Full data view for gene ABHD12

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_001042472.2 transcript reference sequence.

150 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

+/. _1_1i c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166] r.0? p.0? Maternal (confirmed) - pathogenic g.25340671_25399883delins[25390635_25390697;AAGAAACTTAACTTAACCCAACACTTAACTTAAC] g.25360035_25419247delins[25409999_25410061;AAGAAACTTAACTTAACCCAACACTTAACTTAAC] 1-192_oGINS1:c.327+1052del - ABHD12_000005 59 kb deletion PubMed: Chen 2013 - - Germline yes - - 0 - DNA, RNA arrayCGH, arrayCNV, PCR, PCRlr, PCRq, RT-PCR, SEQ, TaqMan, Western - - PHARC 24027063-FamPatIII1 PubMed: Chen 2013 3-generation family, 1 affected, unaffected heterozygous carrier parents F no United States Germany;British - 0 - - 1 Dong-Hui Chen
+/. _1_1i c.-6920_191+6897del r.0? p.0? Both (homozygous) - pathogenic g.25364252_25378259del g.25383616_25397623del 14 bb del removing exon 1 - ABHD12_000002 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Germline - - - 0 - DNA SEQ - - PHARC 20797687-Fam6Pat1 PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - M - United Arab Emirates Arab - 0 - - 3 Jacopo Celli
+/. _1_1i c.-6920_191+6897del r.0? p.0? Both (homozygous) - pathogenic g.25364252_25378259del g.25383616_25397623del 14 kb del removing exon 1 - ABHD12_000002 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Germline - - - 0 - DNA SEQ - - PHARC 20797687-Fam6Pat2 PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - M - United Arab Emirates Arab - 0 - - 1 Jacopo Celli
+/. _1_1i c.-6920_191+6897del r.0? p.0? Both (homozygous) - pathogenic g.25364252_25378259del g.25383616_25397623del 14 kb del removing exon 1 - ABHD12_000002 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Germline - - - 0 - DNA SEQ - - PHARC 20797687-Fam6Pat3 PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - F - United Arab Emirates Arab - 0 - - 1 Jacopo Celli
-/. - c.-40_-39insGGCGGAGGC r.(?) p.(=) Unknown - benign g.25371382_25371383insCCGCCGCCT g.25390746_25390747insCCGCCGCCT - - ABHD12_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.65C>T r.(?) p.(Ser22Phe) Unknown - likely benign g.25371275G>A - ABHD12(NM_001042472.3):c.65C>T (p.S22F) - PYGB_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.103C>T r.(?) p.(Arg35Cys) Unknown - VUS g.25371237G>A g.25390601G>A ABHD12(NM_001042472.3):c.103C>T (p.R35C) - ABHD12_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.103C>T r.(?) p.(Arg35Cys) Unknown - VUS g.25371237G>A - ABHD12(NM_001042472.3):c.103C>T (p.R35C) - ABHD12_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.118C>G r.(?) p.(Leu40Val) Unknown - VUS g.25371222G>C - ABHD12(NM_001042472.3):c.118C>G (p.L40V) - PYGB_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.129G>A r.(?) p.(Thr43=) Unknown - benign g.25371211C>T g.25390575C>T ABHD12(NM_001042472.3):c.129G>A (p.T43=) - ABHD12_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.129G>A r.(?) p.(Thr43=) Unknown - likely benign g.25371211C>T g.25390575C>T ABHD12(NM_001042472.3):c.129G>A (p.T43=) - ABHD12_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.135G>A r.(?) p.(Pro45=) Unknown - likely benign g.25371205C>T g.25390569C>T ABHD12(NM_001042472.3):c.135G>A (p.P45=) - PYGB_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.182C>A r.(?) p.(Ala61Glu) Unknown - VUS g.25371158G>T g.25390522G>T ABHD12(NM_001042472.3):c.182C>A (p.A61E) - ABHD12_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.189C>G r.(?) p.(Gly63=) Unknown - benign g.25371151G>C g.25390515G>C ABHD12(NM_001042472.3):c.189C>G (p.G63=) - ABHD12_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.189C>G r.(?) p.(Gly63=) Unknown - VUS g.25371151G>C g.25390515G>C ABHD12(NM_001042472.3):c.189C>G (p.G63=) - ABHD12_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.191+7_191+10del r.(=) p.(=) Unknown - likely benign g.25371139_25371142del g.25390503_25390506del ABHD12(NM_001042472.3):c.191+7_191+10delCTTC - ABHD12_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.191+7_191+14del r.(=) p.(=) Unknown - likely benign g.25371135_25371142del g.25390499_25390506del ABHD12(NM_001042472.3):c.191+7_191+14delCTTCGCGC - PYGB_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.191+14C>G r.(=) p.(=) Unknown - benign g.25371135G>C g.25390499G>C ABHD12(NM_001042472.3):c.191+14C>G - PYGB_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.191+17A>G r.(=) p.(=) Unknown - benign g.25371132T>C g.25390496T>C ABHD12(NM_001042472.3):c.191+17A>G - PYGB_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.191+19C>G r.(=) p.(=) Unknown - benign g.25371130G>C g.25390494G>C ABHD12(NM_001042472.3):c.191+19C>G - ABHD12_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.191+19del r.(=) p.(=) Unknown - likely benign g.25371130del g.25390494del ABHD12(NM_001042472.3):c.191+19delC - PYGB_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.191+36_191+37insGGGGGGGGGGGGGGGG r.(=) p.(=) Unknown - likely benign g.25371112_25371113insCCCCCCCCCCCCCCCC g.25390476_25390477insCCCCCCCCCCCCCCCC ABHD12(NM_001042472.3):c.191+33_191+36delGGGCinsGGGCGGGGGGGGGGGGGGGG - PYGB_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.191+36_191+37insGGGGGGGGGGGGGGGGGGGGG r.(=) p.(=) Unknown - likely benign g.25371112_25371113insCCCCCCCCCCCCCCCCCCCCC g.25390476_25390477insCCCCCCCCCCCCCCCCCCCCC ABHD12(NM_001042472.3):c.191+31_191+36delGGGGGCinsGGGGGCGGGGGGGGGGGGGGGGGGGGG - PYGB_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.193C>T r.(?) p.(Arg65*) Both (homozygous) - pathogenic g.25319986G>A g.25339350G>A - - ABHD12_000036 - PubMed: Eisenberger 2012 - - Germline yes - - 0 - DNA SEQ, SEQ-NG - wes PHARC 22938382-Fam PubMed: Eisenberger 2012 4-generation family, affected brother/sister, unaffected heterozygous carrier parents F;M yes Lebanon - - 0 - - 2 Johan den Dunnen
+/. - c.193C>T r.(?) p.(Arg65*) Both (homozygous) - pathogenic (recessive) g.25319986G>A - 20:25319986G>A ENST00000376542.3:c.193C>T (Arg65Ter) - ABHD12_000036 - PubMed: Carss 2017 - - Germline - - - 0 - DNA SEQ-NG - WGS retinal disease G008991 PubMed: Carss 2017 - M - United Kingdom (Great Britain) Asia-South - 0 - - 1 LOVD
+/. - c.193C>T r.(?) p.(Arg65*) Both (homozygous) - pathogenic g.25319986G>A g.25339350G>A ABHD12 c.193C>T, p.Arg65Ter - ABHD12_000036 homozygous PubMed: Turro 2020 - - Germline/De novo (untested) ? - - 0 - DNA SEQ-NG-I blood whole genome sequencing retinal disease G008991 PubMed: Turro 2020 only individuals with mutations in retinal disease genes from this publication were inserted into LOVD ? - - - - 0 - - 1 LOVD
-/. - c.202G>A r.(?) p.(Val68Met) Unknown - benign g.25319977C>T g.25339341C>T ABHD12(NM_001042472.3):c.202G>A (p.V68M) - ABHD12_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.202G>A r.(?) p.(Val68Met) Unknown - benign g.25319977C>T g.25339341C>T ABHD12(NM_001042472.3):c.202G>A (p.V68M) - ABHD12_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.202G>A r.(?) p.(Val68Met) Unknown - VUS g.25319977C>T g.25339341C>T - - ABHD12_000025 - PubMed: Wang 2014 - rs11904930 Germline - - - 0 - DNA SEQ-NG - 66-gene panel retinal disease 49 PubMed: Wang 2014 - F - United States - - 0 - - 1 LOVD
?/. - c.203T>C r.(?) p.(Val68Ala) Unknown - VUS g.25319976A>G g.25339340A>G ABHD12(NM_001042472.3):c.203T>C (p.V68A) - ABHD12_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.203T>C r.(?) p.(Val68Ala) Unknown - likely benign g.25319976A>G g.25339340A>G ABHD12(NM_001042472.3):c.203T>C (p.V68A) - ABHD12_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2 c.211_223del r.(?) p.(Arg71Tyrfs*26) Both (homozygous) - pathogenic g.25319956_25319968del - c.211_223del (p.Arg71Tyrfs*26) - ABHD12_000056 - - - - Germline - - - 0 - DNA SEQ - - retinal disease II-1 PubMed: Frasquet-2018 - - yes Spain Spanish - 0 - - 1 LOVD
+/. 2 c.211_223del r.(?) p.(Arg71Tyrfs*26) Both (homozygous) - pathogenic g.25319956_25319968del - c.211_223del (p.Arg71Tyrfs*26) - ABHD12_000056 - - - - Germline - - - 0 - DNA SEQ - - retinal disease II-3 PubMed: Frasquet-2018 - M yes Spain Spanish - 0 - - 1 LOVD
?/. - c.212G>A r.(?) p.(Arg71His) Unknown - VUS g.25319967C>T g.25339331C>T ABHD12(NM_001042472.3):c.212G>A (p.R71H) - PYGB_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2 c.249C>G r.(?) p.(Tyr83*) Both (homozygous) - pathogenic g.25319930G>C - c.249C>G - ABHD12_000055 - - - - Germline yes - - 0 - DNA SEQ, SEQ-NG peripheral blood leukocytes WES retinal disease II:1 PubMed: li-2019 - M - China Hunan - 0 - - 1 LOVD
+/. 2 c.249C>G r.(?) p.(Tyr83*) Both (homozygous) - pathogenic g.25319930G>C - c.249C>G - ABHD12_000055 - - - - Germline yes - - 0 - DNA SEQ, SEQ-NG peripheral blood leukocytes WES retinal disease II:5 PubMed: li-2019 - M - China Hunan - 0 - - 1 LOVD
-?/. - c.268A>G r.(?) p.(Ile90Val) Unknown - likely benign g.25319911T>C g.25339275T>C ABHD12(NM_001042472.3):c.268A>G (p.I90V) - ABHD12_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.281C>T r.(?) p.(Pro94Leu) Unknown - VUS g.25319898G>A - ABHD12(NM_001042472.3):c.281C>T (p.P94L) - PYGB_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.296A>G r.(?) p.(Lys99Arg) Unknown - likely benign g.25319883T>C g.25339247T>C ABHD12(NM_001042472.3):c.296A>G (p.K99R) - PYGB_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2i c.316+2T>A r.spl p.? Both (homozygous) - pathogenic g.25319861A>T g.25339225A>T - - ABHD12_000038 - PubMed: Yoshimura 2015 - - Germline yes - - 0 - DNA SEQ - - PHARC 25743180-Fam1 PubMed: Yoshimura 2015 2-generation family, 3 affecteds (3M), unaffected heterozygous carrier parents M yes Japan - - 0 - - 3 Johan den Dunnen
+/. 2i c.316+2T>A r.spl p.? Both (homozygous) - pathogenic g.25319861A>T g.25339225A>T - - ABHD12_000038 - 2-generation family, 1 affected, unaffected heterozygous carrier parents - - Germline - - - 0 - DNA SEQ - - PHARC 25743180-Fam2 PubMed: Yoshimura 2015 2-generation family, 1 affected, unaffected heterozygous carrier parents M ? Japan - - 0 - - 1 Johan den Dunnen
+?/. - c.316+5G>A r.spl? p.? Parent #1 ACMG likely pathogenic g.25319858C>T g.25339222C>T - - ABHD12_000045 - PubMed: Sun 2018 - - Germline - - - 0 - DNA SEQ-NG - - HL 19676 PubMed: Sun 2018 sporadic case - no China - - 0 - - 1 LOVD
-?/. - c.316+17C>T r.(=) p.(=) Unknown - likely benign g.25319846G>A - ABHD12(NM_001042472.3):c.316+17C>T - PYGB_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.317-5T>C r.spl? p.? Unknown - benign g.25304071A>G g.25323435A>G ABHD12(NM_001042472.3):c.317-5T>C - ABHD12_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.317-2A>G r.spl? p.? Unknown - likely pathogenic g.25304068T>C g.25323432T>C ABHD12(NM_001042472.3):c.317-2A>G - ABHD12_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.319del r.(?) p.(Arg107Glufs*8) Parent #1 - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - DNA SEQ - WES PHARC 24697911-FamRP-1292PatII4 PubMed: Nishiguchi 2014 2-generation family, 4 affecteds (2F, 2M), unaffected carrier parents, PatII4 F no Spain - - 0 - - 4 Johan den Dunnen
+/. - c.319del r.(?) p.(Arg107Glufs*8) Parent #1 - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - DNA SEQ - WES PHARC 24697911-FamRP-1292PatII6 PubMed: Nishiguchi 2014 PatII6 F no Spain - - 0 - - 1 Johan den Dunnen
+/. - c.319del r.(?) p.(Arg107Glufs*8) Parent #1 - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - DNA SEQ - WES PHARC 24697911-FamRP-1292PatII7 PubMed: Nishiguchi 2014 PatII7 M no Spain - - 0 - - 1 Johan den Dunnen
+/. - c.319del r.(?) p.(Arg107Glufs*8) Parent #1 - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - DNA SEQ - WES PHARC 24697911-FamRP-1487PatII2 PubMed: Nishiguchi 2014 2-generation family, 1 affected, unaffected heterozygous father F yes Spain - - 0 - - 1 Johan den Dunnen
+/. - c.337_338del r.(?) p.(Asp113PhefsTer14) Unknown - pathogenic g.25304045_25304046del g.25323409_25323410del ABHD12(NM_001042472.3):c.337_338delGA (p.D113Ffs*14) - PYGB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.337_338del r.(?) p.(Asp113PhefsTer14) Unknown - pathogenic g.25304045_25304046del - ABHD12(NM_001042472.3):c.337_338delGA (p.D113Ffs*14) - PYGB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - DNA SEQ - - PHARC 19005174-FamPatIV1 PubMed: Fiskerstrand 2009, Journal: Fiskerstrand 2009 5-generation family, 3 affecteds (F, 2M), unaffected heterozygous carrier parents/relatives F - Norway Norwegian - 0 - - 3 Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - DNA SEQ - - PHARC 19005174-FamPatIV2 PubMed: Fiskerstrand 2009, Journal: Fiskerstrand 2009 brother PatIV2 M - Norway Norwegian - 0 - - 1 Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - DNA SEQ - - PHARC 19005174-FamPatIV4 PubMed: Fiskerstrand 2009, Journal: Fiskerstrand 2009 third cousin PatIV4 M - Norway Norwegian - 0 - - 1 Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - DNA SEQ - - PHARC 20797687-Fam2Pat2 PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 Sibling 2.2 M - Norway Norwegian - 0 - - 2 Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - DNA SEQ - - PHARC 20797687-Fam2Pat1 PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 Sibling 2.1 F - Norway Norwegian - 0 - - 1 Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - DNA SEQ - - PHARC 20797687-Fam3Pat1 PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - F - Norway Norwegian - 0 - - 1 Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - DNA SEQ - - PHARC 20797687-Fam4Pat1 PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - M - Norway Norwegian - 0 - - 1 Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - DNA SEQ - - PHARC 20797687-Fam5Pat1 PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - M - Norway Norwegian - 0 - - 1 Jacopo Celli
+?/. - c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) Both (homozygous) - likely pathogenic (recessive) g.25304045_25304046delinsAAA - c.337_338delGAinsTTT - ABHD12_000001 - PubMed: Holtan 2020 - - Germline - 1/899 cases - 0 - DNA SEQ - - retinal disease - PubMed: Holtan 2020 1 homozygous patient - - Norway - - 0 - - 1 Global Variome, with Curator vacancy
?/. - c.344A>T r.(?) p.(Lys115Ile) Unknown - VUS g.25304039T>A g.25323403T>A ABHD12(NM_001042472.3):c.344A>T (p.K115I) - PYGB_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 3 c.379_385delinsGATTCCTTATATACCATTGTAGTCTTACTGCTTTTGGTGAACACA r.(?) p.(Asn127Aspfs*23) Both (homozygous) - pathogenic g.25303998_25304004delinsTGTGTTCACCAAAAGCAGTAAGACTACAATGGTATATAAGGAATC - c.379_385delinsGATTCCTTATA TACCATTGTAGTCTTACTGCTTTTGGTGAACACA - ABHD12_000054 - - - - Germline yes - - 0 - DNA SEQ, SEQ-NG peripheral blood - retinal disease XXVI PubMed: Lerat-2019 - M - France French - 0 - - 1 LOVD
+?/. 3 c.379_385delins[GA;317-82_317-40inv] r.(?) p.(Asn127Aspfs*23) Both (homozygous) - likely pathogenic g.25303998_25304004delins[25305006_25305048;TC] - 379_385delAACTACTinsGATTCCTTATATACCATTGTAGTCTTACTGCTTTTGGTGAACACA - ABHD12_000032 - PubMed: Lerat 2017, Journal: Lerat 2017 - - Germline yes - - 0 - DNA SEQ-NG-IT blood - PHARC 15B135 PubMed: Lerat 2017,Journal: Lerat 2017 - M yes France - 36y 0 - no 1 Justine Lerat
-?/. - c.405C>T r.(?) p.(Asp135=) Unknown - likely benign g.25303978G>A g.25323342G>A ABHD12(NM_001042472.3):c.405C>T (p.D135=) - PYGB_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.406G>A r.(?) p.(Val136Met) Unknown - VUS g.25303977C>T - ABHD12(NM_001042472.3):c.406G>A (p.V136M) - PYGB_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.430G>A r.(?) p.(Val144Ile) Unknown - VUS g.25300947C>T g.25320311C>T ABHD12(NM_001042472.3):c.430G>A (p.V144I) - ABHD12_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.447G>A r.(?) p.(Trp159*) Parent #1 - pathogenic g.25300900C>T - - - ABHD12_000008 Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message. PubMed: Nishiguchi 2014 ClinVar-RCV000132768.3 - Germline - - - 0 - DNA SEQ-NG - - COD 24697911-FamW08-1833PatII1 PubMed: Nishiguchi 2014 2-generation family, 1 affected, unaffected heterozygous carrier parents M no Netherlands - - 0 - - 1 Lonneke Haer-Wigman
+/. - c.447G>A r.(?) p.(Trp149*) Parent #1 - pathogenic g.25300930C>T g.25320294C>T - - ABHD12_000008 - PubMed: Haer-Wigman 2017 - - Germline - - - 0 - DNA SEQ-NG - gene panel ? 5085 PubMed: Haer-Wigman 2017 patient - no Netherlands - - 0 - - 1 LOVD
-/. - c.453C>T r.(?) p.(Asn151=) Unknown - benign g.25300924G>A g.25320288G>A ABHD12(NM_001042472.3):c.453C>T (p.N151=) - ABHD12_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.477G>A r.(?) p.(Trp159Ter) Unknown - pathogenic g.25300900C>T g.25320264C>T - - ABHD12_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.477G>A r.(?) p.(Trp159*) Parent #2 ACMG pathogenic g.25300900C>T g.25320264C>T - - ABHD12_000008 - PubMed: Sun 2018 - - Germline - - - 0 - DNA SEQ-NG - - HL 19676 PubMed: Sun 2018 sporadic case - no China - - 0 - - 1 LOVD
+/. 4 c.527G>A r.(?) p.(Gly176Glu) Both (homozygous) - pathogenic (recessive) g.25300850C>T - - - ABHD12_000050 - - - - Germline yes - - - - DNA SEQ blood - CMT - - - M yes Egypt - - - - - 1 Sherifa Ahmed Hamed
+/. 4 c.527G>A r.(?) p.(Gly176Glu) Both (homozygous) - pathogenic (recessive) g.25300850C>T - - - ABHD12_000050 - - - - Germline yes - - - - DNA SEQ blood - CMT - - - F - Egypt - - - - - 4 Sherifa Ahmed Hamed
+/. 4 c.527G>A r.(?) p.(Gly176Glu) Both (homozygous) - pathogenic (recessive) g.25300850C>T - - - ABHD12_000050 - - - - Germline yes - - - - DNA SEQ blood - CMT - - - F - Egypt - - - - - 4 Sherifa Ahmed Hamed
-?/. - c.540C>T r.(?) p.(Thr180=) Unknown - likely benign g.25300837G>A g.25320201G>A ABHD12(NM_001042472.3):c.540C>T (p.T180=) - PYGB_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.542+3G>A r.spl? p.? Unknown - likely benign g.25300832C>T - ABHD12(NM_001042472.3):c.542+3G>A - PYGB_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.556C>T r.(?) p.(Arg186Cys) Unknown - VUS g.25297701G>A g.25317065G>A ABHD12(NM_001042472.3):c.556C>T (p.R186C) - PYGB_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.557G>C r.(?) p.(Arg186Pro) Parent #2 - pathogenic g.25297700C>G g.25317064C>G - - ABHD12_000007 - PubMed: Nishiguchi 2014 ClinVar-RCV000132769.3 rs587777604 Germline - - - 0 - DNA SEQ-NG - - COD 24697911-FamW08-1833PatII1 PubMed: Nishiguchi 2014 2-generation family, 1 affected, unaffected heterozygous carrier parents M no Netherlands - - 0 - - 1 Lonneke Haer-Wigman
?/. - c.557G>C r.(?) p.(Arg186Pro) Unknown - VUS g.25297700C>G g.25317064C>G - - ABHD12_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.557G>C r.(?) p.(Arg186Pro) Parent #2 - pathogenic g.25297700C>G g.25317064C>G - - ABHD12_000007 - PubMed: Haer-Wigman 2017 - - Germline - - - 0 - DNA SEQ-NG - gene panel ? 5085 PubMed: Haer-Wigman 2017 patient - no Netherlands - - 0 - - 1 LOVD
?/. - c.578T>A r.(?) p.(Leu193Gln) Unknown - VUS g.25295602A>T g.25314966A>T ABHD12(NM_001042472.3):c.578T>A (p.L193Q) - PYGB_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.605C>T r.(?) p.(Thr202Ile) Parent #2 - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - DNA SEQ - WES PHARC 24697911-FamRP-1292PatII4 PubMed: Nishiguchi 2014 2-generation family, 4 affecteds (2F, 2M), unaffected carrier parents, PatII4 F no Spain - - 0 - - 4 Johan den Dunnen
+/. - c.605C>T r.(?) p.(Thr202Ile) Parent #2 - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - DNA SEQ - WES PHARC 24697911-FamRP-1292PatII6 PubMed: Nishiguchi 2014 PatII6 F no Spain - - 0 - - 1 Johan den Dunnen
+/. - c.605C>T r.(?) p.(Thr202Ile) Parent #2 - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - DNA SEQ - WES PHARC 24697911-FamRP-1292PatII7 PubMed: Nishiguchi 2014 PatII7 M no Spain - - 0 - - 1 Johan den Dunnen
+/. - c.605C>T r.(?) p.(Thr202Ile) Parent #2 - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - DNA SEQ - WES PHARC 24697911-FamRP-1487PatII2 PubMed: Nishiguchi 2014 2-generation family, 1 affected, unaffected heterozygous father F yes Spain - - 0 - - 1 Johan den Dunnen
+/. - c.620-2A>G r.spl? p.? Both (homozygous) - pathogenic (recessive) g.25290213T>C - 20:25290213T>C ENST00000376542.3:c.620-2A>G - ABHD12_000044 - PubMed: Carss 2017 - - Germline - - - 0 - DNA SEQ-NG - WGS retinal disease W000163 PubMed: Carss 2017 - M - United Kingdom (Great Britain) Asia-South - 0 - - 1 LOVD
+?/. - c.620-2A>G r.spl p.(?) Both (homozygous) - likely pathogenic g.25290213T>C g.25309577T>C ABHD12 c.620-2A>G, - ABHD12_000044 homozygous PubMed: Turro 2020 - - Germline/De novo (untested) ? - - 0 - DNA SEQ-NG-I blood whole genome sequencing retinal disease W000163 PubMed: Turro 2020 only individuals with mutations in retinal disease genes from this publication were inserted into LOVD ? - - - - 0 - - 1 LOVD
-?/. - c.726C>T r.(?) p.(Ile242=) Unknown - likely benign g.25290105G>A - ABHD12(NM_001042472.3):c.726C>T (p.I242=) - PYGB_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.750-2A>G r.spl? p.? Unknown - VUS g.25289132T>C g.25308496T>C ABHD12(NM_001042472.3):c.750-2A>G - ABHD12_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. 8 c.758C>G r.(?) p.(Thr253Arg) Both (homozygous) - pathogenic g.25289122G>C g.25308486G>C - - ABHD12_000039 - PubMed: Tingaud-Sequeira 2017 - - Germline yes - - 0 - DNA SEQ - - PHARC 27890673-FamPatII1 PubMed: Tingaud-Sequeira 2017 3-generation family, 1 affected, unaffected heterozygous carrier parents F no Sweden - - 0 - - 1 Johan den Dunnen
?/. - c.769C>T r.(?) p.(Arg257Trp) Unknown - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.769C>T r.(?) p.(Arg257Trp) Unknown - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.769C>T r.(?) p.(Arg257Trp) Unknown - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.769C>T r.(?) p.(Arg257Trp) Unknown - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.769C>T r.(?) p.(Arg257Trp) Parent #1 - VUS g.25289111G>A g.25308475G>A - - ABHD12_000017 conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs41306784 Germline - 2/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 2 Mohammed Faruq
+/. 8 c.784C>T r.(?) p.(Arg262*) Both (homozygous) - pathogenic g.25289096G>A - c.784C > T, p.Arg262* - ABHD12_000053 - - - - Germline - - - 0 - DNA SEQ - - retinal disease Patient A PubMed: Thimm-2020 - M - (Germany) Iraqi - 0 - - 1 LOVD
+/. 8 c.784C>T r.(?) p.(Arg262*) Both (homozygous) - pathogenic g.25289096G>A - c.784C > T, p.Arg262* - ABHD12_000053 - - - - Germline - - - 0 - DNA SEQ, SEQ-NG, MLPA - - retinal disease Patient B PubMed: Thimm-2020 - M - (Germany) Iraqi - 0 - - 1 LOVD
-?/. - c.787+3G>A r.spl? p.? Unknown - likely benign g.25289090C>T - ABHD12(NM_001042472.3):c.787+3G>A - PYGB_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.788-10_788-7del r.(=) p.(=) Unknown - likely benign g.25288693_25288696del g.25308057_25308060del ABHD12(NM_001042472.3):c.788-10_788-7delGTTT - PYGB_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.837C>T r.(?) p.(Arg279=) Unknown - benign g.25288632G>A g.25307996G>A ABHD12(NM_001042472.3):c.837C>T (p.R279=) - ABHD12_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
Legend   How to query   « First ‹ Prev     1 2     Next › Last »