All transcript variants in gene ARID2

Information The variants shown are described using the NM_152641.2 transcript reference sequence.

23 entries on 1 page. Showing entries 1 - 23.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. - c.109del pathogenic r.(?) p.(Ile37Serfs*21) g.46123843del - ARID2(NM_152641.3):c.109delA (p.I37Sfs*21) - ARID2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. - c.109_110del likely pathogenic r.(?) p.(Ile37Profs*28) g.46123843_46123844del - ARID2(NM_152641.2):c.109_110delAT (p.I37Pfs*28) - ARID2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 5 c.156del - r.(?) p.(Arg53Glufs*5) g.46123890delC - - - ARID2_000010 - PubMed: Bramswig 2017 - - De novo - - - 0 - Julia Lopez
+?/. - c.820C>T likely pathogenic r.(?) p.(Arg274*) g.46230571C>T - ARID2(NM_152641.2):c.820C>T (p.Arg274*) - ARID2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.988_1008del VUS r.(?) p.(Leu330_Gly336del) g.46230739_46230759del - ARID2(NM_152641.2):c.988_1008delTTAGGCCTTGACACATTAGGA (p.L330_G336del) - ARID2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 6 c.1028T>A - r.(?) p.(Leu343*) g.46231108T>A - - - ARID2_000011 Refseq reported:hg19 PubMed: Shang L 2015 - - Unknown - - - 0 - Julia Lopez
?/. - c.1150G>A VUS r.(?) p.(Ala384Thr) g.46231310G>A - ARID2(NM_152641.2):c.1150G>A (p.A384T) - ARID2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.1374C>A benign r.(?) p.(=) g.46233155C>A - ARID2(NM_152641.2):c.1374C>A (p.=) - ARID2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. - c.1997_2000dup likely pathogenic r.(?) p.(Met667Ilefs*41) g.46243903_46243906dup - ARID2(NM_152641.2):c.1997_2000dupAAAT (p.M667Ifs*41) - ARID2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.2048G>A VUS r.(?) p.(Arg683Lys) g.46243954G>A - ARID2(NM_152641.2):c.2048G>A (p.(Arg683Lys)) - ARID2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.2229T>G likely benign r.(?) p.(=) g.46244135T>G - ARID2(NM_152641.2):c.2229T>G (p.=) - ARID2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.2267T>C VUS r.(?) p.(Val756Ala) g.46244173T>C - ARID2(NM_152641.2):c.2267T>C (p.V756A) - ARID2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. - c.2455C>T pathogenic r.(?) p.(Gln819*) g.46244361C>T - ARID2(NM_152641.3):c.2455C>T (p.Q819*) - ARID2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. 10 c.2536delG - r.(?) p.(Ala846Hisfs*6) g.46244442delG - p.(Val846Leufs*3) - ARID2_000012 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - Julia Lopez
-/. - c.2764A>G benign r.(?) p.(Thr922Ala) g.46244670A>G - ARID2(NM_152641.2):c.2764A>G (p.T922A) - ARID2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 12 c.3411_3412del - r.(?) p.(Gly1139Serfs*20) g.46245317_46245318delAG - - - ARID2_000013 - PubMed: Bramswig 2017 - - De novo - - - 0 - Julia Lopez
+?/. - c.3814C>T likely pathogenic r.(?) p.(Arg1272*) g.46245720C>T - ARID2(NM_152641.3):c.3814C>T (p.Arg1272*) - ARID2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. 12 c.4318C>T - r.(?) p.(Gln1440*) g.46246224C>T - - - ARID2_000014 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - Julia Lopez
?/. 12 c.4441delC - r.(?) p.(His1481Ilefs*4) g.46246347delC - - - ARID2_000015 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - Julia Lopez
?/. - c.4585G>A VUS r.(?) p.(Gly1529Arg) g.46246491G>A - ARID2(NM_152641.2):c.4585G>A (p.G1529R) - ARID2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. - c.5006G>A pathogenic r.(?) p.(Trp1669*) g.46285646G>A - ARID2(NM_152641.3):c.5006G>A (p.(Trp1669*)) - ARID2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
./. - c.5192A>T - r.(?) p.(Lys1731Met) g.46287247A>T g.45893464A>T NM_152641.3(ARID2):c.5192A>T p.(Lys1731Met) - ARID2_000002 variant could not be associated with disease phenotype PubMed: Vogelaar 2017, Journal: Vogelaar 2017 - - Germline - - - 0 - Marjolijn JL Ligtenberg
?/. - c.5363+2444G>A - - p.(=) g.46289948G>A g.45896165G>A - - ARID2_000001 - - - - Germline - - - - - Yu Sun
Legend