Full data view for gene CEP164

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_014956.4 transcript reference sequence.

140 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

-/. - c.-21-14C>T r.(=) p.(=) Unknown - benign g.117209268C>T g.117338552C>T - - CEP164_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.5C>T r.(?) p.(Ala2Val) Unknown - VUS g.117209307C>T - CEP164(NM_014956.4):c.5C>T (p.A2V) - CEP164_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.10C>T r.(?) p.(Arg4Ter) Unknown - VUS g.117209312C>T g.117338596C>T CEP164(NM_014956.4):c.10C>T (p.R4*) - CEP164_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.13C>A r.(?) p.(Pro5Thr) Unknown - VUS g.117209315C>A g.117338599C>A - - CEP164_000097 1/1266 control chromosomes PubMed: Xu 2015 - - Germline - 1/314 case chromosomes - 0 - DNA SEQ-NG - gene panel retinal disease RP253 PubMed: Xu 2014 patient F - China - - 0 - - 1 LOVD
-/. - c.79C>A r.(?) p.(Gln27Lys) Unknown - benign g.117209381C>A g.117338665C>A CEP164(NM_001271933.1):c.79C>A (p.(Gln27Lys)), CEP164(NM_014956.4):c.79C>A (p.Q27K) - CEP164_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.79C>A r.(?) p.(Gln27Lys) Unknown - likely benign g.117209381C>A - CEP164(NM_001271933.1):c.79C>A (p.(Gln27Lys)), CEP164(NM_014956.4):c.79C>A (p.Q27K) - CEP164_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.82+166T>G r.(=) p.(=) Unknown - benign g.117209550T>G g.117338834T>G CEP164(NM_014956.5):c.82+166T>G - CEP164_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.162C>T r.(?) p.(Ile54=) Unknown - benign g.117214961C>T g.117344245C>T CEP164(NM_014956.4):c.162C>T (p.I54=) - CEP164_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.190C>G r.(?) p.(Pro64Ala) Unknown - VUS g.117214989C>G g.117344273C>G CEP164(NM_014956.4):c.190C>G (p.P64A) - CEP164_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.190C>G r.(?) p.(Pro64Ala) Unknown - VUS g.117214989C>G g.117344273C>G - - CEP164_000004 - PubMed: Tiwari 2016 - - Germline - - - 0 - DNA SEQ-NG - WES retinal disease Case70559 PubMed: Tiwari 2016 see paper M - Switzerland - - 0 - - 1 LOVD
-/. - c.194+20G>A r.(=) p.(=) Unknown - benign g.117215013G>A g.117344297G>A CEP164(NM_014956.4):c.194+20G>A - CEP164_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.195-52del r.(=) p.(=) Unknown - benign g.117222454del g.117351738del CEP164(NM_014956.5):c.195-52delT - CEP164_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.195-9dup r.(=) p.(=) Unknown - benign g.117222497dup g.117351781dup CEP164(NM_014956.4):c.195-9dupC - CEP164_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.195-2A>T r.spl p.(?) Unknown - likely pathogenic g.117222504A>T g.117351788A>T c.195-2A>T - CEP164_000100 - PubMed: Brooks 2018 - - Germline ? - - 0 - DNA SEQ-NG blood targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome retinal disease 290 PubMed: Brooks 2018 family 76 F - United States - - 0 - - 1 LOVD
-/. - c.237C>T r.(?) p.(Asn79=) Unknown - benign g.117222548C>T g.117351832C>T CEP164(NM_014956.4):c.237C>T (p.N79=) - CEP164_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. 5 c.277C>T r.(?) p.(Arg93Trp) Both (homozygous) - likely pathogenic g.117222588C>T g.117351872C>T g.37316C>T - CEP164_000001 - - - - Germline yes - - 0 - DNA SEQ, SEQ-NG - - BBS - - - M yes Pakistan - - 0 - - 1 Muhammad Ajmal
+?/. 5 c.277C>T r.(?) p.(Arg93Trp) Both (homozygous) - likely pathogenic g.117222588C>T g.117351872C>T g.37316C>T - CEP164_000001 - - - - Germline yes - - 0 - DNA SEQ, SEQ-NG - - BBS - - - F yes Pakistan - - 0 - - 1 Muhammad Ajmal
+?/. - c.277C>T r.(?) p.(Arg93Trp) Unknown - likely pathogenic g.117222588C>T g.117351872C>T c.277C>T; p.R93W - CEP164_000001 - PubMed: Brooks 2018 - - Germline ? - - 0 - DNA SEQ-NG blood targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome retinal disease 290 PubMed: Brooks 2018 family 76 F - United States - - 0 - - 1 LOVD
+?/. - c.277C>T r.(?) p.(Arg93Trp) Both (homozygous) - likely pathogenic (recessive) g.117222588C>T g.117351872C>T CEP164 c.277C>T, p.(R93W) - CEP164_000001 homozygous PubMed: Maria 2016 - - Germline yes - - 0 - DNA SEQ-NG-I, SEQ blood targeted mutation screening, targated exome sequencing of BBS genes, whole exome sequencing retinal disease F05_V:2 PubMed: Maria 2016 family F05 M yes - Pakistani - 0 - - 1 LOVD
+?/. - c.277C>T r.(?) p.(Arg93Trp) Both (homozygous) - likely pathogenic (recessive) g.117222588C>T g.117351872C>T CEP164 c.277C>T, p.(R93W) - CEP164_000001 homozygous PubMed: Maria 2016 - - Germline yes - - 0 - DNA SEQ-NG-I, SEQ blood targeted mutation screening, targated exome sequencing of BBS genes, whole exome sequencing retinal disease F05_V:4 PubMed: Maria 2016 family F05 F yes - Pakistani - 0 - - 1 LOVD
-/. - c.281G>A r.(?) p.(Ser94Asn) Unknown - benign g.117222592G>A g.117351876G>A CEP164(NM_014956.5):c.281G>A (p.S94N) - CEP164_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.281G>A r.(?) p.(Ser94Asn) Unknown - benign g.117222592G>A g.117351876G>A CEP164(NM_014956.5):c.281G>A (p.S94N) - CEP164_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.322dup r.(?) p.(Ala108Glyfs*3) Unknown - pathogenic g.117222633dup - CEP164(NM_014956.4):c.322dupG (p.A108Gfs*3) - CEP164_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.339A>G r.(?) p.(Lys113=) Unknown - benign g.117222650A>G g.117351934A>G CEP164(NM_014956.4):c.339A>G (p.K113=) - CEP164_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.347del r.(?) p.(Lys116ArgfsTer22) Unknown - benign g.117222658del g.117351942del CEP164(NM_014956.4):c.347delA (p.K116Rfs*22) - CEP164_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.347dup r.(?) p.(Glu117GlyfsTer88) Unknown - benign g.117222658dup g.117351942dup CEP164(NM_014956.4):c.347dupA (p.E117Gfs*88) - CEP164_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.380C>A r.(?) p.(Pro127His) Unknown - likely benign g.117222691C>A g.117351975C>A CEP164(NM_014956.4):c.380C>A (p.P127H), CEP164(NM_014956.5):c.380C>A (p.P127H) - CEP164_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.380C>A r.(?) p.(Pro127His) Unknown - likely benign g.117222691C>A g.117351975C>A CEP164(NM_014956.4):c.380C>A (p.P127H), CEP164(NM_014956.5):c.380C>A (p.P127H) - CEP164_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.380C>A r.(?) p.(Pro127His) Unknown - likely benign g.117222691C>A g.117351975C>A CEP164(NM_014956.4):c.380C>A (p.P127H), CEP164(NM_014956.5):c.380C>A (p.P127H) - CEP164_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.380C>T r.(?) p.(Pro127Leu) Unknown - likely benign g.117222691C>T - CEP164(NM_014956.4):c.380C>T (p.P127L), CEP164(NM_014956.5):c.380C>T (p.P127L) - CEP164_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.380C>T r.(?) p.(Pro127Leu) Unknown - likely benign g.117222691C>T - CEP164(NM_014956.4):c.380C>T (p.P127L), CEP164(NM_014956.5):c.380C>T (p.P127L) - CEP164_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.395C>G r.(?) p.(Ala132Gly) Unknown - benign g.117232552C>G g.117361836C>G CEP164(NM_014956.4):c.395C>G (p.A132G) - CEP164_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.458T>C r.(?) p.(Leu153Pro) Unknown - VUS g.117232615T>C g.117361899T>C CEP164(NM_014956.4):c.458T>C (p.L153P) - CEP164_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.485G>A r.(?) p.(Arg162His) Unknown - VUS g.117232642G>A - CEP164(NM_014956.4):c.485G>A (p.R162H) - CEP164_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.491C>G r.(?) p.(Ser164Cys) Unknown - VUS g.117232648C>G - CEP164(NM_014956.4):c.491C>G (p.S164C) - CEP164_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.499G>A r.(?) p.(Val167Met) Unknown - VUS g.117232656G>A g.117361940G>A CEP164(NM_014956.4):c.499G>A (p.V167M) - CEP164_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.548T>A r.(?) p.(Met183Lys) Unknown - likely benign g.117232705T>A g.117361989T>A CEP164(NM_014956.4):c.548T>A (p.M183K) - CEP164_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.553-7T>C r.spl p.? Unknown - VUS g.117233113T>C g.117362397T>C - - CEP164_000098 0/1266 control chromosomes PubMed: Xu 2015 - - Germline - 1/314 case chromosomes - 0 - DNA DGGE, SEQ - - GA1 - PubMed: Zafeiriou 2000 twin of 11508549-Pat.4 - ? Greece - - - - - 1 Katrin Hinderhofer
-?/. - c.688-7T>C r.(=) p.(=) Unknown - likely benign g.117234138T>C g.117363422T>C CEP164(NM_014956.4):c.688-7T>C - CEP164_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.696C>T r.(?) p.(His232=) Unknown - benign g.117234153C>T g.117363437C>T CEP164(NM_014956.4):c.696C>T (p.H232=) - CEP164_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.748G>A r.(?) p.(Gly250Ser) Unknown - benign g.117234205G>A g.117363489G>A CEP164(NM_014956.4):c.748G>A (p.G250S) - CEP164_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.799_801del r.(?) p.(Lys267del) Unknown - VUS g.117241829_117241831del g.117371113_117371115del - - CEP164_000095 no genotypes reported PubMed: Sergouniotis 2016 - rs764638875 Germline - 1/486 individuals - 0 - DNA SEQ-NG - gene panel retinal disease - PubMed: Sergouniotis 2016 analysis 486 cases - - United Kingdom (Great Britain) - - 0 - - 1 LOVD
-?/. - c.828C>T r.(?) p.(Ala276=) Unknown - likely benign g.117241858C>T - CEP164(NM_014956.4):c.828C>T (p.A276=) - CEP164_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.865G>T r.(?) p.(Ala289Ser) Unknown - VUS g.117241895G>T - CEP164(NM_014956.4):c.865G>T (p.A289S) - CEP164_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1026C>G r.(?) p.(Ala342=) Unknown - benign g.117242056C>G g.117371340C>G CEP164(NM_014956.4):c.1026C>G (p.A342=) - CEP164_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1106A>C r.(?) p.(Lys369Thr) Unknown - VUS g.117242136A>C g.117371420A>C - - CEP164_000099 0/1266 control chromosomes PubMed: Xu 2015 - - Germline - 1/314 case chromosomes - 0 - DNA DGGE, SEQ - - GA1 - PubMed: Zafeiriou 2000 twin of 11508549-Pat.4 - ? Greece - - - - - 1 Katrin Hinderhofer
-?/. - c.1152A>G r.(?) p.(Gln384=) Unknown - likely benign g.117242182A>G - CEP164(NM_014956.4):c.1152A>G (p.Q384=) - CEP164_000115 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1153-15G>T r.(=) p.(=) Unknown - likely benign g.117244452G>T g.117373736G>T CEP164(NM_014956.4):c.1153-15G>T - CEP164_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1158G>A r.(?) p.(Leu386=) Unknown - likely benign g.117244472G>A g.117373756G>A CEP164(NM_014956.4):c.1158G>A (p.L386=) - CEP164_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1220C>T r.(?) p.(Ser407Phe) Unknown - VUS g.117244534C>T g.117373818C>T CEP164(NM_014956.4):c.1220C>T (p.S407F) - CEP164_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1230C>T r.(?) p.(Gly410=) Unknown - likely benign g.117244544C>T g.117373828C>T CEP164(NM_014956.4):c.1230C>T (p.G410=) - CEP164_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1245T>C r.(?) p.(Phe415=) Unknown - likely benign g.117246435T>C - CEP164(NM_014956.4):c.1245T>C (p.F415=) - CEP164_000116 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1260G>A r.(?) p.(Ser420=) Unknown - likely benign g.117246450G>A g.117375734G>A CEP164(NM_014956.4):c.1260G>A (p.S420=) - CEP164_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1318-14C>T r.(=) p.(=) Unknown - benign g.117251316C>T g.117380600C>T CEP164(NM_014956.4):c.1318-14C>T - CEP164_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1430A>G r.(?) p.(His477Arg) Unknown - benign g.117252437A>G g.117381721A>G CEP164(NM_014956.5):c.1430A>G (p.H477R) - CEP164_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1430A>G r.(?) p.(His477Arg) Parent #1 - benign g.117252437A>G g.117381721A>G - - CEP164_000019 34 heterozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs117083334 Germline - 34/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 34 Mohammed Faruq
-/. - c.1430A>G r.(?) p.(His477Arg) Both (homozygous) - benign g.117252437A>G g.117381721A>G - - CEP164_000019 1 homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs117083334 Germline - 1/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 1 Mohammed Faruq
-/. - c.1480C>A r.(?) p.(Pro494Thr) Unknown - benign g.117252487C>A g.117381771C>A CEP164(NM_014956.4):c.1480C>A (p.P494T) - CEP164_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1481dup r.(?) p.(Pro495SerfsTer43) Unknown - pathogenic g.117252488dup g.117381772dup CEP164(NM_014956.4):c.1481dupC (p.P495Sfs*43) - CEP164_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1482T>C r.(?) p.(Pro494=) Unknown - benign g.117252489T>C g.117381773T>C CEP164(NM_014956.5):c.1482T>C (p.P494=) - CEP164_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1482T>C r.(?) p.(Pro494=) Unknown - benign g.117252489T>C g.117381773T>C CEP164(NM_014956.5):c.1482T>C (p.P494=) - CEP164_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1484C>G r.(?) p.(Pro495Arg) Unknown - VUS g.117252491C>G g.117381775C>G - - CEP164_000022 0/1266 control chromosomes PubMed: Xu 2015 - rs59763167 Germline - 3/314 case chromosomes - 0 - DNA SEQ-NG - gene panel retinal disease RP253 PubMed: Xu 2014 patient F - China - - 0 - - 1 LOVD
-?/. - c.1577+14_1577+37del r.(=) p.(=) Unknown - likely benign g.117252598_117252621del g.117381882_117381905del CEP164(NM_014956.4):c.1577+14_1577+37delGAAGCATCCTCATGAGGATGAGGG - CEP164_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1639G>A r.(?) p.(Glu547Lys) Unknown - likely benign g.117253573G>A g.117382857G>A CEP164(NM_014956.5):c.1639G>A (p.E547K) - CEP164_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1689G>A r.(?) p.(Val563=) Unknown - VUS g.117253623G>A g.117382907G>A - - CEP164_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1702A>C r.(?) p.(Thr568Pro) Unknown - benign g.117253636A>C g.117382920A>C CEP164(NM_014956.4):c.1702A>C (p.T568P) - CEP164_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.1702A>C r.(?) p.(Thr568Pro) Both (homozygous) - likely pathogenic g.117253636A>C g.117382920A>C - - CEP164_000023 - PubMed: Maranha 2015, Journal: Maranhao 2015 - rs74388237 Germline - - - 0 - DNA SEQ - - retinal disease PKRD142;61142 PubMed: Maranha 2015, Journal: Maranhao 2015, PubMed: Li 2017 6-generation family, 11 affecteds (4F, 7M), unaffected heterozygous carrier parents/relatives F;M yes Pakistan - - 0 - - 11 Johan den Dunnen
-?/. - c.1783A>G r.(?) p.(Met595Val) Unknown - likely benign g.117257977A>G g.117387261A>G CEP164(NM_014956.4):c.1783A>G (p.M595V) - CEP164_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1934+3C>T r.spl? p.? Unknown - benign g.117258131C>T g.117387415C>T CEP164(NM_014956.4):c.1934+3C>T - CEP164_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1934+8C>T r.(=) p.(=) Unknown - benign g.117258136C>T g.117387420C>T CEP164(NM_014956.4):c.1934+8C>T - CEP164_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1935-5C>G r.spl? p.? Unknown - benign g.117261488C>G g.117390772C>G CEP164(NM_014956.5):c.1935-5C>G - CEP164_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1935-5C>G r.spl? p.? Unknown - benign g.117261488C>G g.117390772C>G CEP164(NM_014956.5):c.1935-5C>G - CEP164_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1975G>A r.(?) p.(Glu659Lys) Unknown - likely benign g.117261533G>A g.117390817G>A CEP164(NM_014956.4):c.1975G>A (p.E659K) - CEP164_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2153A>T r.(?) p.(Asn718Ile) Unknown - VUS g.117261801A>T - CEP164(NM_014956.4):c.2153A>T (p.N718I) - CEP164_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2206G>A r.(?) p.(Glu736Lys) Unknown - likely benign g.117261854G>A g.117391138G>A CEP164(NM_014956.4):c.2206G>A (p.E736K) - CEP164_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.2209C>T r.(?) p.(Gln737Ter) Unknown - likely pathogenic g.117261857C>T g.117391141C>T CEP164(NM_014956.4):c.2209C>T (p.Q737*) - CEP164_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2255G>A r.(?) p.(Arg752Lys) Unknown - likely benign g.117261903G>A - CEP164(NM_014956.4):c.2255G>A (p.R752K) - CEP164_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2284-75A>G r.(=) p.(=) Unknown - benign g.117262867A>G g.117392151A>G CEP164(NM_014956.5):c.2284-75A>G - CEP164_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.2326C>T r.(?) p.(Arg776Trp) Unknown - VUS g.117262984C>T g.117392268C>T CEP164(NM_014956.4):c.2326C>T (p.R776W) - CEP164_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2362-15C>T r.(=) p.(=) Unknown - likely benign g.117263197C>T - CEP164(NM_014956.5):c.2362-15C>T - CEP164_000104 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2583G>A r.(?) p.(Val861=) Unknown - likely benign g.117263809G>A g.117393093G>A CEP164(NM_014956.4):c.2583G>A (p.V861=) - CEP164_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2655C>T r.(?) p.(Thr885=) Unknown - benign g.117265104C>T g.117394388C>T CEP164(NM_014956.4):c.2655C>T (p.T885=) - CEP164_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2744G>A r.(?) p.(Arg915His) Unknown - VUS g.117265193G>A g.117394477G>A CEP164(NM_014956.4):c.2744G>A (p.R915H) - CEP164_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2746C>A r.(?) p.(Arg916=) Unknown - likely benign g.117265195C>A - CEP164(NM_014956.4):c.2746C>A (p.R916=) - CEP164_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2772C>G r.(?) p.(Leu924=) Unknown - benign g.117265647C>G g.117394931C>G CEP164(NM_014956.4):c.2772C>G (p.L924=), CEP164(NM_014956.5):c.2772C>G (p.L924=) - CEP164_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2772C>G r.(?) p.(Leu924=) Unknown - likely benign g.117265647C>G g.117394931C>G CEP164(NM_014956.4):c.2772C>G (p.L924=), CEP164(NM_014956.5):c.2772C>G (p.L924=) - CEP164_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2772C>G r.(?) p.(Leu924=) Unknown - likely benign g.117265647C>G - CEP164(NM_014956.4):c.2772C>G (p.L924=), CEP164(NM_014956.5):c.2772C>G (p.L924=) - CEP164_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2844+8A>G r.(=) p.(=) Unknown - benign g.117265727A>G g.117395011A>G CEP164(NM_014956.4):c.2844+8A>G - CEP164_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.2870A>T r.(?) p.(Gln957Leu) Unknown - VUS g.117265864A>T - CEP164(NM_014956.4):c.2870A>T (p.Q957L) - CEP164_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2930A>T r.(?) p.(His977Leu) Unknown - VUS g.117266279A>T g.117395563A>T CEP164(NM_014956.4):c.2930A>T (p.H977L) - CEP164_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2943G>C r.(?) p.(Glu981Asp) Unknown - VUS g.117266292G>C - CEP164(NM_014956.4):c.2943G>C (p.E981D) - CEP164_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2963C>G r.(?) p.(Thr988Ser) Unknown - benign g.117266312C>G g.117395596C>G CEP164(NM_014956.5):c.2963C>G (p.T988S) - CEP164_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3001C>G r.(?) p.(Leu1001Val) Unknown - VUS g.117266350C>G g.117395634C>G CEP164(NM_014956.4):c.3001C>G (p.L1001V) - CEP164_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3001C>G r.(?) p.(Leu1001Val) Unknown - VUS g.117266350C>G g.117395634C>G CEP164(NM_014956.4):c.3001C>G (p.L1001V) - CEP164_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3019C>T r.(?) p.(Arg1007Cys) Unknown - VUS g.117266368C>T g.117395652C>T CEP164(NM_014956.4):c.3019C>T (p.R1007C) - CEP164_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3147G>A r.(?) p.(Glu1049=) Unknown - likely benign g.117266827G>A g.117396111G>A CEP164(NM_014956.4):c.3147G>A (p.E1049=) - CEP164_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.3188T>C r.(?) p.(Ile1063Thr) Unknown - VUS g.117266868T>C g.117396152T>C CEP164(NM_014956.4):c.3188T>C (p.I1063T) - CEP164_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3216+20_3216+33del r.(=) p.(=) Unknown - benign g.117266916_117266929del g.117396200_117396213del CEP164(NM_014956.5):c.3216+20_3216+33delCTGGGGGCTGGGGC - CEP164_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3225C>T r.(?) p.(Thr1075=) Unknown - likely benign g.117267274C>T - CEP164(NM_014956.4):c.3225C>T (p.T1075=) - CEP164_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.3279-12C>T r.(=) p.(=) Unknown - benign g.117267795C>T g.117397079C>T CEP164(NM_014956.4):c.3279-12C>T - CEP164_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
Legend   How to query   « First ‹ Prev     1 2     Next › Last »