All transcript variants in gene CEP164

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_014956.4 transcript reference sequence.

100 entries on 1 page. Showing entries 1 - 100.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-/. - c.-21-14C>T r.(=) p.(=) - benign g.117209268C>T g.117338552C>T - - CEP164_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
?/. - c.10C>T r.(?) p.(Arg4Ter) - VUS g.117209312C>T g.117338596C>T CEP164(NM_014956.4):c.10C>T (p.R4*) - CEP164_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.79C>A r.(?) p.(Gln27Lys) - benign g.117209381C>A g.117338665C>A CEP164(NM_014956.4):c.79C>A (p.Q27K) - CEP164_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.82+166T>G r.(=) p.(=) - benign g.117209550T>G g.117338834T>G CEP164(NM_014956.4):c.82+166T>G - CEP164_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.162C>T r.(?) p.(Ile54=) - benign g.117214961C>T g.117344245C>T CEP164(NM_014956.4):c.162C>T (p.I54=) - CEP164_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.190C>G r.(?) p.(Pro64Ala) - VUS g.117214989C>G g.117344273C>G CEP164(NM_014956.4):c.190C>G (p.P64A) - CEP164_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.194+20G>A r.(=) p.(=) - benign g.117215013G>A g.117344297G>A CEP164(NM_014956.4):c.194+20G>A - CEP164_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.195-52del r.(=) p.(=) - benign g.117222454del g.117351738del CEP164(NM_014956.4):c.195-52delT - CEP164_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.195-9dup r.(=) p.(=) - benign g.117222497dup g.117351781dup CEP164(NM_014956.4):c.195-9dupC - CEP164_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.237C>T r.(?) p.(Asn79=) - benign g.117222548C>T g.117351832C>T CEP164(NM_014956.4):c.237C>T (p.N79=) - CEP164_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
+?/. 5 c.277C>T r.(?) p.(Arg93Trp) - likely pathogenic g.117222588C>T g.117351872C>T g.37316C>T - CEP164_000001 - - - - Germline yes - - 0 - Muhammad Ajmal
+?/. 5 c.277C>T r.(?) p.(Arg93Trp) - likely pathogenic g.117222588C>T g.117351872C>T g.37316C>T - CEP164_000001 - - - - Germline yes - - 0 - Muhammad Ajmal
-/. - c.281G>A r.(?) p.(Ser94Asn) - benign g.117222592G>A g.117351876G>A CEP164(NM_014956.4):c.281G>A (p.S94N) - CEP164_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.281G>A r.(?) p.(Ser94Asn) - benign g.117222592G>A g.117351876G>A CEP164(NM_014956.4):c.281G>A (p.S94N) - CEP164_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-/. - c.339A>G r.(?) p.(Lys113=) - benign g.117222650A>G g.117351934A>G CEP164(NM_014956.4):c.339A>G (p.K113=) - CEP164_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.347del r.(?) p.(Lys116ArgfsTer22) - benign g.117222658del g.117351942del CEP164(NM_014956.4):c.347delA (p.K116Rfs*22) - CEP164_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.347dup r.(?) p.(Glu117GlyfsTer88) - benign g.117222658dup g.117351942dup CEP164(NM_014956.4):c.347dupA (p.E117Gfs*88) - CEP164_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.380C>A r.(?) p.(Pro127His) - VUS g.117222691C>A g.117351975C>A CEP164(NM_014956.4):c.380C>A (p.P127H) - CEP164_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.380C>A r.(?) p.(Pro127His) - likely benign g.117222691C>A g.117351975C>A CEP164(NM_014956.4):c.380C>A (p.P127H) - CEP164_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.380C>A r.(?) p.(Pro127His) - likely benign g.117222691C>A g.117351975C>A CEP164(NM_014956.4):c.380C>A (p.P127H) - CEP164_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.380C>T r.(?) p.(Pro127Leu) - likely benign g.117222691C>T - CEP164(NM_014956.4):c.380C>T (p.P127L) - CEP164_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.380C>T r.(?) p.(Pro127Leu) - likely benign g.117222691C>T - CEP164(NM_014956.4):c.380C>T (p.P127L) - CEP164_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.395C>G r.(?) p.(Ala132Gly) - benign g.117232552C>G g.117361836C>G CEP164(NM_014956.4):c.395C>G (p.A132G) - CEP164_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.458T>C r.(?) p.(Leu153Pro) - VUS g.117232615T>C g.117361899T>C CEP164(NM_014956.4):c.458T>C (p.L153P) - CEP164_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.499G>A r.(?) p.(Val167Met) - VUS g.117232656G>A g.117361940G>A CEP164(NM_014956.4):c.499G>A (p.V167M) - CEP164_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.548T>A r.(?) p.(Met183Lys) - likely benign g.117232705T>A g.117361989T>A CEP164(NM_014956.4):c.548T>A (p.M183K) - CEP164_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.688-7T>C r.(=) p.(=) - likely benign g.117234138T>C g.117363422T>C CEP164(NM_014956.4):c.688-7T>C - CEP164_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.696C>T r.(?) p.(His232=) - benign g.117234153C>T g.117363437C>T CEP164(NM_014956.4):c.696C>T (p.H232=) - CEP164_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.748G>A r.(?) p.(Gly250Ser) - benign g.117234205G>A g.117363489G>A CEP164(NM_014956.4):c.748G>A (p.G250S) - CEP164_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.1026C>G r.(?) p.(Ala342=) - benign g.117242056C>G g.117371340C>G CEP164(NM_014956.4):c.1026C>G (p.A342=) - CEP164_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.1153-15G>T r.(=) p.(=) - likely benign g.117244452G>T g.117373736G>T CEP164(NM_014956.4):c.1153-15G>T - CEP164_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.1158G>A r.(?) p.(Leu386=) - likely benign g.117244472G>A g.117373756G>A CEP164(NM_014956.4):c.1158G>A (p.L386=) - CEP164_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1220C>T r.(?) p.(Ser407Phe) - VUS g.117244534C>T g.117373818C>T CEP164(NM_014956.4):c.1220C>T (p.S407F) - CEP164_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1230C>T r.(?) p.(Gly410=) - likely benign g.117244544C>T g.117373828C>T CEP164(NM_014956.4):c.1230C>T (p.G410=) - CEP164_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1260G>A r.(?) p.(Ser420=) - likely benign g.117246450G>A g.117375734G>A CEP164(NM_014956.4):c.1260G>A (p.S420=) - CEP164_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.1318-14C>T r.(=) p.(=) - benign g.117251316C>T g.117380600C>T CEP164(NM_014956.4):c.1318-14C>T - CEP164_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.1430A>G r.(?) p.(His477Arg) - benign g.117252437A>G g.117381721A>G CEP164(NM_014956.4):c.1430A>G (p.H477R) - CEP164_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.1430A>G r.(?) p.(His477Arg) - benign g.117252437A>G g.117381721A>G - - CEP164_000019 34 heterozygous; Clinindb (India) Faruq 2020, submtted - rs117083334 Germline - 34/2795 individuals - 0 - Mohammed Faruq
-/. - c.1430A>G r.(?) p.(His477Arg) - benign g.117252437A>G g.117381721A>G - - CEP164_000019 1 homozygous; Clinindb (India) Faruq 2020, submtted - rs117083334 Germline - 1/2795 individuals - 0 - Mohammed Faruq
-/. - c.1480C>A r.(?) p.(Pro494Thr) - benign g.117252487C>A g.117381771C>A CEP164(NM_014956.4):c.1480C>A (p.P494T) - CEP164_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.1481dup r.(?) p.(Pro495SerfsTer43) - pathogenic g.117252488dup g.117381772dup CEP164(NM_014956.4):c.1481dupC (p.P495Sfs*43) - CEP164_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1482T>C r.(?) p.(Pro494=) - benign g.117252489T>C g.117381773T>C CEP164(NM_014956.4):c.1482T>C (p.P494=) - CEP164_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.1482T>C r.(?) p.(Pro494=) - benign g.117252489T>C g.117381773T>C CEP164(NM_014956.4):c.1482T>C (p.P494=) - CEP164_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-/. - c.1484C>G r.(?) p.(Pro495Arg) - benign g.117252491C>G g.117381775C>G CEP164(NM_014956.4):c.1484C>G (p.P495R) - CEP164_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.1577+14_1577+37del r.(=) p.(=) - likely benign g.117252598_117252621del g.117381882_117381905del CEP164(NM_014956.4):c.1577+14_1577+37delGAAGCATCCTCATGAGGATGAGGG - CEP164_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1639G>A r.(?) p.(Glu547Lys) - likely benign g.117253573G>A g.117382857G>A CEP164(NM_014956.4):c.1639G>A (p.E547K) - CEP164_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1689G>A r.(?) p.(Val563=) - VUS g.117253623G>A g.117382907G>A - - CEP164_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.1702A>C r.(?) p.(Thr568Pro) - benign g.117253636A>C g.117382920A>C CEP164(NM_014956.4):c.1702A>C (p.T568P) - CEP164_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.1783A>G r.(?) p.(Met595Val) - likely benign g.117257977A>G g.117387261A>G CEP164(NM_014956.4):c.1783A>G (p.M595V) - CEP164_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1934+3C>T r.spl? p.? - benign g.117258131C>T g.117387415C>T CEP164(NM_014956.4):c.1934+3C>T - CEP164_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.1934+8C>T r.(=) p.(=) - benign g.117258136C>T g.117387420C>T CEP164(NM_014956.4):c.1934+8C>T - CEP164_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.1935-5C>G r.spl? p.? - benign g.117261488C>G g.117390772C>G CEP164(NM_014956.4):c.1935-5C>G - CEP164_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.1935-5C>G r.spl? p.? - benign g.117261488C>G g.117390772C>G CEP164(NM_014956.4):c.1935-5C>G - CEP164_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-?/. - c.1975G>A r.(?) p.(Glu659Lys) - likely benign g.117261533G>A g.117390817G>A CEP164(NM_014956.4):c.1975G>A (p.E659K) - CEP164_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.2153A>T r.(?) p.(Asn718Ile) - VUS g.117261801A>T - CEP164(NM_014956.4):c.2153A>T (p.N718I) - CEP164_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2206G>A r.(?) p.(Glu736Lys) - likely benign g.117261854G>A g.117391138G>A CEP164(NM_014956.4):c.2206G>A (p.E736K) - CEP164_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.2209C>T r.(?) p.(Gln737Ter) - likely pathogenic g.117261857C>T g.117391141C>T CEP164(NM_014956.4):c.2209C>T (p.Q737*) - CEP164_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.2284-75A>G r.(=) p.(=) - benign g.117262867A>G g.117392151A>G CEP164(NM_014956.4):c.2284-75A>G - CEP164_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
?/. - c.2326C>T r.(?) p.(Arg776Trp) - VUS g.117262984C>T g.117392268C>T CEP164(NM_014956.4):c.2326C>T (p.R776W) - CEP164_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.2583G>A r.(?) p.(Val861=) - likely benign g.117263809G>A g.117393093G>A CEP164(NM_014956.4):c.2583G>A (p.V861=) - CEP164_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.2655C>T r.(?) p.(Thr885=) - benign g.117265104C>T g.117394388C>T CEP164(NM_014956.4):c.2655C>T (p.T885=) - CEP164_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.2744G>A r.(?) p.(Arg915His) - VUS g.117265193G>A g.117394477G>A CEP164(NM_014956.4):c.2744G>A (p.R915H) - CEP164_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.2772C>G r.(?) p.(Leu924=) - benign g.117265647C>G g.117394931C>G CEP164(NM_014956.4):c.2772C>G (p.L924=) - CEP164_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.2772C>G r.(?) p.(Leu924=) - likely benign g.117265647C>G g.117394931C>G CEP164(NM_014956.4):c.2772C>G (p.L924=) - CEP164_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.2844+8A>G r.(=) p.(=) - benign g.117265727A>G g.117395011A>G CEP164(NM_014956.4):c.2844+8A>G - CEP164_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.2930A>T r.(?) p.(His977Leu) - VUS g.117266279A>T g.117395563A>T CEP164(NM_014956.4):c.2930A>T (p.H977L) - CEP164_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.2963C>G r.(?) p.(Thr988Ser) - benign g.117266312C>G g.117395596C>G CEP164(NM_014956.4):c.2963C>G (p.T988S) - CEP164_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
?/. - c.3001C>G r.(?) p.(Leu1001Val) - VUS g.117266350C>G g.117395634C>G CEP164(NM_014956.4):c.3001C>G (p.L1001V) - CEP164_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.3001C>G r.(?) p.(Leu1001Val) - VUS g.117266350C>G g.117395634C>G CEP164(NM_014956.4):c.3001C>G (p.L1001V) - CEP164_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.3019C>T r.(?) p.(Arg1007Cys) - VUS g.117266368C>T g.117395652C>T CEP164(NM_014956.4):c.3019C>T (p.R1007C) - CEP164_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.3147G>A r.(?) p.(Glu1049=) - likely benign g.117266827G>A g.117396111G>A CEP164(NM_014956.4):c.3147G>A (p.E1049=) - CEP164_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.3188T>C r.(?) p.(Ile1063Thr) - VUS g.117266868T>C g.117396152T>C CEP164(NM_014956.4):c.3188T>C (p.I1063T) - CEP164_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.3216+20_3216+33del r.(=) p.(=) - benign g.117266916_117266929del g.117396200_117396213del CEP164(NM_014956.4):c.3216+20_3216+33delCTGGGGGCTGGGGC - CEP164_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.3279-12C>T r.(=) p.(=) - benign g.117267795C>T g.117397079C>T CEP164(NM_014956.4):c.3279-12C>T - CEP164_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.3356A>G r.(?) p.(Gln1119Arg) - benign g.117267884A>G g.117397168A>G CEP164(NM_014956.4):c.3356A>G (p.Q1119R) - CEP164_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.3484C>A r.(?) p.(Arg1162Ser) - likely benign g.117268012C>A g.117397296C>A CEP164(NM_014956.4):c.3484C>A (p.R1162S) - CEP164_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.3484C>T r.(?) p.(Arg1162Cys) - VUS g.117268012C>T g.117397296C>T CEP164(NM_014956.4):c.3484C>T (p.R1162C) - CEP164_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3501+7A>G r.(=) p.(=) - likely benign g.117268036A>G g.117397320A>G CEP164(NM_014956.4):c.3501+7A>G - CEP164_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.3716C>T r.(?) p.(Pro1239Leu) - benign g.117279712C>T g.117408996C>T CEP164(NM_014956.4):c.3716C>T (p.P1239L) - CEP164_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.3748+11G>A r.(=) p.(=) - likely benign g.117279755G>A g.117409039G>A CEP164(NM_014956.4):c.3748+11G>A - CEP164_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.3932C>G r.(?) p.(Thr1311Ser) - benign g.117280517C>G g.117409801C>G CEP164(NM_014956.4):c.3932C>G (p.T1311S) - CEP164_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.3940T>A r.(?) p.(Tyr1314Asn) - likely benign g.117280525T>A g.117409809T>A CEP164(NM_001271933.1):c.3925T>A (p.(Tyr1309Asn)) - CEP164_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.3940T>C r.(?) p.(Tyr1314His) - likely benign g.117280525T>C g.117409809T>C CEP164(NM_014956.4):c.3940T>C (p.Y1314H) - CEP164_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.3940T>C r.(?) p.(Tyr1314His) - likely benign g.117280525T>C g.117409809T>C CEP164(NM_014956.4):c.3940T>C (p.Y1314H) - CEP164_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3941A>C r.(?) p.(Tyr1314Ser) - likely benign g.117280526A>C g.117409810A>C CEP164(NM_014956.4):c.3941A>C (p.Y1314S) - CEP164_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3999A>G r.(?) p.(Gln1333=) - likely benign g.117280584A>G g.117409868A>G CEP164(NM_014956.4):c.3999A>G (p.Q1333=) - CEP164_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.4025C>T r.(?) p.(Pro1342Leu) - VUS g.117280610C>T - CEP164(NM_014956.4):c.4025C>T (p.P1342L) - CEP164_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.4060G>A r.(?) p.(Asp1354Asn) - likely benign g.117280645G>A - CEP164(NM_014956.4):c.4060G>A (p.D1354N) - CEP164_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.4096+15G>A r.(=) p.(=) - likely benign g.117280696G>A g.117409980G>A CEP164(NM_014956.4):c.4096+15G>A - CEP164_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.4119C>T r.(?) p.(Asn1373=) - benign g.117281566C>T g.117410850C>T CEP164(NM_014956.4):c.4119C>T (p.N1373=) - CEP164_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.4119C>T r.(=) p.(=) - benign g.117281566C>T g.117410850C>T - - CEP164_000040 156 heterozygous; Clinindb (India) Faruq 2020, submtted - rs73016324 Germline - 156/2793 individuals - 0 - Mohammed Faruq
-/. - c.4119C>T r.(=) p.(=) - benign g.117281566C>T g.117410850C>T - - CEP164_000040 3 homozygous; Clinindb (India) Faruq 2020, submtted - rs73016324 Germline - 3/2793 individuals - 0 - Mohammed Faruq
-/. - c.4212G>A r.(?) p.(Ala1404=) - benign g.117282559G>A g.117411843G>A CEP164(NM_014956.4):c.4212G>A (p.A1404=) - CEP164_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.4228C>T r.(?) p.(Gln1410Ter) - VUS g.117282575C>T g.117411859C>T CEP164(NM_014956.4):c.4228C>T (p.Q1410*) - CEP164_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.4265G>A r.(?) p.(Arg1422His) - likely benign g.117282612G>A g.117411896G>A CEP164(NM_014956.4):c.4265G>A (p.R1422H) - CEP164_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.4265G>A r.(?) p.(Arg1422His) - likely benign g.117282612G>A g.117411896G>A CEP164(NM_014956.4):c.4265G>A (p.R1422H) - CEP164_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.4299G>T r.(?) p.(Ser1433=) - benign g.117282800G>T g.117412084G>T CEP164(NM_014956.4):c.4299G>T (p.S1433=) - CEP164_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.4299G>T r.(?) p.(Ser1433=) - benign g.117282800G>T g.117412084G>T CEP164(NM_014956.4):c.4299G>T (p.S1433=) - CEP164_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
?/. - c.4330C>G r.(?) p.(Leu1444Val) - VUS g.117282831C>G g.117412115C>G CEP164(NM_014956.4):c.4330C>G (p.L1444V) - CEP164_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.4355A>G r.(?) p.(His1452Arg) - likely benign g.117282856A>G g.117412140A>G CEP164(NM_014956.4):c.4355A>G (p.H1452R) - CEP164_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
Legend