Full data view for gene ALDH5A1

Information The variants shown are described using the transcript reference sequence.

540 entries on 6 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
?/. - c.-65883del r.(?) p.(=) Unknown - VUS g.24429342del g.24429114del GPLD1(NM_001503.3):c.2442del (p.(Val815SerfsTer47)) - GPLD1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-57828C>T r.(?) p.(=) Unknown - VUS g.24437397C>T - GPLD1(NM_001503.3):c.2141G>A (p.R714H) - ALDH5A1_006169 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-48138G>A r.(?) p.(=) Unknown - VUS g.24447087G>A g.24446859G>A GPLD1(NM_001503.3):c.1799C>T (p.(Pro600Leu)) - GPLD1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-48059C>T r.(?) p.(=) Unknown - likely benign g.24447166C>T g.24446938C>T GPLD1(NM_001503.3):c.1720G>A (p.E574K) - ALDH5A1_006132 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-45167C>T r.(?) p.(=) Unknown - VUS g.24450058C>T g.24449830C>T GPLD1(NM_001503.3):c.1405G>A (p.V469M) - ALDH5A1_006133 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-40933_-40913del r.(?) p.(=) Unknown - likely benign g.24454292_24454312del g.24454064_24454084del GPLD1(NM_001503.3):c.1274_1294delGCCTGCCACCTGTTGACCTGG (p.G425_L431del) - ALDH5A1_006134 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-40832G>A r.(?) p.(=) Unknown - likely benign g.24454393G>A g.24454165G>A GPLD1(NM_001503.3):c.1185C>T (p.H395=) - ALDH5A1_006135 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-11T>C r.(?) p.(=) Unknown - VUS g.24495214T>C g.24494986T>C ALDH5A1(NM_170740.1):c.-11T>C - ALDH5A1_000116 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ _1_10_ c.0 r.0 p.0 Parent #1 - pathogenic (recessive) g.(?_24405120)_(24557191_?)del - 24405120 to 24557191 del - ALDH5A1_006129 0.15-Mb deletion on chromosome 6p22.3 PubMed: Li 2015 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Li 2015 - M - China - - - - - 1 Gajja Salomons
-/. - c.10T>G r.(?) p.(Cys4Gly) Unknown - benign g.24495234T>G g.24495006T>G ALDH5A1(NM_170740.1):c.10T>G (p.C4G) - ALDH5A1_000117 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 1 c.34dup r.(?) p.(Ala12fs*123) Parent #1 - pathogenic (recessive) g.24495258dup g.24495030dup - - ALDH5A1_006002 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.34dup r.(?) p.(Ala12fs*123) Parent #2 - pathogenic (recessive) g.24495258dup g.24495030dup - - ALDH5A1_006002 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.103_121del r.(?) p.(Ser35fs*49) Parent #1 - pathogenic (recessive) g.24495327_24495345del g.24495099_24495117del - - ALDH5A1_006003 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Japan - - - - - 1 Gajja Salomons
-/- 1 c.106G>C r.(?) p.(Val36Leu) Parent #2 - benign g.24495330G>C g.24495102G>C - - ALDH5A1_006130 - PubMed: 27056292 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: 27056292 - M - Japan - - - - - 1 Gajja Salomons
-/- 1 c.106G>C r.(?) p.(Val36Leu) Parent #1 - benign g.24495330G>C g.24495102G>C - - ALDH5A1_006130 - PubMed: 27056292 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: 27056292 - F - Japan - - - - - 1 Gajja Salomons
-?/. - c.106G>C r.(?) p.(Gly36Arg) Unknown - likely benign g.24495330G>C g.24495102G>C ALDH5A1(NM_001080.3):c.106G>C (p.(Gly36Arg)) - ALDH5A1_006130 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 1 c.123_127dup r.(?) p.(Gln43Argfs*50) Parent #1 - pathogenic (recessive) g.24495347_24495351dup g.24495119_24495123dup 127_128InsGGCCC (L31PfsX62) - ALDH5A1_006090 - PubMed: Li 2015 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Li 2015 - F - - - - - - - 1 Gajja Salomons
-?/. - c.130C>G r.(?) p.(Leu44Val) Unknown - likely benign g.24495354C>G - ALDH5A1(NM_170740.1):c.130C>G (p.L44V) - ALDH5A1_006172 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 1 c.164_165del r.(?) p.(Ser55CysfsTer80) Parent #2 - pathogenic (recessive) g.24495388_24495389del g.24495160_24495161del - - ALDH5A1_006009 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - - - - - - - 1 Gajja Salomons
+/+ 1 c.164_165del r.(?) p.(Ser55CysfsTer80) Parent #2 - pathogenic (recessive) g.24495388_24495389del g.24495160_24495161del - - ALDH5A1_006009 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Italy - - - - - 1 Gajja Salomons
?/. - c.175C>T r.(?) p.(Leu59=) Unknown - VUS g.24495399C>T - ALDH5A1(NM_170740.1):c.175C>T (p.L59=) - ALDH5A1_006174 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/+ 1 c.235C>T r.(?) p.(Gln79*) Parent #1 - pathogenic (recessive) g.24495459C>T g.24495231C>T - - ALDH5A1_006011 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - New Caledonia - - - - - 1 Gajja Salomons
+/+ 1 c.235C>T r.(?) p.(Gln79*) Parent #2 - pathogenic (recessive) g.24495459C>T g.24495231C>T - - ALDH5A1_006011 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - New Caledonia - - - - - 1 Gajja Salomons
+/. 1 c.275A>G - p.Asp92Gly Unknown - NA g.24495499A>G - - - ALDH5A1_006147 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - - - - - - - - - - - - - - - - - - -
+/. 1 c.277T>C - p.Cys93Arg Unknown - NA g.24495501T>C - - - ALDH5A1_006148 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - - - - - - - - - - - - - - - - - - -
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Turkey - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Turkey - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - India - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - - - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - United States - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - United States - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - United States - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - F - United States - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - M - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - M - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - Argentina - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - Argentina - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - Argentina - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - - - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - - - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - F - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - F - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - - - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - - - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - France - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - France - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - M - Italy - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Germany - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Germany - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - Italy - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - Italy - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - M - Spain - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - Italy - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - M - Italy - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #2 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - M - Italy - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - United Kingdom (Great Britain) - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Both (homozygous) - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - Sweden - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - M - Greece - - - - - 1 Gajja Salomons
+/+ 1 c.278G>T r.(?) p.(Cys93Phe) Parent #1 - pathogenic (recessive) g.24495502G>T g.24495274G>T - - ALDH5A1_006015 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - Greece - - - - - 1 Gajja Salomons
+/+ 1 c.278_298dup r.(?) p.(Cys93_Arg99dup) Parent #1 - pathogenic (recessive) g.24495502_24495522dup g.24495274_24495294dup - - ALDH5A1_006016 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Greece - - - - - 1 Gajja Salomons
+/+ 1 c.290_310dup r.(?) p.(Glu97_Arg103dup) Parent #1 - pathogenic (recessive) g.24495514_24495534dup g.24495286_24495306dup - - ALDH5A1_006123 - PubMed: Lin 2015 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Lin 2015 - M - Taiwan - - - - - 1 Gajja Salomons
+/+ 1 c.336G>A r.(?) p.(Trp112*) Parent #1 - pathogenic (recessive) g.24495560G>A g.24495332G>A 366delG (W112fsX112) - ALDH5A1_006017 - PubMed: Yamakawa 2012 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Yamakawa 2012 - M - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.336G>A r.(?) p.(Trp112*) Parent #2 - pathogenic (recessive) g.24495560G>A g.24495332G>A 366delG (W112fsX112) - ALDH5A1_006017 - PubMed: Yamakawa 2012 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Yamakawa 2012 - M - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.336G>A r.(?) p.(Trp112*) Parent #1 - pathogenic (recessive) g.24495560G>A g.24495332G>A 366delG (W112fsX112) - ALDH5A1_006017 - PubMed: Yamakawa 2012 - - Germline - - - - - DNA SEQ - - ? - PubMed: Yamakawa 2012 - F - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.336G>A r.(?) p.(Trp112*) Parent #1 - pathogenic (recessive) g.24495560G>A g.24495332G>A 366delG (W112fsX112) - ALDH5A1_006017 - PubMed: Yamakawa 2012 - - Germline - - - - - DNA SEQ - - ? - PubMed: Yamakawa 2012 - M - Canada - - - - - 1 Gajja Salomons
+/+ 1 c.336G>A r.(?) p.(Trp112*) Parent #1 - pathogenic (recessive) g.24495560G>A g.24495332G>A 366delG (W112fsX112) - ALDH5A1_006017 - PubMed: Yamakawa 2012 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Yamakawa 2012 - M - Japan - - - - - 1 Gajja Salomons
?/. - c.354G>C r.(?) p.(Lys118Asn) Unknown - VUS g.24495578G>C g.24495350G>C ALDH5A1(NM_001080.3):c.354G>C (p.(Lys118Asn)) - ALDH5A1_000118 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 1 c.354G>C - p.Lys118Asn Unknown - NA g.24495578G>C - - - ALDH5A1_006149 overexpression in HEK293 cells showed normal SSADH activity. This variant may affect splicing. PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - - - - - - - - - - - - - - - - - - -
+/+ 1i_5i c.356_870+1del r.355_870del p.(Glu119_Lys290del) Parent #2 - pathogenic (recessive) g.24502752_24515539del g.24502524_24515311del r.EX2_EX5del (E119K290del) - ALDH5A1_006087 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Sweden - - - - - 1 Gajja Salomons
+/. 2 c.371T>G - p.Leu124Arg Unknown - NA g.24502767T>G - - - ALDH5A1_006150 overexpression in HEK293 cells showed severely impaired SSADH activity (below 15%) PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - - - - - - - - - - - - - - - - - - -
+/+ 2 c.384C>G r.(?) p.(Tyr128*) Parent #1 - pathogenic (recessive) g.24502780C>G g.24502552C>G - - ALDH5A1_006021 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - - Inuit - - - - 1 Gajja Salomons
+/+ 2 c.384C>G r.(?) p.(Tyr128*) Parent #2 - pathogenic (recessive) g.24502780C>G g.24502552C>G - - ALDH5A1_006021 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - - Inuit - - - - 1 Gajja Salomons
+/+ 2 c.400_401del r.(?) p.(Asn134Met) Parent #2 - pathogenic (recessive) g.24502796_24502797del g.24502568_24502569del 398_399delAA - ALDH5A1_006114 - PubMed: Shu 2017 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Shu 2017 - F - China - - - - - 1 Gajja Salomons
+?/. 2 c.431C>A - p.Ala144Asp Unknown - NA g.24502827C>A - - - ALDH5A1_006151 overexpression in HEK293 cells showed reduced SSADH activity: see discussion in article PubMed: Popp 2020, Journal: Pop 2020 - - In vitro (cloned) - - - - - - - - - - - - - - - - - - - - - - -
+/+ 2i c.438+1G>A r.spl p.? Parent #2 - pathogenic (recessive) g.24502835G>A g.24502607G>A IVS2+1G>A - ALDH5A1_006023 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003, PubMed: Leo 2017 - - - Greece - - - - - 1 Gajja Salomons
+/+ 2i c.438+1G>A r.spl p.? Parent #2 - pathogenic (recessive) g.24502835G>A g.24502607G>A IVS2+1G>A - ALDH5A1_006023 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003, PubMed: Leo 2017 - M - Greece - - - - - 1 Gajja Salomons
+/+ 2i c.438+1G>A r.spl p.? Parent #1 - pathogenic (recessive) g.24502835G>A g.24502607G>A IVS2+1G>A - ALDH5A1_006023 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - Greece - - - - - 1 Gajja Salomons
+/+ 2i c.438+1G>A r.spl p.? Parent #2 - pathogenic (recessive) g.24502835G>A g.24502607G>A IVS2+1G>A - ALDH5A1_006023 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003, PubMed: Leo 2017 - - - Greece - - - - - 1 Gajja Salomons
+/+ 2i c.438+1G>A r.spl p.? Parent #2 - pathogenic (recessive) g.24502835G>A g.24502607G>A IVS2+1G>A - ALDH5A1_006023 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003, PubMed: Leo 2017 - - - Greece - - - - - 1 Gajja Salomons
+/+ 3 c.455_456dup r.(?) p.(Ala153fs*12) Parent #1 - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - - - - - - - 1 Gajja Salomons
+/+ 3 c.455_456dup r.(?) p.(Ala153fs*12) Parent #2 - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - - - - - - - 1 Gajja Salomons
+/+ 3 c.455_456dup r.(?) p.(Ala153fs*12) Parent #1 - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - Netherlands - - - - - 1 Gajja Salomons
+/+ 3 c.455_456dup r.(?) p.(Ala153fs*12) Parent #2 - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - F - Netherlands - - - - - 1 Gajja Salomons
+/+ 3 c.455_456dup r.(?) p.(Ala153fs*12) Parent #1 - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - F - Netherlands - - - - - 1 Gajja Salomons
+/+ 3 c.455_456dup r.(?) p.(Ala153fs*12) Parent #1 - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - M - Netherlands - - - - - 1 Gajja Salomons
+/+ 3 c.455_456dup r.(?) p.(Ala153fs*12) Parent #1 - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - F - Netherlands - - - - - 1 Gajja Salomons
+/+ 3 c.455_456dup r.(?) p.(Ala153fs*12) Parent #1 - pathogenic (recessive) g.24503507_24503508dup g.24503279_24503280dup - - ALDH5A1_006026 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - ? - PubMed: Akaboshi 2003 - - - Netherlands - - - - - 1 Gajja Salomons
+/+ 3 c.461_474del r.(?) p.(His154LeufsTer11) Parent #1 - pathogenic (recessive) g.24503513_24503526del g.24503285_24503298del - - ALDH5A1_006027 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Spain - - - - - 1 Gajja Salomons
+/+ 3 c.461_474del r.(?) p.(His154LeufsTer11) Parent #2 - pathogenic (recessive) g.24503513_24503526del g.24503285_24503298del - - ALDH5A1_006027 - PubMed: Akaboshi 2003 - - Germline - - - - - DNA SEQ - - SSADHD - PubMed: Akaboshi 2003 - - - Spain - - - - - 1 Gajja Salomons
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6     Next › Last »