All variants in the ABHD12 gene

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_001042472.2 transcript reference sequence.

148 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+/. _1_1i c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166] r.0? p.0? - pathogenic g.25340671_25399883delins[25390635_25390697;AAGAAACTTAACTTAACCCAACACTTAACTTAAC] g.25360035_25419247delins[25409999_25410061;AAGAAACTTAACTTAACCCAACACTTAACTTAAC] 1-192_oGINS1:c.327+1052del - ABHD12_000005 59 kb deletion PubMed: Chen 2013 - - Germline yes - - 0 - Dong-Hui Chen
+/. _1_1i c.-6920_191+6897del r.0? p.0? - pathogenic g.25364252_25378259del g.25383616_25397623del 14 bb del removing exon 1 - ABHD12_000002 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Germline - - - 0 - Jacopo Celli
+/. _1_1i c.-6920_191+6897del r.0? p.0? - pathogenic g.25364252_25378259del g.25383616_25397623del 14 kb del removing exon 1 - ABHD12_000002 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Germline - - - 0 - Jacopo Celli
+/. _1_1i c.-6920_191+6897del r.0? p.0? - pathogenic g.25364252_25378259del g.25383616_25397623del 14 kb del removing exon 1 - ABHD12_000002 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Germline - - - 0 - Jacopo Celli
-/. - c.-40_-39insGGCGGAGGC r.(?) p.(=) - benign g.25371382_25371383insCCGCCGCCT g.25390746_25390747insCCGCCGCCT - - ABHD12_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-?/. - c.65C>T r.(?) p.(Ser22Phe) - likely benign g.25371275G>A - ABHD12(NM_001042472.3):c.65C>T (p.S22F) - PYGB_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.103C>T r.(?) p.(Arg35Cys) - VUS g.25371237G>A g.25390601G>A ABHD12(NM_001042472.3):c.103C>T (p.R35C) - ABHD12_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.103C>T r.(?) p.(Arg35Cys) - VUS g.25371237G>A - ABHD12(NM_001042472.3):c.103C>T (p.R35C) - ABHD12_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.118C>G r.(?) p.(Leu40Val) - VUS g.25371222G>C - ABHD12(NM_001042472.3):c.118C>G (p.L40V) - PYGB_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.129G>A r.(?) p.(Thr43=) - likely benign g.25371211C>T g.25390575C>T ABHD12(NM_001042472.3):c.129G>A (p.T43=) - ABHD12_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.135G>A r.(?) p.(Pro45=) - likely benign g.25371205C>T g.25390569C>T ABHD12(NM_001042472.3):c.135G>A (p.P45=) - PYGB_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.182C>A r.(?) p.(Ala61Glu) - VUS g.25371158G>T g.25390522G>T ABHD12(NM_001042472.3):c.182C>A (p.A61E) - ABHD12_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.189C>G r.(?) p.(Gly63=) - benign g.25371151G>C g.25390515G>C ABHD12(NM_001042472.3):c.189C>G (p.G63=) - ABHD12_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.189C>G r.(?) p.(Gly63=) - VUS g.25371151G>C g.25390515G>C ABHD12(NM_001042472.3):c.189C>G (p.G63=) - ABHD12_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.191+7_191+10del r.(=) p.(=) - likely benign g.25371139_25371142del g.25390503_25390506del ABHD12(NM_001042472.3):c.191+7_191+10delCTTC - ABHD12_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.191+7_191+14del r.(=) p.(=) - likely benign g.25371135_25371142del g.25390499_25390506del ABHD12(NM_001042472.3):c.191+7_191+14delCTTCGCGC - PYGB_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.191+14C>G r.(=) p.(=) - benign g.25371135G>C g.25390499G>C ABHD12(NM_001042472.3):c.191+14C>G - PYGB_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.191+17A>G r.(=) p.(=) - benign g.25371132T>C g.25390496T>C ABHD12(NM_001042472.3):c.191+17A>G - PYGB_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.191+19C>G r.(=) p.(=) - benign g.25371130G>C g.25390494G>C ABHD12(NM_001042472.3):c.191+19C>G - ABHD12_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.191+19del r.(=) p.(=) - likely benign g.25371130del g.25390494del ABHD12(NM_001042472.3):c.191+19delC - PYGB_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.191+36_191+37insGGGGGGGGGGGGGGGG r.(=) p.(=) - likely benign g.25371112_25371113insCCCCCCCCCCCCCCCC g.25390476_25390477insCCCCCCCCCCCCCCCC ABHD12(NM_001042472.3):c.191+33_191+36delGGGCinsGGGCGGGGGGGGGGGGGGGG - PYGB_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.191+36_191+37insGGGGGGGGGGGGGGGGGGGGG r.(=) p.(=) - likely benign g.25371112_25371113insCCCCCCCCCCCCCCCCCCCCC g.25390476_25390477insCCCCCCCCCCCCCCCCCCCCC ABHD12(NM_001042472.3):c.191+31_191+36delGGGGGCinsGGGGGCGGGGGGGGGGGGGGGGGGGGG - PYGB_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.193C>T r.(?) p.(Arg65*) - pathogenic g.25319986G>A g.25339350G>A - - ABHD12_000036 - PubMed: Eisenberger 2012 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.193C>T r.(?) p.(Arg65*) - pathogenic (recessive) g.25319986G>A - 20:25319986G>A ENST00000376542.3:c.193C>T (Arg65Ter) - ABHD12_000036 - PubMed: Carss 2017 - - Germline - - - 0 - LOVD
+/. - c.193C>T r.(?) p.(Arg65*) - pathogenic g.25319986G>A g.25339350G>A ABHD12 c.193C>T, p.Arg65Ter - ABHD12_000036 homozygous PubMed: Turro 2020 - - Germline/De novo (untested) ? - - 0 - LOVD
-/. - c.202G>A r.(?) p.(Val68Met) - benign g.25319977C>T g.25339341C>T ABHD12(NM_001042472.3):c.202G>A (p.V68M) - ABHD12_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.202G>A r.(?) p.(Val68Met) - benign g.25319977C>T g.25339341C>T ABHD12(NM_001042472.3):c.202G>A (p.V68M) - ABHD12_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.202G>A r.(?) p.(Val68Met) - VUS g.25319977C>T g.25339341C>T - - ABHD12_000025 - PubMed: Wang 2014 - rs11904930 Germline - - - 0 - LOVD
?/. - c.203T>C r.(?) p.(Val68Ala) - VUS g.25319976A>G g.25339340A>G ABHD12(NM_001042472.3):c.203T>C (p.V68A) - ABHD12_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.203T>C r.(?) p.(Val68Ala) - likely benign g.25319976A>G g.25339340A>G ABHD12(NM_001042472.3):c.203T>C (p.V68A) - ABHD12_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 c.211_223del r.(?) p.(Arg71Tyrfs*26) - pathogenic g.25319956_25319968del - c.211_223del (p.Arg71Tyrfs*26) - ABHD12_000056 - - - - Germline - - - 0 - LOVD
+/. 2 c.211_223del r.(?) p.(Arg71Tyrfs*26) - pathogenic g.25319956_25319968del - c.211_223del (p.Arg71Tyrfs*26) - ABHD12_000056 - - - - Germline - - - 0 - LOVD
?/. - c.212G>A r.(?) p.(Arg71His) - VUS g.25319967C>T g.25339331C>T ABHD12(NM_001042472.3):c.212G>A (p.R71H) - PYGB_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 c.249C>G r.(?) p.(Tyr83*) - pathogenic g.25319930G>C - c.249C>G - ABHD12_000055 - - - - Germline yes - - 0 - LOVD
+/. 2 c.249C>G r.(?) p.(Tyr83*) - pathogenic g.25319930G>C - c.249C>G - ABHD12_000055 - - - - Germline yes - - 0 - LOVD
-?/. - c.268A>G r.(?) p.(Ile90Val) - likely benign g.25319911T>C g.25339275T>C ABHD12(NM_001042472.3):c.268A>G (p.I90V) - ABHD12_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.281C>T r.(?) p.(Pro94Leu) - VUS g.25319898G>A - ABHD12(NM_001042472.3):c.281C>T (p.P94L) - PYGB_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.296A>G r.(?) p.(Lys99Arg) - likely benign g.25319883T>C g.25339247T>C ABHD12(NM_001042472.3):c.296A>G (p.K99R) - PYGB_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2i c.316+2T>A r.spl p.? - pathogenic g.25319861A>T g.25339225A>T - - ABHD12_000038 - PubMed: Yoshimura 2015 - - Germline yes - - 0 - Johan den Dunnen
+/. 2i c.316+2T>A r.spl p.? - pathogenic g.25319861A>T g.25339225A>T - - ABHD12_000038 - 2-generation family, 1 affected, unaffected heterozygous carrier parents - - Germline - - - 0 - Johan den Dunnen
+?/. - c.316+5G>A r.spl? p.? ACMG likely pathogenic g.25319858C>T g.25339222C>T - - ABHD12_000045 - PubMed: Sun 2018 - - Germline - - - 0 - LOVD
-?/. - c.316+17C>T r.(=) p.(=) - likely benign g.25319846G>A - ABHD12(NM_001042472.3):c.316+17C>T - PYGB_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.317-5T>C r.spl? p.? - benign g.25304071A>G g.25323435A>G ABHD12(NM_001042472.3):c.317-5T>C - ABHD12_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
+?/. - c.317-2A>G r.spl? p.? - likely pathogenic g.25304068T>C g.25323432T>C ABHD12(NM_001042472.3):c.317-2A>G - ABHD12_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.319del r.(?) p.(Arg107Glufs*8) - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.319del r.(?) p.(Arg107Glufs*8) - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.319del r.(?) p.(Arg107Glufs*8) - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.319del r.(?) p.(Arg107Glufs*8) - pathogenic g.25304065del g.25323429del - - ABHD12_000033 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.337_338del r.(?) p.(Asp113PhefsTer14) - pathogenic g.25304045_25304046del g.25323409_25323410del ABHD12(NM_001042472.3):c.337_338delGA (p.D113Ffs*14) - PYGB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.337_338del r.(?) p.(Asp113PhefsTer14) - pathogenic g.25304045_25304046del - ABHD12(NM_001042472.3):c.337_338delGA (p.D113Ffs*14) - PYGB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - Jacopo Celli
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - pathogenic g.25304045_25304046delinsAAA g.25323409_25323410delinsAAA 337_338delGAinsTTT [Asp113PhefsX15] - ABHD12_000001 - PubMed: Fiskerstrand 2010, Journal: Fiskerstrand 2010 - - Unknown - - - 0 - Jacopo Celli
+?/. - c.337_338delinsTTT r.(?) p.(Asp113Phefs*15) - likely pathogenic (recessive) g.25304045_25304046delinsAAA - c.337_338delGAinsTTT - ABHD12_000001 - PubMed: Holtan 2020 - - Germline - 1/899 cases - 0 - Global Variome, with Curator vacancy
?/. - c.344A>T r.(?) p.(Lys115Ile) - VUS g.25304039T>A g.25323403T>A ABHD12(NM_001042472.3):c.344A>T (p.K115I) - PYGB_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 3 c.379_385delins[GA;317-82_317-40inv] r.(?) p.(Asn127Aspfs*23) - likely pathogenic g.25303998_25304004delins[25305006_25305048;TC] - 379_385delAACTACTinsGATTCCTTATATACCATTGTAGTCTTACTGCTTTTGGTGAACACA - ABHD12_000032 - PubMed: Lerat 2017, Journal: Lerat 2017 - - Germline yes - - 0 - Justine Lerat
-?/. - c.405C>T r.(?) p.(Asp135=) - likely benign g.25303978G>A g.25323342G>A ABHD12(NM_001042472.3):c.405C>T (p.D135=) - PYGB_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.406G>A r.(?) p.(Val136Met) - VUS g.25303977C>T - ABHD12(NM_001042472.3):c.406G>A (p.V136M) - PYGB_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.430G>A r.(?) p.(Val144Ile) - VUS g.25300947C>T g.25320311C>T ABHD12(NM_001042472.3):c.430G>A (p.V144I) - ABHD12_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.447G>A r.(?) p.(Trp159*) - pathogenic g.25300900C>T - - - ABHD12_000008 Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message. PubMed: Nishiguchi 2014 ClinVar-RCV000132768.3 - Germline - - - 0 - Lonneke Haer-Wigman
+/. - c.447G>A r.(?) p.(Trp149*) - pathogenic g.25300930C>T g.25320294C>T - - ABHD12_000008 - PubMed: Haer-Wigman 2017 - - Germline - - - 0 - LOVD
-/. - c.453C>T r.(?) p.(Asn151=) - benign g.25300924G>A g.25320288G>A ABHD12(NM_001042472.3):c.453C>T (p.N151=) - ABHD12_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
+/. - c.477G>A r.(?) p.(Trp159Ter) - pathogenic g.25300900C>T g.25320264C>T - - ABHD12_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/. - c.477G>A r.(?) p.(Trp159*) ACMG pathogenic g.25300900C>T g.25320264C>T - - ABHD12_000008 - PubMed: Sun 2018 - - Germline - - - 0 - LOVD
+/. 4 c.527G>A r.(?) p.(Gly176Glu) - pathogenic (recessive) g.25300850C>T - - - ABHD12_000050 - - - - Germline yes - - - - Sherifa Ahmed Hamed
+/. 4 c.527G>A r.(?) p.(Gly176Glu) - pathogenic (recessive) g.25300850C>T - - - ABHD12_000050 - - - - Germline yes - - - - Sherifa Ahmed Hamed
+/. 4 c.527G>A r.(?) p.(Gly176Glu) - pathogenic (recessive) g.25300850C>T - - - ABHD12_000050 - - - - Germline yes - - - - Sherifa Ahmed Hamed
-?/. - c.540C>T r.(?) p.(Thr180=) - likely benign g.25300837G>A g.25320201G>A ABHD12(NM_001042472.3):c.540C>T (p.T180=) - PYGB_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.542+3G>A r.spl? p.? - likely benign g.25300832C>T - ABHD12(NM_001042472.3):c.542+3G>A - PYGB_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.556C>T r.(?) p.(Arg186Cys) - VUS g.25297701G>A g.25317065G>A ABHD12(NM_001042472.3):c.556C>T (p.R186C) - PYGB_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.557G>C r.(?) p.(Arg186Pro) - pathogenic g.25297700C>G g.25317064C>G - - ABHD12_000007 - PubMed: Nishiguchi 2014 ClinVar-RCV000132769.3 rs587777604 Germline - - - 0 - Lonneke Haer-Wigman
?/. - c.557G>C r.(?) p.(Arg186Pro) - VUS g.25297700C>G g.25317064C>G - - ABHD12_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/. - c.557G>C r.(?) p.(Arg186Pro) - pathogenic g.25297700C>G g.25317064C>G - - ABHD12_000007 - PubMed: Haer-Wigman 2017 - - Germline - - - 0 - LOVD
?/. - c.578T>A r.(?) p.(Leu193Gln) - VUS g.25295602A>T g.25314966A>T ABHD12(NM_001042472.3):c.578T>A (p.L193Q) - PYGB_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.605C>T r.(?) p.(Thr202Ile) - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.605C>T r.(?) p.(Thr202Ile) - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.605C>T r.(?) p.(Thr202Ile) - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.605C>T r.(?) p.(Thr202Ile) - pathogenic g.25295575G>A g.25314939G>A - - ABHD12_000034 - PubMed: Nishiguchi 2014 - - Germline yes - - 0 - Johan den Dunnen
+/. - c.620-2A>G r.spl? p.? - pathogenic (recessive) g.25290213T>C - 20:25290213T>C ENST00000376542.3:c.620-2A>G - ABHD12_000044 - PubMed: Carss 2017 - - Germline - - - 0 - LOVD
+?/. - c.620-2A>G r.spl p.(?) - likely pathogenic g.25290213T>C g.25309577T>C ABHD12 c.620-2A>G, - ABHD12_000044 homozygous PubMed: Turro 2020 - - Germline/De novo (untested) ? - - 0 - LOVD
-?/. - c.726C>T r.(?) p.(Ile242=) - likely benign g.25290105G>A - ABHD12(NM_001042472.3):c.726C>T (p.I242=) - PYGB_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.750-2A>G r.spl? p.? - VUS g.25289132T>C g.25308496T>C ABHD12(NM_001042472.3):c.750-2A>G - ABHD12_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. 8 c.758C>G r.(?) p.(Thr253Arg) - pathogenic g.25289122G>C g.25308486G>C - - ABHD12_000039 - PubMed: Tingaud-Sequeira 2017 - - Germline yes - - 0 - Johan den Dunnen
?/. - c.769C>T r.(?) p.(Arg257Trp) - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.769C>T r.(?) p.(Arg257Trp) - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
?/. - c.769C>T r.(?) p.(Arg257Trp) - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.769C>T r.(?) p.(Arg257Trp) - VUS g.25289111G>A g.25308475G>A ABHD12(NM_001042472.3):c.769C>T (p.R257W) - ABHD12_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.769C>T r.(?) p.(Arg257Trp) - VUS g.25289111G>A g.25308475G>A - - ABHD12_000017 conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs41306784 Germline - 2/2795 individuals - 0 - Mohammed Faruq
+/. 8 c.784C>T r.(?) p.(Arg262*) - pathogenic g.25289096G>A - c.784C > T, p.Arg262* - ABHD12_000053 - - - - Germline - - - 0 - LOVD
+/. 8 c.784C>T r.(?) p.(Arg262*) - pathogenic g.25289096G>A - c.784C > T, p.Arg262* - ABHD12_000053 - - - - Germline - - - 0 - LOVD
-?/. - c.787+3G>A r.spl? p.? - likely benign g.25289090C>T - ABHD12(NM_001042472.3):c.787+3G>A - PYGB_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.788-10_788-7del r.(=) p.(=) - likely benign g.25288693_25288696del g.25308057_25308060del ABHD12(NM_001042472.3):c.788-10_788-7delGTTT - PYGB_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.837C>T r.(?) p.(Arg279=) - benign g.25288632G>A g.25307996G>A ABHD12(NM_001042472.3):c.837C>T (p.R279=) - ABHD12_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.837C>T r.(?) p.(Arg279=) - benign g.25288632G>A g.25307996G>A ABHD12(NM_001042472.3):c.837C>T (p.R279=) - ABHD12_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
Legend   How to query   « First ‹ Prev     1 2     Next › Last »