Full data view for gene ARID2

Information The variants shown are described using the NM_152641.2 transcript reference sequence.

23 entries on 1 page. Showing entries 1 - 23.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

Allele     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age/Death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+/. - c.109del pathogenic r.(?) p.(Ile37Serfs*21) Unknown g.46123843del - ARID2(NM_152641.3):c.109delA (p.I37Sfs*21) - ARID2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.109_110del likely pathogenic r.(?) p.(Ile37Profs*28) Unknown g.46123843_46123844del - ARID2(NM_152641.2):c.109_110delAT (p.I37Pfs*28) - ARID2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 5 c.156del - r.(?) p.(Arg53Glufs*5) Parent #1 g.46123890delC - - - ARID2_000010 - PubMed: Bramswig 2017 - - De novo - - - 0 - DNA SEQ - - CSS Ind2 PubMed: Bramswig 2017 - - - - - - 0 - - 1 Julia Lopez
+?/. - c.820C>T likely pathogenic r.(?) p.(Arg274*) Unknown g.46230571C>T - ARID2(NM_152641.2):c.820C>T (p.Arg274*) - ARID2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.988_1008del VUS r.(?) p.(Leu330_Gly336del) Unknown g.46230739_46230759del - ARID2(NM_152641.2):c.988_1008delTTAGGCCTTGACACATTAGGA (p.L330_G336del) - ARID2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 6 c.1028T>A - r.(?) p.(Leu343*) Parent #1 g.46231108T>A - - - ARID2_000011 Refseq reported:hg19 PubMed: Shang L 2015 - - Unknown - - - 0 - DNA SEQ - - ID 2 PubMed: Shang L 2015 - F - - - - 0 - - 1 Julia Lopez
?/. - c.1150G>A VUS r.(?) p.(Ala384Thr) Unknown g.46231310G>A - ARID2(NM_152641.2):c.1150G>A (p.A384T) - ARID2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1374C>A benign r.(?) p.(=) Unknown g.46233155C>A - ARID2(NM_152641.2):c.1374C>A (p.=) - ARID2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1997_2000dup likely pathogenic r.(?) p.(Met667Ilefs*41) Unknown g.46243903_46243906dup - ARID2(NM_152641.2):c.1997_2000dupAAAT (p.M667Ifs*41) - ARID2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2048G>A VUS r.(?) p.(Arg683Lys) Unknown g.46243954G>A - ARID2(NM_152641.2):c.2048G>A (p.(Arg683Lys)) - ARID2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2229T>G likely benign r.(?) p.(=) Unknown g.46244135T>G - ARID2(NM_152641.2):c.2229T>G (p.=) - ARID2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2267T>C VUS r.(?) p.(Val756Ala) Unknown g.46244173T>C - ARID2(NM_152641.2):c.2267T>C (p.V756A) - ARID2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.2455C>T pathogenic r.(?) p.(Gln819*) Unknown g.46244361C>T - ARID2(NM_152641.3):c.2455C>T (p.Q819*) - ARID2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 10 c.2536delG - r.(?) p.(Ala846Hisfs*6) Parent #1 g.46244442delG - p.(Val846Leufs*3) - ARID2_000012 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - DNA SEQ - - ID 1 PubMed: Shang L 2015 - F - - - - 0 - - 1 Julia Lopez
-/. - c.2764A>G benign r.(?) p.(Thr922Ala) Unknown g.46244670A>G - ARID2(NM_152641.2):c.2764A>G (p.T922A) - ARID2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 12 c.3411_3412del - r.(?) p.(Gly1139Serfs*20) Parent #1 g.46245317_46245318delAG - - - ARID2_000013 - PubMed: Bramswig 2017 - - De novo - - - 0 - DNA SEQ - - CSS Ind1 PubMed: Bramswig 2017 - - - - - - 0 - - 1 Julia Lopez
+?/. - c.3814C>T likely pathogenic r.(?) p.(Arg1272*) Unknown g.46245720C>T - ARID2(NM_152641.3):c.3814C>T (p.Arg1272*) - ARID2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 12 c.4318C>T - r.(?) p.(Gln1440*) Parent #1 g.46246224C>T - - - ARID2_000014 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - DNA SEQ - - ID 4 PubMed: Shang L 2015 - F - - - - 0 - - 1 Julia Lopez
?/. 12 c.4441delC - r.(?) p.(His1481Ilefs*4) Parent #1 g.46246347delC - - - ARID2_000015 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - DNA SEQ - - ID 3 PubMed: Shang L 2015 - M - - - - 0 - - 1 Julia Lopez
?/. - c.4585G>A VUS r.(?) p.(Gly1529Arg) Unknown g.46246491G>A - ARID2(NM_152641.2):c.4585G>A (p.G1529R) - ARID2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.5006G>A pathogenic r.(?) p.(Trp1669*) Unknown g.46285646G>A - ARID2(NM_152641.3):c.5006G>A (p.(Trp1669*)) - ARID2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
./. - c.5192A>T - r.(?) p.(Lys1731Met) Unknown g.46287247A>T g.45893464A>T NM_152641.3(ARID2):c.5192A>T p.(Lys1731Met) - ARID2_000002 variant could not be associated with disease phenotype PubMed: Vogelaar 2017, Journal: Vogelaar 2017 - - Germline - - - 0 - DNA SEQ-NG - - cancer, gastric Vogelaar-759A PubMed: Vogelaar 2017, Journal: Vogelaar 2017 54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer - - - - - 0 - - 1 Marjolijn JL Ligtenberg
?/. - c.5363+2444G>A - - p.(=) Unknown g.46289948G>A g.45896165G>A - - ARID2_000001 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
Legend