Full data view for gene ARID2

Information The variants shown are described using the NM_152641.2 transcript reference sequence.

36 entries on 1 page. Showing entries 1 - 36.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+/. - c.109del r.(?) p.(Ile37SerfsTer21) Unknown - pathogenic g.46123843del g.45730060del ARID2(NM_152641.3):c.109delA (p.I37Sfs*21) - ARID2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.109_110del r.(?) p.(Ile37ProfsTer28) Unknown - likely pathogenic g.46123843_46123844del g.45730060_45730061del ARID2(NM_152641.4):c.109_110delAT (p.I37Pfs*28) - ARID2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 5 c.156del r.(?) p.(Arg53Glufs*5) Parent #1 - VUS g.46123890del g.45730107del - - ARID2_000010 - PubMed: Bramswig 2017 - - De novo - - - 0 - DNA SEQ - - CSS Ind2 PubMed: Bramswig 2017 - - - - - - 0 - - 1 Julia Lopez
-?/. - c.180C>T r.(?) p.(Phe60=) Unknown - likely benign g.46123914C>T - ARID2(NM_152641.3):c.180C>T (p.F60=) - chr12_007306 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.820C>T r.(?) p.(Arg274Ter) Unknown - likely pathogenic g.46230571C>T g.45836788C>T - - ARID2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.988_1008del r.(?) p.(Leu330_Gly336del) Unknown - VUS g.46230739_46230759del g.45836956_45836976del ARID2(NM_152641.4):c.988_1008delTTAGGCCTTGACACATTAGGA (p.L330_G336del) - ARID2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 6 c.1028T>A r.(?) p.(Leu343*) Parent #1 - VUS g.46231108T>A g.45837325T>A - - ARID2_000011 Refseq reported:hg19 PubMed: Shang L 2015 - - Unknown - - - 0 - DNA SEQ - - ID 2 PubMed: Shang L 2015 - F - - - - 0 - - 1 Julia Lopez
?/. - c.1150G>A r.(?) p.(Ala384Thr) Unknown - VUS g.46231310G>A g.45837527G>A ARID2(NM_152641.3):c.1150G>A (p.A384T) - ARID2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1374C>A r.(?) p.(Gly458=) Unknown - benign g.46233155C>A g.45839372C>A ARID2(NM_152641.4):c.1374C>A (p.G458=) - ARID2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1997_2000dup r.(?) p.(Met667IlefsTer41) Unknown - likely pathogenic g.46243903_46243906dup g.45850120_45850123dup ARID2(NM_152641.4):c.1997_2000dupAAAT (p.M667Ifs*41) - ARID2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2048G>A r.(?) p.(Arg683Lys) Unknown - VUS g.46243954G>A g.45850171G>A ARID2(NM_152641.2):c.2048G>A (p.(Arg683Lys)) - ARID2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2229T>G r.(?) p.(Val743=) Unknown - likely benign g.46244135T>G g.45850352T>G ARID2(NM_152641.4):c.2229T>G (p.V743=) - ARID2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2267T>C r.(?) p.(Val756Ala) Unknown - VUS g.46244173T>C g.45850390T>C ARID2(NM_152641.3):c.2267T>C (p.V756A) - ARID2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.2455C>T r.(?) p.(Gln819Ter) Unknown - pathogenic g.46244361C>T g.45850578C>T ARID2(NM_152641.3):c.2455C>T (p.Q819*) - ARID2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 10 c.2536del r.(?) p.(Val846LeufsTer3) Parent #1 - VUS g.46244442del g.45850659del p.(Val846Leufs*3) - ARID2_000012 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - DNA SEQ - - ID 1 PubMed: Shang L 2015 - F - - - - 0 - - 1 Julia Lopez
-/. - c.2764A>G r.(?) p.(Thr922Ala) Unknown - benign g.46244670A>G g.45850887A>G ARID2(NM_152641.3):c.2764A>G (p.T922A) - ARID2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.3216del r.(?) p.(Pro1073GlnfsTer83) Unknown - likely pathogenic g.46245122del g.45851339del - - ARID2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.3285_3286insAT r.(?) p.(Gln1096IlefsTer61) Unknown - pathogenic g.46245191_46245192insAT - ARID2(NM_152641.3):c.3285_3286insAT (p.Q1096Ifs*61) - ARID2_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 12 c.3411_3412del r.(?) p.(Gly1139Serfs*20) Parent #1 - VUS g.46245317_46245318del g.45851534_45851535del - - ARID2_000013 - PubMed: Bramswig 2017 - - De novo - - - 0 - DNA SEQ - - CSS Ind1 PubMed: Bramswig 2017 - - - - - - 0 - - 1 Julia Lopez
+/. - c.3551del r.(?) p.(Pro1184LeufsTer4) Unknown - pathogenic g.46245457del - ARID2(NM_152641.4):c.3551delC (p.P1184Lfs*4) - ARID2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.3814C>T r.(?) p.(Arg1272Ter) Unknown - likely pathogenic g.46245720C>T g.45851937C>T - - ARID2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3981A>G r.(?) p.(Ser1327=) Unknown - likely benign g.46245887A>G - ARID2(NM_152641.3):c.3981A>G (p.S1327=) - ARID2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.4146C>T r.(?) p.(Ser1382=) Unknown - likely benign g.46246052C>T g.45852269C>T ARID2(NM_152641.3):c.4146C>T (p.S1382=) - ARID2_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.4223A>G r.(?) p.(Lys1408Arg) Unknown - likely benign g.46246129A>G g.45852346A>G ARID2(NM_152641.3):c.4223A>G (p.K1408R) - ARID2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.4240A>G r.(?) p.(Arg1414Gly) Unknown - VUS g.46246146A>G g.45852363A>G ARID2(NM_152641.3):c.4240A>G (p.R1414G) - ARID2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.4300G>T r.(?) p.(Ala1434Ser) Parent #1 - VUS g.46246206G>T g.45852423G>T - - ARID2_000032 no interpretation available; 8 heterozygous, no homozygous; Clinindb (India) Faruq 2020, submtted - rs150136669 Germline - 8/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - Faruq 2020, submitted analysis 2794 individuals (India) - - India - - 0 - - 8 Mohammed Faruq
?/. 12 c.4318C>T r.(?) p.(Gln1440*) Parent #1 - VUS g.46246224C>T g.45852441C>T - - ARID2_000014 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - DNA SEQ - - ID 4 PubMed: Shang L 2015 - F - - - - 0 - - 1 Julia Lopez
?/. 12 c.4441del r.(?) p.(His1481Ilefs*4) Parent #1 - VUS g.46246347del g.45852564del - - ARID2_000015 Refseq reported:hg19 PubMed: Shang L 2015 - - De novo - - - 0 - DNA SEQ - - ID 3 PubMed: Shang L 2015 - M - - - - 0 - - 1 Julia Lopez
+/. - c.4441del r.(?) p.(His1481Ilefs*4) Parent #1 - pathogenic g.46246347del g.45852564del - - ARID2_000033 1 heterozygous, no homozygous; Clinindb (India) Faruq 2020, submtted - rs796052241 Germline - 1/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - Faruq 2020, submitted analysis 2794 individuals (India) - - India - - 0 - - 1 Mohammed Faruq
?/. - c.4583C>T r.(?) p.(Ala1528Val) Unknown - VUS g.46246489C>T - ARID2(NM_152641.3):c.4583C>T (p.A1528V) - chr12_007307 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.4585G>A r.(?) p.(Gly1529Arg) Unknown - VUS g.46246491G>A g.45852708G>A ARID2(NM_152641.3):c.4585G>A (p.G1529R) - ARID2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.4945G>C r.(?) p.(Val1649Leu) Unknown - likely benign g.46285585G>C - ARID2(NM_152641.3):c.4945G>C (p.V1649L) - ARID2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.5006G>A r.(?) p.(Trp1669Ter) Unknown - pathogenic g.46285646G>A g.45891863G>A - - ARID2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.5036G>A r.(?) p.(Arg1679Gln) Unknown - VUS g.46285676G>A g.45891893G>A ARID2(NM_152641.3):c.5036G>A (p.R1679Q) - ARID2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
./. - c.5192A>T r.(?) p.(Lys1731Met) Unknown - likely pathogenic g.46287247A>T g.45893464A>T NM_152641.3(ARID2):c.5192A>T p.(Lys1731Met) - ARID2_000002 variant could not be associated with disease phenotype PubMed: Vogelaar 2017, Journal: Vogelaar 2017 - - Germline - - - 0 - DNA SEQ-NG - - cancer, gastric Vogelaar-759A PubMed: Vogelaar 2017, Journal: Vogelaar 2017 54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer - - - - - 0 - - 1 Marjolijn JL Ligtenberg
?/. - c.5363+2444G>A r.(=) p.(=) Unknown - VUS g.46289948G>A g.45896165G>A - - ARID2_000001 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
Legend