Unique variants in the ALDH5A1 gene

Information The variants shown are described using the transcript reference sequence.

125 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. 1 - c.-65883del r.(?) p.(=) - VUS g.24429342del g.24429114del GPLD1(NM_001503.3):c.2442del (p.(Val815SerfsTer47)) - GPLD1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-57828C>T r.(?) p.(=) - VUS g.24437397C>T - GPLD1(NM_001503.3):c.2141G>A (p.R714H) - ALDH5A1_006169 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-48138G>A r.(?) p.(=) - VUS g.24447087G>A g.24446859G>A GPLD1(NM_001503.3):c.1799C>T (p.(Pro600Leu)) - GPLD1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-48059C>T r.(?) p.(=) - likely benign g.24447166C>T g.24446938C>T GPLD1(NM_001503.3):c.1720G>A (p.E574K) - ALDH5A1_006132 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-45167C>T r.(?) p.(=) - VUS g.24450058C>T g.24449830C>T GPLD1(NM_001503.3):c.1405G>A (p.V469M) - ALDH5A1_006133 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-40933_-40913del r.(?) p.(=) - likely benign g.24454292_24454312del g.24454064_24454084del GPLD1(NM_001503.3):c.1274_1294delGCCTGCCACCTGTTGACCTGG (p.G425_L431del) - ALDH5A1_006134 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-40832G>A r.(?) p.(=) - likely benign g.24454393G>A g.24454165G>A GPLD1(NM_001503.3):c.1185C>T (p.H395=) - ALDH5A1_006135 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-11T>C r.(?) p.(=) - VUS g.24495214T>C g.24494986T>C ALDH5A1(NM_170740.1):c.-11T>C - ALDH5A1_000116 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/+ 1 _1_10_ c.0 r.0 p.0 - pathogenic (recessive) g.(?_24405120)_(24557191_?)del - 24405120 to 24557191 del - ALDH5A1_006129 0.15-Mb deletion on chromosome 6p22.3 PubMed: Li 2015 - - Germline - - - - - Gajja Salomons
-/. 1 - c.10T>G r.(?) p.(Cys4Gly) - benign g.24495234T>G g.24495006T>G ALDH5A1(NM_170740.1):c.10T>G (p.C4G) - ALDH5A1_000117 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/+ 2 1 c.34dup r.(?) p.(Ala12fs*123) - pathogenic (recessive) g.24495258dup g.24495030dup - - ALDH5A1_006002 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 1 c.103_121del r.(?) p.(Ser35fs*49) - pathogenic (recessive) g.24495327_24495345del g.24495099_24495117del - - ALDH5A1_006003 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
-/-, -?/. 3 1 c.106G>C r.(?) p.(Gly36Arg), p.(Val36Leu) - benign, likely benign g.24495330G>C g.24495102G>C ALDH5A1(NM_001080.3):c.106G>C (p.(Gly36Arg)) - ALDH5A1_006130 VKGL data sharing initiative Nederland PubMed: 27056292 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Leiden, Gajja Salomons
+/+ 1 1 c.123_127dup r.(?) p.(Gln43Argfs*50) - pathogenic (recessive) g.24495347_24495351dup g.24495119_24495123dup 127_128InsGGCCC (L31PfsX62) - ALDH5A1_006090 - PubMed: Li 2015 - - Germline - - - - - Gajja Salomons
-?/. 1 - c.130C>G r.(?) p.(Leu44Val) - likely benign g.24495354C>G - ALDH5A1(NM_170740.1):c.130C>G (p.L44V) - ALDH5A1_006172 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+ 2 1 c.164_165del r.(?) p.(Ser55CysfsTer80) - pathogenic (recessive) g.24495388_24495389del g.24495160_24495161del - - ALDH5A1_006009 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
?/. 1 - c.175C>T r.(?) p.(Leu59=) - VUS g.24495399C>T - ALDH5A1(NM_170740.1):c.175C>T (p.L59=) - ALDH5A1_006174 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+ 2 1 c.235C>T r.(?) p.(Gln79*) - pathogenic (recessive) g.24495459C>T g.24495231C>T - - ALDH5A1_006011 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/. 1 1 c.275A>G - p.Asp92Gly - NA g.24495499A>G - - - ALDH5A1_006147 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/. 1 1 c.277T>C - p.Cys93Arg - NA g.24495501T>C - - - ALDH5A1_006148 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+ 45 1 c.278G>T r.(?) p.(Cys93Phe) - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 1 c.278_298dup r.(?) p.(Cys93_Arg99dup) - pathogenic (recessive) g.24495502_24495522dup g.24495274_24495294dup - - ALDH5A1_006016 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 1 c.290_310dup r.(?) p.(Glu97_Arg103dup) - pathogenic (recessive) g.24495514_24495534dup g.24495286_24495306dup - - ALDH5A1_006123 - PubMed: Lin 2015 - - Germline - - - - - Gajja Salomons
+/+ 5 1 c.336G>A r.(?) p.(Trp112*) - pathogenic (recessive) g.24495560G>A g.24495332G>A 366delG (W112fsX112) - ALDH5A1_006017 - PubMed: Yamakawa 2012 - - Germline - - - - - Gajja Salomons
?/. 2 1 c.354G>C -, r.(?) p.(Lys118Asn), p.Lys118Asn - NA, VUS g.24495578G>C g.24495350G>C ALDH5A1(NM_001080.3):c.354G>C (p.(Lys118Asn)) - ALDH5A1_000118, ALDH5A1_006149 overexpression in HEK293 cells showed normal SSADH activity. This variant may affect splicing., 1 more item PubMed: Popp 2020, Journal: Pop 2020 - - CLASSIFICATION record, In vitro (cloned) - - - - - VKGL-NL_Leiden, Gajja Salomons
+/+ 1 1i_5i c.356_870+1del r.355_870del p.(Glu119_Lys290del) - pathogenic (recessive) g.24502752_24515539del g.24502524_24515311del r.EX2_EX5del (E119K290del) - ALDH5A1_006087 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/. 1 2 c.371T>G - p.Leu124Arg - NA g.24502767T>G - - - ALDH5A1_006150 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+ 2 2 c.384C>G r.(?) p.(Tyr128*) - pathogenic (recessive) g.24502780C>G g.24502552C>G - - ALDH5A1_006021 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 2 c.400_401del r.(?) p.(Asn134Met) - pathogenic (recessive) g.24502796_24502797del g.24502568_24502569del 398_399delAA - ALDH5A1_006114 - PubMed: Shu 2017 - - Germline - - - - - Gajja Salomons
+?/. 1 2 c.431C>A - p.Ala144Asp - NA g.24502827C>A - - - ALDH5A1_006151 overexpression in HEK293 cells showed reduced SSADH activity: see discussion in article PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+ 5 2i c.438+1G>A r.spl p.? - pathogenic (recessive) g.24502835G>A g.24502607G>A IVS2+1G>A - ALDH5A1_006023 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 8 3 c.455_456dup r.(?) p.(Ala153fs*12) - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 2 3 c.461_474del r.(?) p.(His154LeufsTer11) - pathogenic (recessive) g.24503513_24503526del g.24503285_24503298del - - ALDH5A1_006027 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 3 c.496T>C r.(?) p.(Trp166Arg) - pathogenic (recessive) g.24503548T>C g.24503320T>C - - ALDH5A1_006120 - PubMed: Liu 2016 - - Germline - - - - - Gajja Salomons
+/+ 6 3 c.526G>A r.(?) p.(Gly176Arg) - pathogenic (recessive) g.24503578G>A g.24503350G>A - - ALDH5A1_006029 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 3 c.527G>A r.(?) p.(Gly176Glu) - pathogenic (recessive) g.24503579G>A g.24503351G>A - - ALDH5A1_006111 - PubMed: Jiang 2013 - - Germline - - - - - Gajja Salomons
-?/. 1 - c.532A>G r.(?) p.(Ile178Val) - likely benign g.24503584A>G - ALDH5A1(NM_170740.1):c.532A>G (p.I178V) - ALDH5A1_006170 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 3 c.536T>A - p.Ile179Asn - NA g.24503588T>A - - - ALDH5A1_006152 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
-/-, -/. 3 ? c.538C>T r.(?) p.(Arg180Cys), p.(His180Tyr) - benign g.24503590C>T g.24503362C>T ALDH5A1(NM_170740.1):c.538C>T (p.H180Y) - ALDH5A1_000119 VKGL data sharing initiative Nederland PubMed: 27056292 - - CLASSIFICATION record, Germline - - - - - Gajja Salomons, VKGL-NL_Groningen
-/-, -?/. 3 ? c.545C>T r.(?) p.(Pro182Leu), p.(Ser182Phe) - benign, likely benign g.24503597C>T g.24503369C>T ALDH5A1(NM_001080.3):c.545C>T (p.(Pro182Leu)) - ALDH5A1_006131 VKGL data sharing initiative Nederland PubMed: 27056292 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Leiden, Gajja Salomons
+/. 1 3 c.559C>G - p.Arg187Gly - NA g.24503611C>G - - - ALDH5A1_006153 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+ 2 3 c.574A>T r.(?) p.(Lys192*) - pathogenic (recessive) g.24503626A>T g.24503398A>T - - ALDH5A1_006034 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/. 1 3 c.581C>T - p.Pro194Leu - NA g.24503633C>T - - - ALDH5A1_006154 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
-?/., ?/. 2 - c.583A>G r.(?) p.(Ile195Val) - likely benign, VUS g.24503635A>G g.24503407A>G ALDH5A1(NM_001080.3):c.583A>G (p.(Ile195Val)), ALDH5A1(NM_170740.1):c.583A>G (p.I195V) - ALDH5A1_006136 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - c.584T>C r.(?) p.(Ile195Thr) - VUS g.24503636T>C - ALDH5A1(NM_170740.1):c.584T>C (p.I195T) - ALDH5A1_006175 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+, +?/. 2 3 c.589G>A r.(?) p.(Val197Met) - likely pathogenic, pathogenic (recessive) g.24503641G>A g.24503413G>A ALDH5A1(NM_170740.1):c.589G>A (p.V197M) - ALDH5A1_006121 VKGL data sharing initiative Nederland PubMed: Liu 2016 - - CLASSIFICATION record, Germline - - - - - Gajja Salomons, VKGL-NL_Groningen
?/. 1 - c.605C>T r.(?) p.(Thr202Ile) - VUS g.24503657C>T - ALDH5A1(NM_170740.1):c.605C>T (p.T202I) - ALDH5A1_006173 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.606C>A r.(?) p.(Thr202=) - likely benign g.24503658C>A g.24503430C>A ALDH5A1(NM_170740.1):c.606C>A (p.T202=) - ALDH5A1_006143 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 3 c.608C>G - p.Pro203Arg - NA g.24503660C>G - - - ALDH5A1_006155 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+, ?/. 2 3 c.608C>T r.(?) p.(Pro203Leu) - pathogenic (recessive), VUS g.24503660C>T g.24503432C>T - - ALDH5A1_006088 - PubMed: Ganapathy 2019 - rs906284769 Germline - - - - - Johan den Dunnen, Gajja Salomons
+/+ 4 3i c.610-2A>G r.439_452del p.? - pathogenic (recessive) g.24505095A>G g.24504867A>G IVS3-2A>G - ALDH5A1_006038 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+, +/. 46 4 c.612G>A r.(?) p.(Trp204*), p.(Trp204Ter) - pathogenic, pathogenic (recessive) g.24505099G>A g.24504871G>A - - ALDH5A1_006039 no variant 2nd allele identified PubMed: Akaboshi 2003 - rs118203982 Germline, Unknown - - - - - Gajja Salomons, MobiDetails
+/. 1 4 c.620C>T - p.Pro207Leu - NA g.24505107C>T - - - ALDH5A1_006156 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+, +/. 20 4 c.621del r.(?) p.(Ser208Valfs*3) - pathogenic, pathogenic (recessive) g.24505108del g.24504880del ALDH5A1(NM_170740.1):c.621delC (p.S208Vfs*3) - ALDH5A1_006041 VKGL data sharing initiative Nederland PubMed: Akaboshi 2003 - - CLASSIFICATION record, Germline - - - - - Gajja Salomons, VKGL-NL_VUmc
+/. 1 4 c.622A>C - p.Ser208Arg - NA g.24505109A>C - - - ALDH5A1_006157 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/. 1 4 c.637C>G - p.Arg213Gly - NA g.24505124C>G - - - ALDH5A1_006158 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+ 1 4 c.638G>T r.(?) p.(Arg213Leu) - pathogenic (recessive) g.24505125G>T g.24504897G>T - - ALDH5A1_006113 - PubMed: Shu 2017 - - Germline - - - - - Gajja Salomons
+/. 1 4 c.653C>A - p.Ala218Asp - NA g.24505140C>A - - - ALDH5A1_006159 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+ 12 4 c.668G>A r.(?) p.(Cys223Tyr) - pathogenic (recessive) g.24505155G>A g.24504927G>A - - ALDH5A1_006046 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 4 c.675_680del r.(?) p.(Val226Val227del) - pathogenic (recessive) g.24505162_24505167del g.24504934_24504939del - - ALDH5A1_006124 - PubMed: Lin 2015 - - Germline - - - - - Gajja Salomons
-/., -?/. 2 - c.678G>C r.(?) p.(Val226=) - benign, likely benign g.24505165G>C g.24504937G>C ALDH5A1(NM_170740.1):c.678G>C (p.V226=) - ALDH5A1_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+/. 1 4 c.685C>T - p.Pro229Ser - NA g.24505172C>T - - - ALDH5A1_006160 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+ 1 3 c.691G>A r.(?) p.(Asn231Asp) - pathogenic (recessive) g.24505178G>A g.24504950G>A - - ALDH5A1_006112 - PubMed: Jiang 2013 - - Germline - - - - - Gajja Salomons
+/+, +?/. 27 4 c.698C>T r.(?) p.(Thr233Met) - likely pathogenic (recessive), pathogenic (recessive) g.24505185C>T g.24504957C>T - - ALDH5A1_006048 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons, Alejandro Brea-Fernández
+?/. 1 - c.700C>T r.(?) p.(Pro234Ser) - likely pathogenic g.24505187C>T - - - ALDH5A1_006178 - - - rs1386328721 Unknown - - - - - MobiDetails
+?/., ?/. 2 4 c.709G>A -, r.(?) p.(Ala237Thr), p.Ala237Thr - NA, VUS g.24505196G>A - ALDH5A1(NM_170740.1):c.709G>A (p.A237T) - ALDH5A1_006049, ALDH5A1_006161 overexpression in HEK293 cells showed reduced SSADH activity: see discussion in article, 1 more item PubMed: Popp 2020, Journal: Pop 2020 - - CLASSIFICATION record, In vitro (cloned) - - - - - Gajja Salomons, VKGL-NL_Rotterdam
+/+, -/. 2 4 c.709G>T r.(?) p.(Ala237Ser) - benign, pathogenic (recessive) g.24505196G>T g.24504968G>T - - ALDH5A1_006115 47 heterozygous, no homozygous; Clinindb (India) PubMed: Akaboshi 2003, PubMed: Narang 2020, Journal: Narang 2020 - rs62621664 Germline - 47/2794 individuals - - - Gajja Salomons, Mohammed Faruq
-?/. 1 - c.726+7C>T r.(=) p.(=) - likely benign g.24505220C>T g.24504992C>T ALDH5A1(NM_170740.1):c.726+7C>T - ALDH5A1_006139 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.726+8G>A r.(=) p.(=) - benign g.24505221G>A g.24504993G>A ALDH5A1(NM_170740.1):c.726+8G>A - ALDH5A1_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 5 c.754G>T - p.Gly252Cys - NA g.24515422G>T - - - ALDH5A1_006162 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/. 1 5 c.755G>T - p.Gly252Val - NA g.24515423G>T - - - ALDH5A1_006163 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
+/+ 1 5 c.764A>G r.(?) p.(Asn255Ser) - pathogenic (recessive) g.24515432A>G g.24515204A>G - - ALDH5A1_006053 no variant 2nd allele identified PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 3 5 c.781C>T r.(?) p.(Arg261*) - pathogenic (recessive) g.24515449C>T g.24515221C>T - - ALDH5A1_006054 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 33 5 c.803G>A r.(?) p.(Gly268Glu) - pathogenic (recessive) g.24515471G>A g.24515243G>A - - ALDH5A1_006055 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 6 c.819del r.(?) p.(Asp274Ilefs*27) - pathogenic (recessive) g.24515487del g.24515259del 858delT - ALDH5A1_006128 - - - - Germline - - - - - Gajja Salomons
+/. 1 5 c.851G>A - p.Gly284Asp - NA g.24515519G>A - - - ALDH5A1_006164 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - Gajja Salomons
?/. 2 - c.862A>G r.(?) p.(Thr288Ala) - VUS g.24515530A>G g.24515302A>G ALDH5A1(NM_170740.1):c.901A>G (p.T301A) - ALDH5A1_006144 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+/+ 2 5i c.870+1G>A r.spl p.? - pathogenic (recessive) g.24515539G>A g.24515311G>A IVS5+1G>A - ALDH5A1_006057 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 5 5i c.870+1G>T r.spl p.? - pathogenic (recessive) g.24515539G>T g.24515311G>T IVS5+1G>T - ALDH5A1_006057 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
-?/. 1 - c.871-6T>C r.(=) p.(=) - likely benign g.24520623T>C g.24520395T>C ALDH5A1(NM_001080.3):c.871-6T>C (p.(=)) - ALDH5A1_006145 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.885C>T r.(?) p.(His295=) - likely benign g.24520643C>T g.24520415C>T ALDH5A1(NM_170740.1):c.924C>T (p.H308=) - ALDH5A1_000123 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/+ 1 6 c.901A>G r.(?) p.(Lys301Glu) - pathogenic (recessive) g.24520659A>G g.24520431A>G - - ALDH5A1_006116 - PubMed: P¸ttmann 2013 - - Germline - - - - - Gajja Salomons
-/., -?/., ?/. 3 - c.961G>A r.(?) p.(Val321Met) - benign, likely benign, VUS g.24520719G>A g.24520491G>A ALDH5A1(NM_170740.1):c.1000G>A (p.V334M) - ALDH5A1_000124 conflicting interpretations of pathogenicity; 4 heterozygous, no homozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs115784602 CLASSIFICATION record, Germline - 4/2794 individuals - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen, Mohammed Faruq
+/+ 1 6 c.1005C>A r.(?) p.(Asn335Lys) - pathogenic (recessive) g.24520763C>A g.24520535C>A - - ALDH5A1_006060 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 4 6i c.1015-2A>C r.spl p.? - pathogenic (recessive) g.24522993A>C g.24522765A>C IVS6-2A>C - ALDH5A1_006062 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/. 1 - c.1045C>T r.(?) p.(Gln349*) - pathogenic (recessive) g.24523025C>T g.24522797C>T NM_170740.1:c.1084C>T - ALDH5A1_006064 - PubMed: Froukh 2020 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.1080C>T r.(?) p.(Phe360=) - likely benign g.24523060C>T g.24522832C>T ALDH5A1(NM_170740.1):c.1119C>T (p.F373=) - ALDH5A1_006140 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - c.1106G>A r.(?) p.(Arg369His) - likely benign, VUS g.24523086G>A g.24522858G>A ALDH5A1(NM_170740.1):c.1145G>A (p.R382H) - ALDH5A1_006141 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+/+ 6 7 c.1145C>A r.(?) p.(Pro382Gln) - pathogenic (recessive) g.24523125C>A g.24522897C>A - - ALDH5A1_006066 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 7 c.1145C>T r.(?) p.(Pro382Leu) - pathogenic (recessive) g.24523125C>T g.24522897C>T - - ALDH5A1_006065 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
?/. 1 - c.1163C>T r.(?) p.(Ala388Val) - VUS g.24523143C>T g.24522915C>T ALDH5A1(NM_001080.3):c.1163C>T (p.(Ala388Val)) - ALDH5A1_000125 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1164G>C r.(?) p.(Ala388=) - likely benign g.24523144G>C g.24522916G>C ALDH5A1(NM_170740.1):c.1203G>C (p.A401=) - ALDH5A1_000126 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 - c.1173+1G>T r.spl? p.? - pathogenic g.24523154G>T - ALDH5A1(NM_170740.1):c.1212+1G>T - ALDH5A1_006176 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1198G>A r.(?) p.(Val400Ile) - likely benign g.24528249G>A g.24528021G>A ALDH5A1(NM_170740.1):c.1237G>A (p.V413I) - ALDH5A1_006146 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1216G>A r.(?) p.(Val406Ile) - likely benign g.24528267G>A g.24528039G>A ALDH5A1(NM_170740.1):c.1255G>A (p.V419I) - ALDH5A1_000127 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/+, +/., ?/. 59 8 c.1226G>A r.(?) p.(Gly409Asp) - pathogenic, pathogenic (recessive), VUS g.24528277G>A g.24528049G>A ALDH5A1(NM_001080.3):c.1226G>A (p.(Gly409Asp)) - ALDH5A1_006067 1 heterozygous, no homozygous; Clinindb (India), VKGL data sharing initiative Nederland PubMed: Akaboshi 2003, PubMed: Leo 2017, PubMed: Narang 2020, Journal: Narang 2020 - rs118203984 CLASSIFICATION record, Germline - 1/2795 individuals - - - VKGL-NL_Leiden, Gajja Salomons, Mohammed Faruq
+/+ 46 8 c.1234C>T r.(?) p.(Arg412*) - pathogenic (recessive) g.24528285C>T g.24528057C>T - - ALDH5A1_006068 - PubMed: Akaboshi 2003 - - Germline - - - - - Gajja Salomons
+/+ 1 8 c.1274T>C r.(?) p.(Leu425Pro) - pathogenic (recessive) g.24528325T>C g.24528097T>C 1313T>C - ALDH5A1_006119 - PubMed: Li 2015 - - Germline - - - - - Gajja Salomons
?/. 1 - c.1280A>G r.(?) p.(Asn427Ser) - VUS g.24528331A>G g.24528103A>G - - ALDH5A1_000132 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/+ 1 8 c.1294A>C r.(?) p.(Met432Leu) - pathogenic (recessive) g.24528345A>C g.24528117A>C - - ALDH5A1_006117 - PubMed: Yamakawa 2012 - - Germline - - - - - Gajja Salomons
Legend   How to query   « First ‹ Prev     1 2     Next › Last »