All transcript variants in gene AR

Information The variants shown are described using the NM_000044.3 transcript reference sequence.

1545 entries on 16 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11 ...     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

Haplotype     

ClassClinical     

RNA change     

Protein     

P-domain     

Enzyme activity     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 1 c.1500T>? - - r.(?) p.(=) N-term - g.? - (Pro500Pro) - AR_000509 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1i_8 c.1617-?_(*436_?)del - - r.(?) p.? - Bmax zero g.? - - - AR_000140 - PubMed: Jakubiczka 1997 - - Germline - - - 0 - Bruce Gottlieb
+/. 2i_8 c.1769-?_(*436_?)del - - r.(?) p.? - - g.? - - - AR_000110 - PubMed: Brown 1993 - - Germline - - - 0 - Bruce Gottlieb
+/. 3i_8 c.1886-?_(*436_?)del - - r.(?) p.? LBD Bmax zero g.? - - - AR_000409 - Brown et al. Proc Natl Acad Sci 85: 8151, 1988 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.? - - r.(?) p.(Gly489fs*) N-term Bmax low g.? - - - AR_000000 - PubMed: Ahmed 2000 - - Germline - - - 0 - Bruce Gottlieb
+/. 2i c.? - - r.spl? p.? - Bmax zero g.? - - - AR_000000 - PubMed: Ahmed 2000 - - Germline - - - 0 - Bruce Gottlieb
+/. 2i c.? - - r.spl? p.? - - g.? - - - AR_000000 - PubMed: Ahmed 2000 - - Germline - - - 0 - Bruce Gottlieb
+/. 3 c.? - - r.(?) p.? DBD Bmax zero g.? - - - AR_000000 - PubMed: Ahmed 2000 - - Germline - - - 0 - Bruce Gottlieb
+/. 3 c.? - - r.(?) p.? DBD - g.? - - - AR_000000 - PubMed: Ahmed 2000 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.? - - r.(?) p.(Ser83fs*) N-term Bmax zero; kD zero g.? - - - AR_000000 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
+/. ? c.? - - r.(?) p.? - - g.? - - - AR_000000 - PubMed: Audi 2010 - - Germline - - - 0 - Lucy Raymond
+/. 2 c.? - - r.(?) p.? - - g.? - - - AR_000000 no immunoreactive AR PubMed: Avila 2002 - - Germline - - - 0 - Bruce Gottlieb
+/. 2 c.? - - r.(?) p.? - - g.? - - - AR_000000 no immunoreactive AR PubMed: Avila 2002 - - Germline - - - 0 - Bruce Gottlieb
+/. 2i c.? - - r.(?) p.? - - g.? - - - AR_000000 - PubMed: Boehmer 2001 - - Germline - - - 0 - Bruce Gottlieb
+/. 4 c.? - - r.(?) p.(Val716*) LBD - g.? - - - AR_000000 - PubMed: Bouvattier 2002 - - Germline - - - 0 - Bruce Gottlieb
+/. 7 c.? - - r.(?) p.(Asn849fs*) LBD - g.? - - - AR_000000 - PubMed: Cheikhelard 2008 - - Germline - - - 0 - Bruce Gottlieb
+/. 7 c.? - - r.(?) p.(Val867fs*) LBD - g.? - - - AR_000000 - PubMed: Cheikhelard 2008 - - Germline - - - 0 - Bruce Gottlieb
+/. 7 c.? - - r.(?) p.(Val867fs*) LBD - g.? - - - AR_000000 - PubMed: Cheikhelard 2008 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.? - - r.(?) 142 N-term - g.? - - - AR_000000 - PubMed: Hiort 1996 - - Germline - - - 0 - Bruce Gottlieb
+/. 3 c.? - - r.(?) p.? DBD - g.? - - - AR_000000 - PubMed: Hiort 1996 - - Germline - - - 0 - Bruce Gottlieb
+/. ? c.? - - r.(?) p.? - - g.? - - - AR_000000 - PubMed: Melo 2005 - - Germline - - - 0 - Lucy Raymond
+/. 4 c.? - - r.(?) p.? LBD - g.? - - - AR_000000 - Aiken et al. Am J Obs & Gyn 165:1891-1894, 1991 - - Germline - - - 0 - Bruce Gottlieb
+/. 5 c.? - - r.(?) p.(Tyr?Arg) LBD Bmax zero g.? - - - AR_000000 - Marcelli et al. 74th US Endo Soc Meetings: Abstr. 224, 1992 - - Germline - - - 0 - Bruce Gottlieb
-/- 8 c.? - - r.(?) p.? 3' UTR - g.? - - - AR_000000 - Paz et al. European Urology 31: 209-215, 1997 - - Somatic - - - 0 - Bruce Gottlieb
+/. 2 c.? - - r.(?) p.? - - g.? - - - AR_000000 - Quigley et al. J Cell Biochem Suppl 16C. Abstr. L323, 1992 - - Germline - - - 0 - Bruce Gottlieb
+/+ 3 c.? - - r.(?) p.? DBD Bmax high; kD normal g.? - - - AR_000000 produces internally deleted protein Quigley et al. Mol Endocrinol 6: 1103, 1992 - - Germline - - - 0 - Bruce Gottlieb
+/. 7 c.? - - r.(?) p.? LBD - g.? - insATG - AR_000000 ATG insertion at codon 869 Scheiber et al. J Pediatric Endo Metab 16: 367-373, 2003 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.? - - r.(?) p.(Arg485Cys) N-term - g.? - - - AR_000000 AR23 Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.? - - r.(?) p.(Arg485Cys) N-term - g.? - - - AR_000000 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.? - - r.(?) p.(Arg485Cys) N-term - g.? - - - AR_000000 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.? - - r.(?) p.(Arg485Thr) N-term - g.? - - - AR_000000 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 5 c.? - - r.(?) p.(=) LBD - g.? - (Arg761Arg) - AR_000000 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 8 c.? - - r.(?) p.(Gln828*) N-term - g.? - - - AR_000000 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 5 c.? - - r.(?) p.(Arg761fs*) LBD Bmax zero g.? - - - AR_000000 - Vichlis et al. J Hum Genet 48: 346-351, 2003 - - Germline - - - 0 - Bruce Gottlieb
+/+ 8 c.? - - r.(?) p.(Phe917*) LBD - g.? - - - AR_000000 neg. N/C interaction Werner et al. Sex Dev 2: 73-83, 2008 - - Germline - - - 0 - Bruce Gottlieb
+/+ 1 c.? - - r.(?) p.(=) - - g.? - 1034T>G - AR_000000 - Yeh et al. Int J Cancer 120: 1610-1617, 2007 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.?C>T - - r.(?) p.(=) N-term - g.? - 2558C>T (Tyr481Tyr) - AR_000000 - Yeh et al. Int J Cancer 120: 1610-1617, 2007 - - Somatic - - - 0 - Bruce Gottlieb
+/. 5 c.?del - - r.(?) p.? LBD Bmax zero g.? - - - AR_000000 affected aunt exon 6-7deletion only Maclean et al. J Clin Invest, 91: 1123, 1993 - - Germline - - - 0 - Bruce Gottlieb
+/. 1_8 c.(?_-1115)_(*436_?)del - - r.0 p.0 - Bmax zero g.? - - - AR_000122 - PubMed: Ahmed 2000 - - Germline - - - 0 - Bruce Gottlieb
+/. 1_8 c.(?_-1115)_(*436_?)del - - r.0 p.0 - Bmax zero g.? - - - AR_000122 - PubMed: Hiort 1996 - - Germline - - - 0 - Bruce Gottlieb
+/. 1_8 c.(?_-1115)_(*436_?)del - - r.0 p.0 - Bmax zero g.? - - - AR_000122 - Quigley et al. J Clin Endocrinol Metab 74: 927-933, 1992 - - Germline - - - 0 - Bruce Gottlieb
+/. 1_8 c.(?_-1115)_(*436_?)del - - r.0 p.0 - Bmax zero g.? - - - AR_000122 deletion breakpoints not yet defined Trifiro et al. Mol Cell Endocrinol 75: 37-47, 1991 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.-912C>A - - r.(?) p.(=) - - g.66764077C>A g.67544235C>A 203C>A - AR_000148 pos +214 from transcription initiation site AR-TIS II PubMed: Crocitto 1997 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.-800G>T - - r.(?) p.? - - g.66764189G>T g.67544347G>T (415G>T) - AR_000147 pos +2 from transcription initiation site AR-TIS II PubMed: Crocitto 1997 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.(1580_1581)G>A - - r.(?) p.(Trp527*) N-term - g.(66766568_66766569)G>A - - - AR_000000 - Hyytinen et al. Lab Invest. 82: 1591-1598, 2002 - - Somatic - - - 0 - Bruce Gottlieb
+/. 2 c.(1630_1660)del(17) - - r.? p.? DBD - g.(66863111_66863141)del(17) - del 17bp H543fsX544 - AR_000000 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
+/+ 2 c.(1768+1_1769-1)? - - r.1768_1769ins1769-1_1769-1 p.Glu589_Gly590ins23 - - g.(66863250_66905851)? - 2883_2884ins69 - AR_000439 AR23 variant, ins 69 nt of intron 2 = 23 aa, affects AR trafficking Jagla et al.Endocrinology 148: 4334-43, 2007 - - Somatic - - - 0 - Bruce Gottlieb
+/. 2i c.(1768+1_1769-1)? - - r.1768_1769ins1769-1_1769-1 p.Glu589_Gly590ins23 - - g.(66863250_66905851)? - - - AR_000439 AR23 splice variant, ins 69 nt of intron 2, found in 5/8 cases Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 2i c.(1768+1_1769-1)del - - r.spl p.? - Bmax normal; kD high g.(66863250_66905851)del - - - AR_000000 deletion >6 kb intron 2, affects splicing PubMed: Boehmer 2001 - - Germline - - - 0 - Bruce Gottlieb
+/. 3 c.(1768+1_1886-1)? - - r.1769_1885del p.? - - g.(66863250_66931243)? - - - AR_000000 higher express variant in 7/13 breast cancer PubMed: Zhu 1997 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.4G>A - - r.(?) p.(Glu2Lys) N-term Bmax low; kD high g.66764992G>A g.67545150G>A 1119G>A - AR_000136 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
+/+ 1 c.4G>A - - r.(?) p.(Glu2Lys) N-term k high g.66764992G>A g.67545150G>A 1119G>A - AR_000136 variant protein 20-50% reduced PubMed: Choong 1996 - - Germline - - - 0 - Bruce Gottlieb
-?/. - c.7G>A - likely benign r.(?) p.(Val3Met) - - g.66764995G>A - AR:NM_000044.3:c.7G>A - AR_000627 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
+/. 1 c.19delC - - r.(?) p.(Leu7fs*) N-term - g.66765007delC g.67545165delC 1134delC - AR_000328 - PubMed: Barbaro 2007 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.39_42dup - - r.(?) p.(Pro15fs*) N-term - g.66765027_66765030dup g.67545185_67545188dup 1154_1157dupGCCG - AR_000398 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.82C>T - - r.(?) p.(Q28X - - g.66765070C>T g.67545228C>T - - AR_000315 - PubMed: Katayama 2006 - - Germline - - - 0 - Lucy Raymond
+/. 1 c.115_117del - - r.(?) p.(Pro39del) N-term - g.66765103_66765105del g.67545261_67545263del 1230_1232delCCC - AR_000446 - Jung et al. Human Genetics 114: 222, 2004 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.118delA - - r.(?) p.(Arg40fs*) N-term - g.66765106delA g.67545264delA 1233delA - AR_000420 - Decaestecker et al.Fertility & Sterility 89: 1260 e3-7, 2008 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.125delC - - r.(?) p.(Pro42fs*) N-term Bmax zero g.66765113delC g.67545271delC 1240delC - AR_000234 - PubMed: Boehmer 2001 - - Germline - - - 0 - Bruce Gottlieb
+/. - c.127G>T - pathogenic r.(?) p.(Glu43*) - - g.66765115G>T - AR:c.127G>T (E43*) - AR_000628 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. 1 c.128A>G - - r.(?) p.(Glu43Gly) N-term - g.66765116A>G g.67545274A>G 1243A>G - AR_000499 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. - c.159_171del - pathogenic r.(?) p.(Leu54Serfs*117) - - g.66765147_66765159del - AR:c.159_171delTTTGCTGCTGCTG (L54Sfs*117) - AR_000629 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. 1 c.161T>C - - r.(?) p.(Leu54Ser) N-term - g.66765149T>C g.67545307T>C 1276T>C - AR_000549 - Tilley et al. Clinical Cancer Res. 2: 277-285, 1996 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.163_164insC - - r.(?) p.(Leu55fs*) N-term - g.66765151_66765152insC g.67545309_67545310insC 1278_1279insC - AR_000353 - PubMed: Philibert 2009 - - Germline - - - 0 - Bruce Gottlieb
-/. - c.169_170insGCA - benign r.(?) p.(Leu57delinsArgMet) - - g.66765157_66765158insGCA - AR:c.237_239dupGCA (Q80dup) - AR_000631 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.169_170insGCAGCA - benign r.(?) p.(Leu57delinsArgSerMet) - - g.66765157_66765158insGCAGCA - AR:c.234_239dupGCAGCA (Q79_Q80dup) - AR_000630 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.169_170insGCAGCAGCAGCAGCAGCA - benign r.(?) p.(Leu57delinsArgSerSerSerSerSerMet) - - g.66765157_66765158insGCAGCAGCAGCAGCAGCA - AR:c.222_239dupGCAGCAGCAGCAGCAGCA (Q75_Q80dup) - AR_000633 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.169_170insGCAGCAGCAGCAGCAGCAGCA - benign r.(?) p.(Leu57delinsArgSerSerSerSerSerSerMet) - - g.66765157_66765158insGCAGCAGCAGCAGCAGCAGCA - AR:c.219_239dupGCAGCAGCAGCAGCAGCAGCA (Q74_Q80dup) - AR_000632 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. 1 c.170T>A - - r.(?) p.(Leu57Gln) N-term - g.66765158T>A g.67545316T>A - - AR_000411 - Chelnski et al. The Prostate 47: 66-75, 2001 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.170T>A - - r.(?) p.(Leu57Gln) N-term - g.66765158T>A g.67545316T>A 1285T>A - AR_000411 - Tilley et al. Clinical Cancer Res. 2: 277-285, 1996 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.170T>A - - r.(?) p.(Leu57Gln) N-term - g.66765158T>A g.67545316T>A 1285T>A - AR_000411 - Yeh et al. Int J Cancer 120: 1610-1617, 2007 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.170_172del - - r.(?) p.(Leu57del) N-term - g.66765158_66765160del g.67545316_67545318del 1284_1286delCTG - AR_000421 seminoma Garolla et al. Encdorine Related Cancer 12: 645-655, 2005 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.170_172dup - - r.(?) p.(Leu57dup) N-term - g.66765158_66765160dup g.67545316_67545318dup - - AR_000323 - PubMed: Ferlin 2006 - - Germline - - - 0 - Bruce Gottlieb
-/. - c.171_173del - benign r.(?) p.(Gln80del) - - g.66765159_66765161del - AR:c.237_239delGCA (Q80del) - AR_000634 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.171_176del - likely benign r.(?) p.(Gln79_Gln80del) - - g.66765159_66765164del - AR:c.234_239delGCAGCA (Q79_Q80del) - AR_000635 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.171_182del - benign r.(?) p.(Gln77_Gln80del) - - g.66765159_66765170del - AR:c.228_239delGCAGCAGCAGCA (Q77_Q80del) - AR_000636 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.171_194del - VUS r.(?) p.(Gln73_Gln80del) - - g.66765159_66765182del - AR:c.216_239delGCAGCAGCAGCAGCAGCAGCAGCA (Q73_Q80del) - AR_000637 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.172_173insGCAGCA - benign r.(?) p.(Gln58delinsArgSerLys) - - g.66765160_66765161insGCAGCA - AR:c.234_239dupGCAGCA (Q79_Q80dup) - AR_000638 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - - g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax normal; kD normal g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - - g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - - g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - - g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Audi 2010 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax v low g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Gottlieb 1999 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax low g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: MacLean 2004 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax low g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Melo 2003 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax zero g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Melo 2005 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax low; k normal g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Pinsky 1992 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax low; kD normal g.66765162_66765227= - CAG-22 - AR_000000 - Beitel et al. Hum Mol Genet, 3: 21, 1994 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - - g.66765162_66765227= - CAG-22 - AR_000000 - Watanabe et al. Jpn J Clin Oncol 27: 389-393, 1997 - - Somatic - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - - g.66765162_66765227= - CAG-22 - AR_000000 - Watanabe et al. Jpn J Clin Oncol 27: 389-393, 1997 - - Somatic - - - 0 - Bruce Gottlieb
?/. 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax normal g.66765162_66765227= - CAG-22 - AR_000000 - Wong et al. Mol Cell Endocrinol 292: 69-78, 2008 - - Germline - - - 0 - Bruce Gottlieb
+/. 1 c.173A>T - - r.(?) p.(Gln58Leu) N-term - g.66765161A>T g.67545319A>T 1288A>T - AR_000267 - PubMed: Lund 2003 - - Germline - - - 0 - Bruce Gottlieb
?/. 1 c.173A>T - - r.(?) p.(Gln58Leu) N-term - g.66765161A>T g.67545319A>T - - AR_000267 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.173A>T - - r.(?) p.(Gln58Leu) N-term - g.66765161A>T g.67545319A>T - - AR_000267 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.173A>T - - r.(?) p.(Gln58Leu) N-term - g.66765161A>T g.67545319A>T - - AR_000267 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.173A>T - - r.(?) p.(Gln58Leu) DBD - g.66765161A>T g.67545319A>T - - AR_000267 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+/. 1 c.173A>T - - r.(?) p.(Gln58Leu) N-term - g.66765161A>T g.67545319A>T - - AR_000267 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - 0 - Bruce Gottlieb
+?/. - c.173A>T - likely pathogenic r.(?) p.(Gln58Leu) - - g.66765161A>T - AR:c.173A>T (Q58L) - AR_000267 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. 1 c.175C>T - - r.(?) p.(Gln59*) N-term Bmax zero g.66765163C>T g.67545321C>T 1291C>T - AR_000308 - PubMed: Holterhus 2005b - - Germline - - - 0 - Bruce Gottlieb
Legend   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11 ...     Next › Last »