Unique variants in the ABHD12 gene

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_001042472.2 transcript reference sequence.

76 entries on 1 page. Showing entries 1 - 76.
Legend   How to query  




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+/. 1 _1_1i c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166] r.0? p.0? - pathogenic g.25340671_25399883delins[25390635_25390697;AAGAAACTTAACTTAACCCAACACTTAACTTAAC] g.25360035_25419247delins[25409999_25410061;AAGAAACTTAACTTAACCCAACACTTAACTTAAC] 1-192_oGINS1:c.327+1052del - ABHD12_000005 59 kb deletion PubMed: Chen 2013 - - Germline yes - - - - Dong-Hui Chen
+/. 3 _1_1i c.-6920_191+6897del r.0? p.0? - pathogenic g.25364252_25378259del g.25383616_25397623del 14 bb del removing exon 1, 14 kb del removing exon 1 - ABHD12_000002 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Germline - - - - - Jacopo Celli
-/. 1 - c.-40_-39insGGCGGAGGC r.(?) p.(=) - benign g.25371382_25371383insCCGCCGCCT g.25390746_25390747insCCGCCGCCT - - ABHD12_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 2 - c.103C>T r.(?) p.(Arg35Cys) - VUS g.25371237G>A g.25390601G>A ABHD12(NM_001042472.3):c.103C>T (p.R35C) - ABHD12_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.129G>A r.(?) p.(Thr43=) - likely benign g.25371211C>T g.25390575C>T ABHD12(NM_001042472.3):c.129G>A (p.T43=) - ABHD12_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.135G>A r.(?) p.(Pro45=) - likely benign g.25371205C>T g.25390569C>T ABHD12(NM_001042472.3):c.135G>A (p.P45=) - PYGB_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.182C>A r.(?) p.(Ala61Glu) - VUS g.25371158G>T g.25390522G>T ABHD12(NM_001042472.3):c.182C>A (p.A61E) - ABHD12_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., ?/. 2 - c.189C>G r.(?) p.(Gly63=) - benign, VUS g.25371151G>C g.25390515G>C ABHD12(NM_001042472.3):c.189C>G (p.G63=) - ABHD12_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.191+7_191+10del r.(=) p.(=) - likely benign g.25371139_25371142del g.25390503_25390506del ABHD12(NM_001042472.3):c.191+7_191+10delCTTC - ABHD12_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.191+7_191+14del r.(=) p.(=) - likely benign g.25371135_25371142del g.25390499_25390506del ABHD12(NM_001042472.3):c.191+7_191+14delCTTCGCGC - PYGB_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.191+14C>G r.(=) p.(=) - benign g.25371135G>C g.25390499G>C ABHD12(NM_001042472.3):c.191+14C>G - PYGB_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.191+17A>G r.(=) p.(=) - benign g.25371132T>C g.25390496T>C ABHD12(NM_001042472.3):c.191+17A>G - PYGB_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.191+17_191+19del r.(=) p.(=) - benign g.25371130_25371132del g.25390494_25390496del ABHD12(NM_001042472.3):c.191+17_191+19delAGC - PYGB_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.191+19C>G r.(=) p.(=) - benign g.25371130G>C g.25390494G>C ABHD12(NM_001042472.3):c.191+19C>G - ABHD12_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.191+19del r.(=) p.(=) - likely benign g.25371130del g.25390494del ABHD12(NM_001042472.3):c.191+19delC - PYGB_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.191+36_191+37insGGGGGGGGGGGGGGGG r.(=) p.(=) - likely benign g.25371112_25371113insCCCCCCCCCCCCCCCC g.25390476_25390477insCCCCCCCCCCCCCCCC ABHD12(NM_001042472.3):c.191+33_191+36delGGGCinsGGGCGGGGGGGGGGGGGGGG - PYGB_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.191+36_191+37insGGGGGGGGGGGGGGGGGGGGG r.(=) p.(=) - likely benign g.25371112_25371113insCCCCCCCCCCCCCCCCCCCCC g.25390476_25390477insCCCCCCCCCCCCCCCCCCCCC ABHD12(NM_001042472.3):c.191+31_191+36delGGGGGCinsGGGGGCGGGGGGGGGGGGGGGGGGGGG - PYGB_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 2 - c.193C>T r.(?) p.(Arg65*) - pathogenic, pathogenic (recessive) g.25319986G>A g.25339350G>A 20:25319986G>A ENST00000376542.3:c.193C>T (Arg65Ter) - ABHD12_000036 - PubMed: Carss 2017, PubMed: Eisenberger 2012 - - Germline yes - - - - Johan den Dunnen
-/., ?/. 3 - c.202G>A r.(?) p.(Val68Met) - benign, VUS g.25319977C>T g.25339341C>T ABHD12(NM_001042472.3):c.202G>A (p.V68M) - ABHD12_000025 VKGL data sharing initiative Nederland PubMed: Wang 2014 - rs11904930 CLASSIFICATION record, Germline - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/., ?/. 2 - c.203T>C r.(?) p.(Val68Ala) - likely benign, VUS g.25319976A>G g.25339340A>G ABHD12(NM_001042472.3):c.203T>C (p.V68A) - ABHD12_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
?/. 1 - c.212G>A r.(?) p.(Arg71His) - VUS g.25319967C>T g.25339331C>T ABHD12(NM_001042472.3):c.212G>A (p.R71H) - PYGB_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.268A>G r.(?) p.(Ile90Val) - likely benign g.25319911T>C g.25339275T>C ABHD12(NM_001042472.3):c.268A>G (p.I90V) - ABHD12_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.296A>G r.(?) p.(Lys99Arg) - likely benign g.25319883T>C g.25339247T>C ABHD12(NM_001042472.3):c.296A>G (p.K99R) - PYGB_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 2i c.316+2T>A r.spl p.? - pathogenic g.25319861A>T g.25339225A>T - - ABHD12_000038 - 2-generation family, 1 affected, unaffected heterozygous carrier parents, PubMed: Yoshimura 2015 - - Germline yes - - - - Johan den Dunnen
+?/. 1 - c.316+5G>A r.spl? p.? ACMG likely pathogenic g.25319858C>T g.25339222C>T - - ABHD12_000045 - PubMed: Sun 2018 - - Germline - - - - - LOVD
-?/. 1 - c.316+17C>T r.(=) p.(=) - likely benign g.25319846G>A - ABHD12(NM_001042472.3):c.316+17C>T - PYGB_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.317-5T>C r.spl? p.? - benign g.25304071A>G g.25323435A>G ABHD12(NM_001042472.3):c.317-5T>C - ABHD12_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 - c.317-2A>G r.spl? p.? - likely pathogenic g.25304068T>C g.25323432T>C ABHD12(NM_001042472.3):c.317-2A>G - ABHD12_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 4 - c.319del r.(?) p.(Arg107Glufs*8) - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - - - Johan den Dunnen
+/. 2 - c.337_338del r.(?) p.(Asp113PhefsTer14) - pathogenic g.25304045_25304046del g.25323409_25323410del ABHD12(NM_001042472.3):c.337_338delGA (p.D113Ffs*14) - PYGB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
+/., +?/. 9 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - likely pathogenic (recessive), pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15], c.337_338delGAinsTTT - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010, PubMed: Holtan 2020 - - Germline, Unknown - 1/899 cases - - - Global Variome, with Curator vacancy, Jacopo Celli
?/. 1 - c.344A>T r.(?) p.(Lys115Ile) - VUS g.25304039T>A g.25323403T>A ABHD12(NM_001042472.3):c.344A>T (p.K115I) - PYGB_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 3 c.379_385delins[GA;317-82_317-40inv] r.(?) p.(Asn127Aspfs*23) - likely pathogenic g.25303998_25304004delins[25305006_25305048;TC] - 379_385delAACTACTinsGATTCCTTATATACCATTGTAGTCTTACTGCTTTTGGTGAACACA - ABHD12_000032 - PubMed: Lerat 2017, Journal: Lerat 2017 - - Germline yes - - - - Justine Lerat
-?/. 1 - c.405C>T r.(?) p.(Asp135=) - likely benign g.25303978G>A g.25323342G>A ABHD12(NM_001042472.3):c.405C>T (p.D135=) - PYGB_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.430G>A r.(?) p.(Val144Ile) - VUS g.25300947C>T g.25320311C>T ABHD12(NM_001042472.3):c.430G>A (p.V144I) - ABHD12_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 - c.447G>A r.(?) p.(Trp149*), p.(Trp159*) - pathogenic g.25300900C>T, g.25300930C>T g.25320294C>T - - ABHD12_000008 1 more item PubMed: Haer-Wigman 2017, PubMed: Nishiguchi 2014 ClinVar-RCV000132768.3 - Germline - - - - - Lonneke Haer-Wigman
-/. 1 - c.453C>T r.(?) p.(Asn151=) - benign g.25300924G>A g.25320288G>A ABHD12(NM_001042472.3):c.453C>T (p.N151=) - ABHD12_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 2 - c.477G>A r.(?) p.(Trp159*), p.(Trp159Ter) ACMG pathogenic g.25300900C>T g.25320264C>T - - ABHD12_000008 VKGL data sharing initiative Nederland PubMed: Sun 2018 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.540C>T r.(?) p.(Thr180=) - likely benign g.25300837G>A g.25320201G>A ABHD12(NM_001042472.3):c.540C>T (p.T180=) - PYGB_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.556C>T r.(?) p.(Arg186Cys) - VUS g.25297701G>A g.25317065G>A ABHD12(NM_001042472.3):c.556C>T (p.R186C) - PYGB_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/., ?/. 3 - c.557G>C r.(?) p.(Arg186Pro) - pathogenic, VUS g.25297700C>G g.25317064C>G - - ABHD12_000007 VKGL data sharing initiative Nederland PubMed: Haer-Wigman 2017, PubMed: Nishiguchi 2014 ClinVar-RCV000132769.3 rs587777604 CLASSIFICATION record, Germline - - - - - Lonneke Haer-Wigman, VKGL-NL_Nijmegen
?/. 1 - c.578T>A r.(?) p.(Leu193Gln) - VUS g.25295602A>T g.25314966A>T ABHD12(NM_001042472.3):c.578T>A (p.L193Q) - PYGB_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 4 - c.605C>T r.(?) p.(Thr202Ile) - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - - - Johan den Dunnen
+/. 1 - c.620-2A>G r.spl? p.? - pathogenic (recessive) g.25290213T>C - 20:25290213T>C ENST00000376542.3:c.620-2A>G - ABHD12_000044 - PubMed: Carss 2017 - - Germline - - - - - LOVD
?/. 1 - c.750-2A>G r.spl? p.? - VUS g.25289132T>C g.25308496T>C ABHD12(NM_001042472.3):c.750-2A>G - ABHD12_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 8 c.758C>G r.(?) p.(Thr253Arg) - pathogenic g.25289122G>C g.25308486G>C - - ABHD12_000039 - PubMed: Tingaud-Sequeira 2017 - - Germline yes - - - - Johan den Dunnen
?/. 5 - c.769C>T r.(?) p.(Arg257Trp) - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs41306784 CLASSIFICATION record, Germline - 2/2795 individuals - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Nijmegen, VKGL-NL_AMC, Mohammed Faruq
-?/. 1 - c.787+3G>A r.spl? p.? - likely benign g.25289090C>T - ABHD12(NM_001042472.3):c.787+3G>A - PYGB_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.788-10_788-7del r.(=) p.(=) - likely benign g.25288693_25288696del g.25308057_25308060del ABHD12(NM_001042472.3):c.788-10_788-7delGTTT - PYGB_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 3 - c.837C>T r.(?) p.(Arg279=) - benign g.25288632G>A g.25307996G>A ABHD12(NM_001042472.3):c.837C>T (p.R279=) - ABHD12_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen, VKGL-NL_AMC
+/. 7 9 c.846_852dup r.(?) p.(His285*) - pathogenic g.25288620_25288626dup g.25307984_25307990dup 846_852dupTAAGAGC [His285fsX1] - ABHD12_000004 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - - - Jacopo Celli
-?/. 1 - c.867+9A>C r.(=) p.(=) - likely benign g.25288593T>G g.25307957T>G ABHD12(NM_001042472.3):c.867+9A>C - ABHD12_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.(867+1_868-1)_(950+1_951-1)del r.spl p.(Ile290Argfs*14) ACMG pathogenic g.(25284265_25287468)_(25287552_25288601)del - 868-?_950+?del - ABHD12_000047 - - - - Germline/De novo (untested) - - - - - Jinu Han
+?/. 1 - c.897G>A r.(?) p.(Trp299*) ACMG pathogenic g.25287522C>T - - - ABHD12_000048 - - - - Germline/De novo (untested) - - - - - Jinu Han
-?/. 1 - c.951-9C>T r.(=) p.(=) - likely benign g.25284273G>A g.25303637G>A ABHD12(NM_001042472.3):c.951-9C>T - ABHD12_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.979A>T r.(?) p.(Ile327Phe) - VUS g.25284236T>A - ABHD12(NM_001042472.3):c.979A>T (p.I327F) - PYGB_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.983T>C r.(?) p.(Leu328Pro) - VUS g.25284232A>G g.25303596A>G - - ABHD12_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/., -/. 2 - c.1045G>A r.(?) p.(Ala349Thr) - benign, likely pathogenic g.25282967C>T g.25302331C>T ABHD12(NM_001042472.3):c.1045G>A (p.A349T) - ABHD12_000013 VKGL data sharing initiative Nederland PubMed: Maranha 2015, Journal: Maranhao 2015 - rs746748 CLASSIFICATION record, Germline - - - - - VKGL-NL_AMC
+/. 1 12 c.1054C>T r.(?) p.(Arg352*) - pathogenic g.25282958G>A g.25302322G>A Arg352X - ABHD12_000003 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - - - Jacopo Celli
-/. 2 - c.1068T>C r.(?) p.(Asp356=) - benign g.25282944A>G g.25302308A>G ABHD12(NM_001042472.3):c.1068T>C (p.D356=) - ABHD12_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_AMC
+/. 2 - c.1075del r.(?) p.(Val359PhefsTer27) - pathogenic g.25282937del g.25302301del ABHD12(NM_001042472.3):c.1075delG (p.V359Ffs*27) - ABHD12_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_VUmc
-?/. 1 - c.1113G>A r.(?) p.(Arg371=) - likely benign g.25282899C>T g.25302263C>T ABHD12(NM_001042472.3):c.1113G>A (p.R371=) - PYGB_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.1116C>G r.(?) p.(His372Gln) - pathogenic g.25282896G>C g.25302260G>C - - ABHD12_000035 - PubMed: Nishiguchi 2014 - - Germline yes - - - - Johan den Dunnen
+?/. 1 12 c.1129A>T r.1129a>u p.Lys377* - likely pathogenic g.25282883T>A g.25302247T>A c.1129A>T - ABHD12_000006 - PubMed: Chen 2013 - - Germline yes - - - - Dong-Hui Chen
-?/. 1 - c.1157+3G>A r.spl? p.? - likely benign g.25282852C>T g.25302216C>T ABHD12(NM_001042472.3):c.1157+3G>A - PYGB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.1158-1G>T r.spl p.? - likely pathogenic g.25281521C>A g.25300885C>A IVS12-1G>T - ABHD12_000046 - PubMed: Stone 2017 - - Germline - - - - - LOVD
-?/. 1 - c.1176G>A r.(?) p.(Ser392=) - likely benign g.25281502C>T g.25300866C>T ABHD12(NM_001042472.3):c.1176G>A (p.S392=) - ABHD12_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*13G>T r.(=) p.(=) - VUS g.25281468C>A g.25300832C>A ABHD12(NM_001042472.3):c.*13G>T - ABHD12_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 2 - c.*454G>A r.(=) p.(=) - likely benign g.25281027C>T g.25300391C>T - - ABHD12_000043 136 heterozygous; Clinindb (India), 4 homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs41309917 Germline - 136/2792 individuals, 4/2792 individuals - - - Mohammed Faruq
?/. 1 - c.*5843G>C r.(=) p.(=) - VUS g.25275638C>G g.25295002C>G ABHD12(NM_015600.4):c.1186G>C (p.D396H) - PYGB_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 2 - c.*5860A>G r.(=) p.(=) - benign g.25275621T>C g.25294985T>C ABHD12(NM_015600.4):c.1203A>G (p.S401=) - PYGB_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_AMC
-?/. 1 - c.*5863G>A r.(=) p.(=) - likely benign g.25275618C>T g.25294982C>T ABHD12(NM_015600.4):c.1206G>A (p.E402=) - PYGB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.*5864C>T r.(=) p.(=) - benign g.25275617G>A g.25294981G>A ABHD12(NM_015600.4):c.1207C>T (p.L403=) - PYGB_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.*5879C>T r.(=) p.(=) - likely benign g.25275602G>A g.25294966G>A ABHD12(NM_015600.4):c.*7C>T - PYGB_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.*5890C>G r.(=) p.(=) - likely benign g.25275591G>C - ABHD12(NM_015600.4):c.*18C>G - PYGB_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.*10326C>G r.(=) p.(=) - VUS g.25271155G>C g.25290519G>C PYGB(NM_002862.4):c.1866G>C (p.K622N) - PYGB_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query