Unique variants in gene AR

Information The variants shown are described using the NM_000044.3 transcript reference sequence.

688 entries on 7 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3 4 5 6 7     Next › Last »




AscendingDNA change (cDNA)     



RNA change     



Enzyme activity     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+/. 1 1 c.1500T>? - - r.(?) p.(=) N-term - g.? - (Pro500Pro) - AR_000509 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - - - Bruce Gottlieb
+/. 1 1i_8 c.1617-?_(*436_?)del - - r.(?) p.? - Bmax zero g.? - - - AR_000140 - PubMed: Jakubiczka 1997 - - Germline - - - - - Bruce Gottlieb
+/. 1 2i_8 c.1769-?_(*436_?)del - - r.(?) p.? - - g.? - - - AR_000110 - PubMed: Brown 1993 - - Germline - - - - - Bruce Gottlieb
+/. 1 3i_8 c.1886-?_(*436_?)del - - r.(?) p.? LBD Bmax zero g.? - - - AR_000409 - Brown et al. Proc Natl Acad Sci 85: 8151, 1988 - - Germline - - - - - Bruce Gottlieb
+/., +/+, -/- 32 ?, 1, 2i, 3, 4, 5, 7, 8, 2 c.? - - r.(?), r.spl? p.?, p.(Gly489fs*), p.(Val716*), 142, p.(Tyr?Arg), p.(Arg761fs*), p.(Asn849fs*), p.(Val867fs*), p.(=), 5 more items N-term, DBD, LBD, 3' UTR Bmax low, Bmax zero, Bmax zero; kD zero, Bmax high; kD normal g.? - 1034T>G, insATG, (Arg761Arg) - AR_000000 neg. N/C interaction, produces internally deleted protein, ATG insertion at codon 869, AR23, 1 more item PubMed: Melo 2005, PubMed: Ahmed 2000, PubMed: Boehmer 2001, PubMed: Bouvattier 2002, 14 more items - - Germline, Somatic - - - - - Lucy Raymond, Bruce Gottlieb
+/. 1 1 c.?C>T - - r.(?) p.(=) N-term - g.? - 2558C>T (Tyr481Tyr) - AR_000000 - Yeh et al. Int J Cancer 120: 1610-1617, 2007 - - Somatic - - - - - Bruce Gottlieb
+/. 1 5 c.?del - - r.(?) p.? LBD Bmax zero g.? - - - AR_000000 affected aunt exon 6-7deletion only Maclean et al. J Clin Invest, 91: 1123, 1993 - - Germline - - - - - Bruce Gottlieb
+/. 4 1_8 c.(?_-1115)_(*436_?)del - - r.0 p.0 - Bmax zero g.? - - - AR_000122 deletion breakpoints not yet defined PubMed: Ahmed 2000, PubMed: Hiort 1996, Trifiro et al. Mol Cell Endocrinol 75: 37-47, 1991, 1 more item - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.-912C>A - - r.(?) p.(=) - - g.66764077C>A g.67544235C>A 203C>A - AR_000148 pos +214 from transcription initiation site AR-TIS II PubMed: Crocitto 1997 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.-800G>T - - r.(?) p.? - - g.66764189G>T g.67544347G>T (415G>T) - AR_000147 pos +2 from transcription initiation site AR-TIS II PubMed: Crocitto 1997 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.(1580_1581)G>A - - r.(?) p.(Trp527*) N-term - g.(66766568_66766569)G>A - - - AR_000000 - Hyytinen et al. Lab Invest. 82: 1591-1598, 2002 - - Somatic - - - - - Bruce Gottlieb
+/. 1 2 c.(1630_1660)del(17) - - r.? p.? DBD - g.(66863111_66863141)del(17) - del 17bp H543fsX544 - AR_000000 - PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
+/., +/+ 2 2i, 2 c.(1768+1_1769-1)? - - r.1768_1769ins1769-1_1769-1 p.Glu589_Gly590ins23 - - g.(66863250_66905851)? - 2883_2884ins69 - AR_000439 AR23 splice variant, ins 69 nt of intron 2, found in 5/8 cases, 1 more item Steinkamp et al. Cancer Res 69: 4434-4442, 2009, Jagla et al.Endocrinology 148: 4334-43, 2007 - - Somatic - - - - - Bruce Gottlieb
+/. 1 2i c.(1768+1_1769-1)del - - r.spl p.? - Bmax normal; kD high g.(66863250_66905851)del - - - AR_000000 deletion >6 kb intron 2, affects splicing PubMed: Boehmer 2001 - - Germline - - - - - Bruce Gottlieb
+/. 1 3 c.(1768+1_1886-1)? - - r.1769_1885del p.? - - g.(66863250_66931243)? - - - AR_000000 higher express variant in 7/13 breast cancer PubMed: Zhu 1997 - - Somatic - - - - - Bruce Gottlieb
+/., +/+ 2 1 c.4G>A - - r.(?) p.(Glu2Lys) N-term Bmax low; kD high, k high g.66764992G>A g.67545150G>A 1119G>A - AR_000136 variant protein 20-50% reduced PubMed: Audi 2010, PubMed: Choong 1996 - - Germline - - - - - Bruce Gottlieb
-?/. 1 - c.7G>A - likely benign r.(?) p.(Val3Met) - - g.66764995G>A - AR:NM_000044.3:c.7G>A - AR_000627 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 1 c.19delC - - r.(?) p.(Leu7fs*) N-term - g.66765007delC g.67545165delC 1134delC - AR_000328 - PubMed: Barbaro 2007 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.39_42dup - - r.(?) p.(Pro15fs*) N-term - g.66765027_66765030dup g.67545185_67545188dup 1154_1157dupGCCG - AR_000398 - PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.82C>T - - r.(?) p.(Q28X - - g.66765070C>T g.67545228C>T - - AR_000315 - PubMed: Katayama 2006 - - Germline - - - - - Lucy Raymond
+/. 1 1 c.115_117del - - r.(?) p.(Pro39del) N-term - g.66765103_66765105del g.67545261_67545263del 1230_1232delCCC - AR_000446 - Jung et al. Human Genetics 114: 222, 2004 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.118delA - - r.(?) p.(Arg40fs*) N-term - g.66765106delA g.67545264delA 1233delA - AR_000420 - Decaestecker et al.Fertility & Sterility 89: 1260 e3-7, 2008 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.125delC - - r.(?) p.(Pro42fs*) N-term Bmax zero g.66765113delC g.67545271delC 1240delC - AR_000234 - PubMed: Boehmer 2001 - - Germline - - - - - Bruce Gottlieb
+/. 1 - c.127G>T - pathogenic r.(?) p.(Glu43*) - - g.66765115G>T - AR:c.127G>T (E43*) - AR_000628 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 1 c.128A>G - - r.(?) p.(Glu43Gly) N-term - g.66765116A>G g.67545274A>G 1243A>G - AR_000499 - Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - - - Bruce Gottlieb
+/. 1 - c.159_171del - pathogenic r.(?) p.(Leu54Serfs*117) - - g.66765147_66765159del - AR:c.159_171delTTTGCTGCTGCTG (L54Sfs*117) - AR_000629 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 1 c.161T>C - - r.(?) p.(Leu54Ser) N-term - g.66765149T>C g.67545307T>C 1276T>C - AR_000549 - Tilley et al. Clinical Cancer Res. 2: 277-285, 1996 - - Somatic - - - - - Bruce Gottlieb
+/. 1 1 c.163_164insC - - r.(?) p.(Leu55fs*) N-term - g.66765151_66765152insC g.67545309_67545310insC 1278_1279insC - AR_000353 - PubMed: Philibert 2009 - - Germline - - - - - Bruce Gottlieb
-/. 1 - c.169_170insGCA - benign r.(?) p.(Leu57delinsArgMet) - - g.66765157_66765158insGCA - AR:c.237_239dupGCA (Q80dup) - AR_000631 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.169_170insGCAGCA - benign r.(?) p.(Leu57delinsArgSerMet) - - g.66765157_66765158insGCAGCA - AR:c.234_239dupGCAGCA (Q79_Q80dup) - AR_000630 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.169_170insGCAGCAGCAGCAGCAGCA - benign r.(?) p.(Leu57delinsArgSerSerSerSerSerMet) - - g.66765157_66765158insGCAGCAGCAGCAGCAGCA - AR:c.222_239dupGCAGCAGCAGCAGCAGCA (Q75_Q80dup) - AR_000633 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.169_170insGCAGCAGCAGCAGCAGCAGCA - benign r.(?) p.(Leu57delinsArgSerSerSerSerSerSerMet) - - g.66765157_66765158insGCAGCAGCAGCAGCAGCAGCA - AR:c.219_239dupGCAGCAGCAGCAGCAGCAGCA (Q74_Q80dup) - AR_000632 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 3 1 c.170T>A - - r.(?) p.(Leu57Gln) N-term - g.66765158T>A g.67545316T>A 1285T>A - AR_000411 - Tilley et al. Clinical Cancer Res. 2: 277-285, 1996, Yeh et al. Int J Cancer 120: 1610-1617, 2007, 1 more item - - Somatic - - - - - Bruce Gottlieb
+/. 1 1 c.170_172del - - r.(?) p.(Leu57del) N-term - g.66765158_66765160del g.67545316_67545318del 1284_1286delCTG - AR_000421 seminoma Garolla et al. Encdorine Related Cancer 12: 645-655, 2005 - - Somatic - - - - - Bruce Gottlieb
+/. 1 1 c.170_172dup - - r.(?) p.(Leu57dup) N-term - g.66765158_66765160dup g.67545316_67545318dup - - AR_000323 - PubMed: Ferlin 2006 - - Germline - - - - - Bruce Gottlieb
-/. 1 - c.171_173del - benign r.(?) p.(Gln80del) - - g.66765159_66765161del - AR:c.237_239delGCA (Q80del) - AR_000634 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.171_176del - likely benign r.(?) p.(Gln79_Gln80del) - - g.66765159_66765164del - AR:c.234_239delGCAGCA (Q79_Q80del) - AR_000635 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.171_182del - benign r.(?) p.(Gln77_Gln80del) - - g.66765159_66765170del - AR:c.228_239delGCAGCAGCAGCA (Q77_Q80del) - AR_000636 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.171_194del - VUS r.(?) p.(Gln73_Gln80del) - - g.66765159_66765182del - AR:c.216_239delGCAGCAGCAGCAGCAGCAGCAGCA (Q73_Q80del) - AR_000637 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.172_173insGCAGCA - benign r.(?) p.(Gln58delinsArgSerLys) - - g.66765160_66765161insGCAGCA - AR:c.234_239dupGCAGCA (Q79_Q80dup) - AR_000638 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 14 1 c.174_239= CAG[22] - r.(?) p.(=) - Bmax zero, Bmax v low, Bmax low; k normal, Bmax normal, Bmax normal; kD normal, Bmax low; kD normal, 1 more item g.66765162_66765227= - CAG-22 - AR_000000 - PubMed: Melo 2005, PubMed: Gottlieb 1999, PubMed: Pinsky 1992, PubMed: Audi 2010, PubMed: MacLean 2004, 4 more items - - Germline, Somatic - - - - - Bruce Gottlieb
+?/., +/., ?/. 7 1 c.173A>T - likely pathogenic r.(?) p.(Gln58Leu) N-term, DBD - g.66765161A>T g.67545319A>T AR:c.173A>T (Q58L), 1288A>T - AR_000267 VKGL data sharing initiative Nederland; correct HGVS to be checked PubMed: Lund 2003, Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - CLASSIFICATION record, Germline, Somatic - - - - - VKGL-NL_Rotterdam, Bruce Gottlieb
+/. 1 1 c.175C>T - - r.(?) p.(Gln59*) N-term Bmax zero g.66765163C>T g.67545321C>T 1291C>T - AR_000308 - PubMed: Holterhus 2005b - - Germline - - - - - Bruce Gottlieb
-/. 2 - c.177_182del - benign r.(?) p.(Gln79_Gln80del) - - g.66765165_66765170del - AR:c.234_239delGCAGCA (Q79_Q80del) - AR_000639 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
-/. 1 - c.177_185del - benign r.(?) p.(Gln78_Gln80del) - - g.66765165_66765173del - AR:c.231_239delGCAGCAGCA (Q78_Q80del) - AR_000640 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/+ 2 1 c.178C>T - - r.(?) p.(Gln60*) N-term Bmax low; kD normal; k high g.66765166C>T g.67545324C>T 1293C>T - AR_000115 normal upregulation PubMed: Bouvattier 2002, PubMed: Zoppi 1993 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.179dupA - - r.(?) p.(Gln60fs*) N-term - g.66765167dupA g.67545325dupA 1294dupA - AR_000576 either 1 nt insert or 2 nt del Zhu et al. J Clin Endocrinol Metab 84: 1590-1594, 1999 - - Germline - - - - - Bruce Gottlieb
-/. 1 - c.180_182del - benign r.(?) p.(Gln80del) - - g.66765168_66765170del - AR:c.237_239delGCA (Q80del) - AR_000641 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.184_185insGCA - benign r.(?) p.(Gln62delinsArgLys) - - g.66765172_66765173insGCA - AR:c.237_239dupGCA (Q80dup) - AR_000642 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.187_188insGCAGCA - benign r.(?) p.(Gln63delinsArgSerLys) - - g.66765175_66765176insGCAGCA - AR:c.234_239dupGCAGCA (Q79_Q80dup) - AR_000643 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 1 c.188A>G - - r.(?) p.(Gln64Arg) N-term - g.66765176A>G g.67545334A>G 1303A>G - AR_000551 - Tilley et al. Clinical Cancer Res. 2: 277-285, 1996 - - Somatic - - - - - Bruce Gottlieb
-/. 1 - c.192_194del - benign r.(?) p.(Gln80del) - - g.66765180_66765182del - AR:c.237_239delGCA (Q80del) - AR_000644 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 1 c.196C>T - - r.(?) p.(Gln67*) N-term - g.66765184C>T g.67545342C>T 1311C>T - AR_000335 - PubMed: Cheikhelard 2008 - - Germline - - - - - Bruce Gottlieb
?/. 1 1 c.198_239del CAG[8] - r.(?) p.(Gln67_Gln80del) - - g.66765186_66765227del - CAG-8 - AR_000374 - PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.199C>T - - r.(?) p.(Gln67*) - - g.66765187C>T g.67545345C>T - - AR_000336 - PubMed: Cheikhelard 2008 - - Germline - - - - - Lucy Raymond
-/. 1 - c.201_203dup - benign r.(?) p.(Gln80dup) - - g.66765189_66765191dup - AR:c.237_239dupGCA (Q80dup) - AR_000645 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 1 c.208C>T - - r.(?) p.(Gln70*) N-term - g.66765196C>T g.67545354C>T 1323C>T - AR_000354 - PubMed: Philibert 2009 - - Germline - - - - - Bruce Gottlieb
?/. 2 1 c.210_239del CAG[12] - r.(?) p.(Gln71_Gln80del) - Bmax normal; kD high; thermolabile, Bmax zero g.66765198_66765227del - CAG-12 - AR_000623 - McPhaul et al.J Clin Inv 87: 1413,1991: Batch&al Arc Dis Ch 68: 453 1993, PubMed: Gottlieb 1999 - - Germline - - - - - Bruce Gottlieb
+/. 2 1 c.212A>G - - r.(?) p.(Gln71Arg) N-term - g.66765200A>G g.67545358A>G 1324>G - AR_000344, AR_000345 CAG22 in blood azoospermia Sertoli Cell only Syndrome; Gln20, 21 and 23 PubMed: Hose 2009 - - Germline - - - - - Bruce Gottlieb, Lucy Raymond
?/. 1 1 c.213_239del CAG[13] - r.(?) p.(Gln72_Gln80del) - - g.66765201_66765227del - CAG-13 - AR_000615 - PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
?/. 3 1 c.216_239del CAG[14] - r.(?) p.(Gln73_Gln80del) - - g.66765204_66765227del - CAG-14 - AR_000626 - Zuccarello et al. Clin Endocrinol 68: 58-588, 2008, Boehmer et al. Am J Hum Genetics 60: 1003-6, 1997, 1 more item - - Germline - - - - - Bruce Gottlieb
?/. 2 1 c.216_239dup CAG[30] - r.(?) p.(Gln73_Gln80dup) - Bmax low g.66765204_66765227dup - CAG-30 - AR_000268 - Werner et al. J Clin Endocrinol Metab 91: 3515-3520, 2006, PubMed: Melo 2003 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.217C>T - - r.(?) p.(Gln73*) N-term - g.66765205C>T g.67545363C>T 1332C>T - AR_000470 somatic mosaicism, 2/3 variant and 1/3 wt Mueller et al. Hum Genet 119: 681, 2006 - - Somatic - - - - - Bruce Gottlieb
?/. 1 - c.217_218insGGC - VUS r.(?) p.(Gln72_Gln73insArg) - - g.66765205_66765206insGGC - AR:NM_000044.3:c.215_216insGCG - AR_000646 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 1 c.219_239del CAG[15] - r.(?) p.(Gln74_Gln80del) - Bmax zero g.66765207_66765227del - CAG-15 - AR_000624 - PubMed: Gottlieb 1999 - - Germline - - - - - Bruce Gottlieb
?/. 1 1 c.219_239dup CAG[29] - r.(?) p.(Gln74_Gln80dup) - - g.66765207_66765227dup - CAG-29 - AR_000373 - PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
?/. 3 1 c.222_239del CAG[16] - r.(?) p.(Gln75_Gln80del) - Bmax zero, Bmax normal; kD normal g.66765210_66765227del - CAG-16 - AR_000625 - PubMed: Melo 2003, Chen et al. The Prostate 63: 395-406, 2005 - - Germline, Somatic - - - - - Bruce Gottlieb
?/. 4 1 c.222_239dup CAG[28] - r.(?) p.(Gln75_Gln80dup) - Bmax low; kD normal, Bmax zero to normal, Bmax zero g.66765210_66765227dup - CAG-28 - AR_000621 - Werner et al. J Clin Endocrinol Metab 91: 3515-3520, 2006, PubMed: Audi 2010, PubMed: Melo 2003, 1 more item - - Germline - - - - - Bruce Gottlieb
?/. 1 1 c.225_239del CAG[17] - r.(?) p.(Gln76_Gln80del) - - g.66765213_66765227del - CAG-17 - AR_000616 - PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
?/. 10 1 c.225_239dup CAG[27] - r.(?) p.(Gln76_Gln80dup) - Bmax normal; kD high, Bmax normal; kD normal; k normal, Bmax zero, Bmax low; kD high, Bmax low, 1 more item g.66765213_66765227dup - CAG-27 - AR_000618 - PubMed: Pinsky 1992, Ko et al. J Reprod. Med 42: 424- 427, 1997, PubMed: Wang 1998, PubMed: Audi 2010, 5 more items - - Germline, Somatic - - - - - Bruce Gottlieb
+/. 2 1 c.226C>T - - r.(?) p.(Gln76*) N-term - g.66765214C>T g.67545372C>T 1341C>T - AR_000355 truncated CAG repeat? PubMed: Philibert 2009, PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.227delA - - r.(?) p.(fs*) N-term - g.66765215delA g.67545373delA 1342delA - AR_000356 - PubMed: Philibert 2009 - - Germline - - - - - Bruce Gottlieb
?/. 10 1 c.228_239del CAG[18] - r.(?) p.(Gln77_Gln80del) - Bmax zero; kD zero, Bmax low; kD normal, Bmax normal; kD high; k high; thermolabile g.66765216_66765227del - CAG-18 - AR_000617 - Wallin et al. J Pathology 189: 559-653, 1999, PubMed: Audi 2010, PubMed: MacLean 2004, 2 more items - - Somatic, Germline - - - - - Bruce Gottlieb
?/. 10 1 c.228_239dup CAG[26] - r.(?) p.(Gln77_Gln80dup) - Bmax low; kD high, Bmax zero, Bmax normal; kD normal; k normal, Bmax normal; kD normal g.66765216_66765227dup - CAG-26 - AR_000620 - PubMed: Peters 1999, PubMed: Shkolny 1995, PubMed: Shkolny 1999, PubMed: Audi 2010, 2 more items - - Germline - - - - - Bruce Gottlieb
?/., -?/. 21 1 c.231_239del CAG[19] - r.(?) p.(Gln78_Gln80del) - Bmax normal; kD high, Bmax low; kD normal, Bmax zero; kD zero, Bmax normal, Bmax zero, 2 more items g.66765219_66765227del - CAG-19 - AR_000581 variant could not be associated with disease phenotype PubMed: Gottlieb 1999, Ko et al. J Reprod. Med 42: 424- 427, 1997, PubMed: Knoke 1999, 6 more items - - Germline - - - - - Bruce Gottlieb, Marjolijn JL Ligtenberg
?/. 9 1 c.231_239dup CAG[25] - r.(?) p.(Gln78_Gln80dup) - Bmax normal; kD high, Bmax normal; kD normal; k high, Bmax low; kD high, Bmax zero g.66765219_66765227dup - CAG-25 - AR_000622 - PubMed: Saunders 1992, PubMed: Shkolny 1999, Beitel et al. Hum Mol Genet, 3: 21-27, 1994, 3 more items - - Germline - - - - - Bruce Gottlieb
?/., -?/. 20 1 c.234_239del CAG[20] - r.(?) p.(Gln79_Gln80del) - Bmax normal; kD high, Bmax zero, Bmax normal; kD high; k high, Bmax normal, Bmax zero; kD zero, 2 more items g.66765222_66765227del - CAG-20 - AR_000582 variant could not be associated with disease phenotype PubMed: Gottlieb 1999, Hyytinen et al. Lab Invest. 82: 1591-1598, 2002, PubMed: Pinsky 1992, 7 more items - - Germline, Somatic - - - - - Bruce Gottlieb, Marjolijn JL Ligtenberg
?/. 10 1 c.234_239dup CAG[24] - r.(?) p.(Gln79_Gln80dup) - Bmax normal; kD normal, Bmax normal; kD normal; k high; thermolabile g.66765222_66765227dup - CAG-24 - AR_000619 - PubMed: Pinsky 1992, Thiele et al. J Clin Endocrinol Metab 84: 1751-1753. 1999, PubMed: Audi 2010, 5 more items - - Germline, Somatic - - - - - Bruce Gottlieb
?/. 23 1 c.237_239del CAG[21] - r.(?) p.(Gln80del) - Bmax normal; kD normal, Bmax v low; kD normal, Bmax normal; kD high, Bmax zero, Bmax v low, Bmax low, 1 more item g.66765225_66765227del - CAG-21 - AR_000004 - PubMed: Gottlieb 1999, PubMed: Boehmer 2001, PubMed: Hellwinkel 2001, PubMed: Saunders 1992, 10 more items - - Germline, Somatic - - - - - Bruce Gottlieb
+/. 1 1 c.238C>T - ACMG 5 r.(?) p.(Gln80*) - - g.66765226C>T g.67545384C>T - - AR_000600 - Trujillano et al., submitted - - Germline - - - - - Daniel Trujillano
+/. 1 1i c.239_240insCAG[40_52] CAG[40_52] - r.0 p.0 N-term - g.66765227_66765228insCAG[40_52] - - - AR_000450 expansion of repeat from 40-52 CAGs PubMed: La Spada 1991 - - Germline yes - - - - Bruce Gottlieb
+/., -?/. 2 1 c.240A>G - likely benign r.(?), r.(=) p.(=) N-term - g.66765228A>G g.67545386A>G 1355A>G (Gln80Gln), AR:c.240A>G (Q80=) - AR_000572 VKGL data sharing initiative Nederland; correct HGVS to be checked Yeh et al. Int J Cancer 120: 1610-1617, 2007 - - Somatic, CLASSIFICATION record - - - - - Bruce Gottlieb, VKGL-NL_Rotterdam
+/. 1 1 c.240dupA - - r.(?) p.(Glu81fs*) N-term - g.66765228dupA g.67545386dupA 1355_1356insA - AR_000390 - PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.244_248del - - r.(?) p.(Thr82fs*) N-term - g.66765232_66765236del g.67545390_67545394del 1359_1363delACTAG - AR_000357 - PubMed: Philibert 2009 - - Germline - - - - - Bruce Gottlieb
-/. 1 - c.252_254dup - benign r.(?) p.(Pro84_Arg85insSer) - - g.66765240_66765242dup - AR:c.271_273dupCAG (Q91dup) - AR_000647 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 1 c.256C>T - - r.(?) p.(Gln86*) N-term Bmax low; kD high g.66765244C>T g.67545402C>T 1371C>T - AR_000394 - PubMed: Audi 2010 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.257dupA - - r.(?) p.(Gln87fs*) N-term Bmax zero g.66765245dupA g.67545403dupA 1372_1373insA - AR_000184 - PubMed: Gottlieb 1999 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.262C>T - - r.(?) p.(Gln88*) N-term Bmax zero g.66765250C>T g.67545408C>T 1377C>T - AR_000314 - PubMed: Jaaskelainen 2006 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.268C>T - - r.(?) p.(Gln90*) N-term - g.66765256C>T g.67545414C>T 1383C>T - AR_000250 - PubMed: Bouvattier 2002 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.270G>T - - r.(?) p.(Gln90His) N-term - g.66765258G>T g.67545416G>T 1385G>T - AR_000573 - Yeh et al. Int J Cancer 120: 1610-1617, 2007 - - Somatic - - - - - Bruce Gottlieb
?/., +/. 7 1 c.271_273del - - r.(?) p.(Gln86del), p.(Gln91del) N-term, DBD, LBD - g.66765259_66765261del g.67545417_67545419del 1371_1373delCAG - AR_000517 AR23 splice variant Steinkamp et al. Cancer Res 69: 4434-4442, 2009 - - Somatic - - - - - Bruce Gottlieb
+/. 1 - c.277G>T - pathogenic r.(?) p.(Glu93*) - - g.66765265G>T - AR:c.277G>T (E93*) - AR_000648 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 1 c.279G>Y - - r.(?) p.(Glu93Asp) N-term - g.66765267G>Y g.67545425G>Y - - AR_000414 AR independant Chelnski et al. The Prostate 47: 66-75, 2001 - - Somatic - - - - - Bruce Gottlieb
+/. 1 1 c.302G>A - - r.(?) p.(Arg101His) N-term - g.66765290G>A g.67545448G>A 1417G>A - AR_000574 - Yeh et al. Int J Cancer 120: 1610-1617, 2007 - - Somatic - - - - - Bruce Gottlieb
+/. 1 1 c.312delC - - r.(?) p.(Pro104fs*) N-term Bmax zero g.66765300delC g.67545458delC 1427delC - AR_000186 - PubMed: Gottlieb 1999 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.325_326insA - - r.(?) p.(Val109fs*) N-term - g.66765313_66765314insA g.67545471_67545472insA 1440_1441insA - AR_000358 - PubMed: Philibert 2009 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.342G>T - - r.(?) p.(Gln114His) N-term - g.66765330G>T g.67545488G>T 1457G>T - AR_000560 - Tilley et al. Clinical Cancer Res. 2: 277-285, 1996 - - Somatic - - - - - Bruce Gottlieb
+/. 1 1 c.343C>T - - r.(?) p.(Gln115*) N-term - g.66765331C>T g.67545489C>T 1458C>T - AR_000187 - PubMed: Gottlieb 1999 - - Germline - - - - - Bruce Gottlieb
+/. 1 1 c.358C>T - - r.(?) p.(Gln120*) N-term - g.66765346C>T g.67545504C>T 1473C>T - AR_000327 - PubMed: Berg 2007 - - Germline - - - - - Bruce Gottlieb
+/. 2 1 c.362C>A - - r.(?) p.(Ser121*) N-term - g.66765350C>A g.67545508C>A 1477C>A - AR_000273 - PubMed: Melo 2005, PubMed: Melo 2003 - - Germline - - - - - Bruce Gottlieb
Legend   « First ‹ Prev     1 2 3 4 5 6 7     Next › Last »