         .    | 28    .         .         .    g.24930
 GTCATGGGTTTCCCTGGCCCCAAAGGTGCCAAC | GGTGAGCCTGGCAAAGCTGGTGAGAAG    c.1860
 V  M  G  F  P  G  P  K  G  A  N   | G  E  P  G  K  A  G  E  K      p.620

          .         .        | 29.         .         .         .    g.25395
 GGACTGCCTGGTGCTCCTGGTCTGAGG | GGTCTTCCTGGCAAAGATGGTGAGACAGGTGCT    c.1920
 G  L  P  G  A  P  G  L  R   | G  L  P  G  K  D  G  E  T  G  A      p.640

          .         .  | 30      .         .         .         .    g.25805
 GCAGGACCCCCTGGCCCTGCT | GGACCTGCTGGTGAACGAGGCGAGCAGGGTGCTCCTGGG    c.1980
 A  G  P  P  G  P  A   | G  P  A  G  E  R  G  E  Q  G  A  P  G      p.660

          .      | 31  .         .         .         .         .    g.26109
 CCATCTGGGTTCCAG | GGACTTCCTGGCCCTCCTGGTCCCCCAGGTGAAGGTGGAAAACCA    c.2040
 P  S  G  F  Q   | G  L  P  G  P  P  G  P  P  G  E  G  G  K  P      p.680

           | 32        .         .         .         .     | 33   . g.26562
 GGTGACCAG | GGTGTTCCCGGTGAAGCTGGAGCCCCTGGCCTCGTGGGTCCCAGG | GGTGAA c.2100
 G  D  Q   | G  V  P  G  E  A  G  A  P  G  L  V  G  P  R   | G  E   p.700

          .         .         .         .         .         .       g.26622
 CGAGGTTTCCCAGGTGAACGTGGCTCTCCCGGTGCCCAGGGCCTCCAGGGTCCCCGTGGC       c.2160
 R  G  F  P  G  E  R  G  S  P  G  A  Q  G  L  Q  G  P  R  G         p.720

          .         .         .    | 34    .         .         .    g.26920
 CTCCCCGGCACTCCTGGCACTGATGGTCCCAAA | GGTGCATCTGGCCCAGCAGGCCCCCCT    c.2220
 L  P  G  T  P  G  T  D  G  P  K   | G  A  S  G  P  A  G  P  P      p.740

          .         .         .         .         .         .       g.26980
 GGGGCTCAGGGCCCTCCAGGTCTTCAGGGAATGCCTGGCGAGAGGGGAGCAGCTGGTATC       c.2280
 G  A  Q  G  P  P  G  L  Q  G  M  P  G  E  R  G  A  A  G  I         p.760

          .         .  | 35      .         .         .         .    g.27381
 GCTGGGCCCAAAGGCGACAGG | GGTGACGTTGGTGAGAAAGGCCCTGAGGGAGCCCCTGGA    c.2340
 A  G  P  K  G  D  R   | G  D  V  G  E  K  G  P  E  G  A  P  G      p.780

          .      | 36  .         .         .         .         .    g.27718
 AAGGATGGTGGACGA | GGCCTGACAGGTCCCATTGGCCCCCCTGGCCCAGCTGGTGCTAAT    c.2400
 K  D  G  G  R   | G  L  T  G  P  I  G  P  P  G  P  A  G  A  N      p.800

           | 37        .         .         .         .         .    g.28157
 GGCGAGAAG | GGAGAAGTTGGACCTCCTGGTCCTGCAGGAAGTGCTGGTGCTCGTGGCGCT    c.2460
 G  E  K   | G  E  V  G  P  P  G  P  A  G  S  A  G  A  R  G  A      p.820

     | 38    .         .         .         .         .        | 39. g.28844
 CCG | GGTGAACGTGGAGAGACTGGGCCCCCCGGACCAGCGGGATTTGCTGGGCCTCCT | GGT c.2520
 P   | G  E  R  G  E  T  G  P  P  G  P  A  G  F  A  G  P  P   | G   p.840

          .         .         .         .         .         .       g.28904
 GCTGATGGCCAGCCTGGGGCCAAGGGTGAGCAAGGAGAGGCCGGCCAGAAAGGCGATGCT       c.2580
 A  D  G  Q  P  G  A  K  G  E  Q  G  E  A  G  Q  K  G  D  A         p.860

          .         .         .         .      | 40  .         .    g.29455
 GGTGCCCCTGGTCCTCAGGGCCCCTCTGGAGCACCTGGGCCTCAG | GGTCCTACTGGAGTG    c.2640
 G  A  P  G  P  Q  G  P  S  G  A  P  G  P  Q   | G  P  T  G  V      p.880

          .         .         .          | 41        .         .    g.29959
 ACTGGTCCTAAAGGAGCCCGAGGTGCCCAAGGCCCCCCG | GGAGCCACTGGATTCCCTGGA    c.2700
 T  G  P  K  G  A  R  G  A  Q  G  P  P   | G  A  T  G  F  P  G      p.900

          .         .         .    | 42    .         .         .    g.30771
 GCTGCTGGCCGCGTTGGACCCCCAGGCTCCAAT | GGCAACCCTGGACCCCCTGGTCCCCCT    c.2760
 A  A  G  R  V  G  P  P  G  S  N   | G  N  P  G  P  P  G  P  P      p.920

          .         .         .         .         .         .       g.30831
 GGTCCTTCTGGAAAAGATGGTCCCAAAGGTGCTCGAGGAGACAGCGGCCCCCCTGGCCGA       c.2820
 G  P  S  G  K  D  G  P  K  G  A  R  G  D  S  G  P  P  G  R         p.940

          .         .         .         .         .         .       g.30891
 GCTGGTGAACCCGGCCTCCAAGGTCCTGCTGGACCCCCTGGCGAGAAGGGAGAGCCTGGA       c.2880
 A  G  E  P  G  L  Q  G  P  A  G  P  P  G  E  K  G  E  P  G         p.960

          .      | 43  .         .         .         .         .    g.31149
 GATGACGGTCCCTCT | GGTGCCGAAGGTCCACCAGGTCCCCAGGGTCTGGCTGGTCAGAGA    c.2940
 D  D  G  P  S   | G  A  E  G  P  P  G  P  Q  G  L  A  G  Q  R      p.980

          .         .         .         .         .         .       g.31209
 GGCATCGTCGGTCTGCCTGGGCAACGTGGTGAGAGAGGATTCCCTGGCTTGCCTGGCCCG       c.3000
 G  I  V  G  L  P  G  Q  R  G  E  R  G  F  P  G  L  P  G  P         p.1000

     | 44    .         .         .         .         .         .    g.31442
 TCG | GGTGAGCCCGGCAAGCAGGGTGCTCCTGGAGCATCTGGAGACAGAGGTCCTCCTGGC    c.3060
 S   | G  E  P  G  K  Q  G  A  P  G  A  S  G  D  R  G  P  P  G      p.1020

          .         .         .         .         .  | 45      .    g.31858
 CCCGTGGGTCCTCCTGGCCTGACGGGTCCTGCAGGTGAACCTGGACGAGAG | GGAAGCCCC    c.3120
 P  V  G  P  P  G  L  T  G  P  A  G  E  P  G  R  E   | G  S  P      p.1040

          .         .         .         .      | 46  .         .    g.32090
 GGTGCTGATGGCCCCCCTGGCAGAGATGGCGCTGCTGGAGTCAAG | GGTGATCGTGGTGAG    c.3180
 G  A  D  G  P  P  G  R  D  G  A  A  G  V  K   | G  D  R  G  E      p.1060

          .         .         .         .         .         .       g.32150
 ACTGGTGCTGTGGGAGCTCCTGGAGCCCCTGGGCCCCCTGGCTCCCCTGGCCCCGCTGGT       c.3240
 T  G  A  V  G  A  P  G  A  P  G  P  P  G  S  P  G  P  A  G         p.1080

          .         .         .    | 47    .         .         .    g.32374
 CCAACTGGCAAGCAAGGAGACAGAGGAGAAGCT | GGTGCACAAGGCCCCATGGGACCCTCA    c.3300
 P  T  G  K  Q  G  D  R  G  E  A   | G  A  Q  G  P  M  G  P  S      p.1100

          .         .        | 48.         .         .         .    g.32616
 GGACCAGCTGGAGCCCGGGGAATCCAG | GGTCCTCAAGGCCCCAGAGGTGACAAAGGAGAG    c.3360
 G  P  A  G  A  R  G  I  Q   | G  P  Q  G  P  R  G  D  K  G  E      p.1120

          .         .         .         .         .         .       g.32676
 GCTGGAGAGCCTGGCGAGAGAGGCCTGAAGGGACACCGTGGCTTCACTGGTCTGCAGGGT       c.3420
 A  G  E  P  G  E  R  G  L  K  G  H  R  G  F  T  G  L  Q  G         p.1140

          .      | 49  .         .         .         .         .    g.32980
 CTGCCCGGCCCTCCT | GGTCCTTCTGGAGACCAAGGTGCTTCTGGTCCTGCTGGTCCTTCT    c.3480
 L  P  G  P  P   | G  P  S  G  D  Q  G  A  S  G  P  A  G  P  S      p.1160

           | 50        .         .         .         .         .    g.33483
 GGCCCTAGA | GGTCCTCCTGGCCCCGTCGGTCCCTCTGGCAAAGATGGTGCTAATGGAATC    c.3540
 G  P  R   | G  P  P  G  P  V  G  P  S  G  K  D  G  A  N  G  I      p.1180

          .         .         .         .         .        | 51.    g.33900
 CCTGGCCCCATTGGGCCTCCTGGTCCCCGTGGACGATCAGGCGAAACCGGCCCTGCT | GGT    c.3600
 P  G  P  I  G  P  P  G  P  R  G  R  S  G  E  T  G  P  A   | G      p.1200

          .         .         .         .         .         .       g.33960
 CCTCCTGGAAATCCTGGACCCCCTGGTCCTCCAGGTCCCCCTGGCCCTGGCATCGACATG       c.3660
 P  P  G  N  P  G  P  P  G  P  P  G  P  P  G  P  G  I  D  M         p.1220

          .         .         .         .         .         .       g.34020
 TCCGCCTTTGCTGGCTTAGGCCCGAGAGAGAAGGGCCCCGACCCCCTGCAGTACATGCGG       c.3720
 S  A  F  A  G  L  G  P  R  E  K  G  P  D  P  L  Q  Y  M  R         p.1240

          .         .         .         .         .         .       g.34080
 GCCGACCAGGCAGCCGGTGGCCTGAGACAGCATGACGCCGAGGTGGATGCCACACTCAAG       c.3780
 A  D  Q  A  A  G  G  L  R  Q  H  D  A  E  V  D  A  T  L  K         p.1260

          .         .         .         .         .         .       g.34140
 TCCCTCAACAACCAGATTGAGAGCATCCGCAGCCCCGAGGGCTCCCGCAAGAACCCTGCT       c.3840
 S  L  N  N  Q  I  E  S  I  R  S  P  E  G  S  R  K  N  P  A         p.1280

          .         .         .         .       | 52 .         .    g.34654
 CGCACCTGCAGAGACCTGAAACTCTGCCACCCTGAGTGGAAGAGTG | GAGACTACTGGATT    c.3900
 R  T  C  R  D  L  K  L  C  H  P  E  W  K  S  G |   D  Y  W  I      p.1300

          .         .         .         .         .         .       g.34714
 GACCCCAACCAAGGCTGCACCTTGGACGCCATGAAGGTTTTCTGCAACATGGAGACTGGC       c.3960
 D  P  N  Q  G  C  T  L  D  A  M  K  V  F  C  N  M  E  T  G         p.1320

          .         .         .         .         .         .       g.34774
 GAGACTTGCGTCTACCCCAATCCAGCAAACGTTCCCAAGAAGAACTGGTGGAGCAGCAAG       c.4020
 E  T  C  V  Y  P  N  P  A  N  V  P  K  K  N  W  W  S  S  K         p.1340

          .         .         .         .         .     | 53   .    g.35177
 AGCAAGGAGAAGAAACACATCTGGTTTGGAGAAACCATCAATGGTGGCTTCCAT | TTCAGC    c.4080
 S  K  E  K  K  H  I  W  F  G  E  T  I  N  G  G  F  H   | F  S      p.1360

          .         .         .         .         .         .       g.35237
 TATGGAGATGACAATCTGGCTCCCAACACTGCCAACGTCCAGATGACCTTCCTACGCCTG       c.4140
 Y  G  D  D  N  L  A  P  N  T  A  N  V  Q  M  T  F  L  R  L         p.1380

          .         .         .         .         .         .       g.35297
 CTGTCCACGGAAGGCTCCCAGAACATCACCTACCACTGCAAGAACAGCATTGCCTATCTG       c.4200
 L  S  T  E  G  S  Q  N  I  T  Y  H  C  K  N  S  I  A  Y  L         p.1400

          .         .         .         .         .         .       g.35357
 GACGAAGCAGCTGGCAACCTCAAGAAGGCCCTGCTCATCCAGGGCTCCAATGACGTGGAG       c.4260
 D  E  A  A  G  N  L  K  K  A  L  L  I  Q  G  S  N  D  V  E         p.1420

          .         .         .         .         .        | 54.    g.35952
 ATCCGGGCAGAGGGCAATAGCAGGTTCACGTACACTGCCCTGAAGGATGGCTGCACG | AAA    c.4320
 I  R  A  E  G  N  S  R  F  T  Y  T  A  L  K  D  G  C  T   | K      p.1440

          .         .         .         .         .         .       g.36012
 CATACCGGTAAGTGGGGCAAGACTGTTATCGAGTACCGGTCACAGAAGACCTCACGCCTC       c.4380
 H  T  G  K  W  G  K  T  V  I  E  Y  R  S  Q  K  T  S  R  L         p.1460

          .         .         .         .         .         .       g.36072
 CCCATCATTGACATTGCACCCATGGACATAGGAGGGCCCGAGCAGGAATTCGGTGTGGAC       c.4440
 P  I  I  D  I  A  P  M  D  I  G  G  P  E  Q  E  F  G  V  D         p.1480

          .         .                                               g.36096
 ATAGGGCCGGTCTGCTTCTTGTAA                                           c.4464
 I  G  P  V  C  F  L  X                                             p.1487

          .         .         .         .         .         .       g.36156
 aaacctgaacccagaaacaacacaatccgttgcaaacccaaaggacccaagtactttcca       c.*60

          .         .         .         .         .         .       g.36216
 atctcagtcactctaggactctgcactgaatggctgacctgacctgatgtccattcatcc       c.*120

          .         .         .         .         .         .       g.36276
 caccctctcacagttcggacttttctcccctctctttctaagagacctgaactgggcaga       c.*180

          .         .         .         .         .         .       g.36336
 ctgcaaaataaaatctcggtgttctatttatttattgtcttcctgtaagaccttcgggtc       c.*240

          .         .         .         .         .         .       g.36396
 aaggcagaggcaggaaactaactggtgtgagtcaaatgccccctgagtgactgcccccag       c.*300

          .         .         .         .         .         .       g.36456
 cccaggccagaagacctcccttcaggtgccgggcgcaggaactgtgtgtgtcctacacaa       c.*360

          .         .         .         .         .         .       g.36516
 tggtgctattctgtgtcaaacacctctgtattttttaaaacatcaattgatattaaaaat       c.*420

          .         .                                               g.36538
 gaaaagattattggaaagtaca                                             c.*442

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Collagen, type II, alpha 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2014 Leiden University Medical Center