Unique variants in the CYP2A6 gene

Information The variants shown are described using the NM_000762.5 transcript reference sequence.

185 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Haplotype     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/-? 40 - c.?con? r.(?) p.? CYP2A6*10, CYP2A6*19, CYP2A6*1B10, CYP2A6*1B11, CYP2A6*1B12, CYP2A6*1B13, CYP2A6*1B14, CYP2A6*1B2, 12 more items - likely benign g.?con? - gene conversion in the 3' flanking region - CYP2A6_000007 reference haplotype CYP2A6*10, reference haplotype CYP2A6*19, reference haplotype CYP2A6*1B10, 17 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Fukami 2005a, 11 more items - - Germline - - - - - Julia Lopez
-?/-? 1 1 c.-1890C>T r.(=) p.(=) - - likely benign g.41358221G>A g.40852316G>A -1890C>T - CYP2A6_000179 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 16 1 c.-1680A>G r.(=) p.(=) CYP2A6*18C, CYP2A6*1B10, CYP2A6*1B11, CYP2A6*1B5, CYP2A6*1B6, CYP2A6*1B7, CYP2A6*1B8, CYP2A6*9B - likely benign g.41358011T>C g.40852106T>C -1680A>G - CYP2A6_000178 reference haplotype CYP2A6*18C, reference haplotype CYP2A6*1B10, reference haplotype CYP2A6*1B11, 5 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 1 1 c.-1644C>T r.(=) p.(=) - - likely benign g.41357975G>A g.40852070G>A -1643C>T - CYP2A6_000177 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 14 1 c.-1579T>C r.(=) p.(=) CYP2A6*18C, CYP2A6*1B10, CYP2A6*1B11, CYP2A6*1B5, CYP2A6*1B6, CYP2A6*1B7, CYP2A6*1B8 - likely benign g.41357910A>G g.40852005A>G -1579T>C - CYP2A6_000176 reference haplotype CYP2A6*18C, reference haplotype CYP2A6*1B10, reference haplotype CYP2A6*1B11, 4 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 1 1 c.-1569T>C r.(=) p.(=) - - likely benign g.41357900A>G g.40851995A>G -1569T>C - CYP2A6_000175 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 10 1 c.-1464A>T r.(=) p.(=) CYP2A6*18C, CYP2A6*1B10, CYP2A6*1B11, CYP2A6*1B7, CYP2A6*1B8 - likely benign g.41357795T>A g.40851890T>A -1464A>T - CYP2A6_000174 reference haplotype CYP2A6*18C, reference haplotype CYP2A6*1B10, reference haplotype CYP2A6*1B11, 2 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 30 1 c.-1301A>C r.(=) p.(=) CYP2A6*18C, CYP2A6*1B10, CYP2A6*1B11, CYP2A6*1B16, CYP2A6*1B5, CYP2A6*1B6, CYP2A6*1B7, CYP2A6*1B8, 7 more items - likely benign g.41357632T>G g.40851727T>G -1301A>C - CYP2A6_000173 reference haplotype CYP2A6*18C, reference haplotype CYP2A6*1B10, reference haplotype CYP2A6*1B11, 12 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 3 more items - - Germline - - - - - Julia Lopez
-?/-? 34 1 c.-1289G>A r.(=) p.(=) CYP2A6*18C, CYP2A6*1B10, CYP2A6*1B11, CYP2A6*1B16, CYP2A6*1B5, CYP2A6*1B6, CYP2A6*1B7, CYP2A6*1B8, 9 more items - likely benign g.41357620C>T g.40851715C>T -1289G>A - CYP2A6_000172 reference haplotype CYP2A6*18C, reference haplotype CYP2A6*1B10, reference haplotype CYP2A6*1B11, 14 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 3 more items - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.-1269T>C r.(=) p.(=) CYP2A6*28A - likely benign g.41357600A>G g.40851695A>G -1269T>C - CYP2A6_000171 reference haplotype CYP2A6*28A Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.-1200_-1199ins(316) r.(?) p.? CYP2A6*1K - likely benign g.41357530_41357531insN[316] - -1199_-1198ins316bpAlu - CYP2A6_000170 reference haplotype CYP2A6*1K Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 1 1 c.-1162G>A r.(=) p.(=) - - likely benign g.41357493C>T g.40851588C>T -1162G>A - CYP2A6_000169 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 1 1 c.-1126C>A r.(=) p.(=) - - likely benign g.41357457G>T g.40851552G>T -1126C>A - CYP2A6_000168 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 30 1 c.-1013A>G r.(=) p.(=) CYP2A6*18C, CYP2A6*1B10, CYP2A6*1B11, CYP2A6*1B2, CYP2A6*1B5, CYP2A6*1B6, CYP2A6*1B8, CYP2A6*1D, 7 more items - likely benign g.41357344T>C g.40851439T>C -1013A>G - CYP2A6_000167 reference haplotype CYP2A6*18C, reference haplotype CYP2A6*1B10, reference haplotype CYP2A6*1B11, 12 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 6 more items - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.-975T>C r.(=) p.(=) CYP2A6*31B - likely benign g.41357306A>G g.40851401A>G -975T>C - CYP2A6_000166 reference haplotype CYP2A6*31B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 15 1 c.-746A>G r.(=) p.(=) CYP2A6*1B13, CYP2A6*1B16, CYP2A6*1H, CYP2A6*1J, CYP2A6*25, CYP2A6*26, CYP2A6*27 - likely benign g.41357077T>C g.40851172T>C -745A>G - CYP2A6_000165 reference haplotype CYP2A6*1B13, reference haplotype CYP2A6*1B16, reference haplotype CYP2A6*1H, 4 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 4 more items - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.-687A>G r.(=) p.(=) CYP2A6*1K - likely benign g.41357018T>C g.40851113T>C -686A>G - CYP2A6_000164 reference haplotype CYP2A6*1K Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 4 1 c.-492_-470delinsAATCCATATGTGGAATCTG r.(=) p.(=) CYP2A6*31A, CYP2A6*31B - likely benign g.41356801_41356823delinsCAGATTCCACATATGGATT g.40850896_40850918delinsCAGATTCCACATATGGATT -492_-470delCCCCTTCCTGAGACCCTTAACCCinsAATCCATATGTGGAATCTG - CYP2A6_000163 reference haplotype CYP2A6*31A, reference haplotype CYP2A6*31B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.-396G>A r.(=) p.(=) CYP2A6*1C - likely benign g.41356727C>T g.40850822C>T -395G>A - CYP2A6_000162 reference haplotype CYP2A6*1C Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Kiyotani 2002 - - Germline - - - - - Julia Lopez
+/+, -?/-? 8 1 c.-48T>G r.(=) p.(=) CYP2A6*13, CYP2A6*15, CYP2A6*9A, CYP2A6*9B - likely benign, pathogenic g.41356379A>C g.40850474A>C -48T>G - CYP2A6_000161 reference haplotype CYP2A6*13, reference haplotype CYP2A6*15, reference haplotype CYP2A6*9A, 1 more item Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 2 more items - rs28399433 Germline - - - - - Julia Lopez
+/+, -?/-? 4 - c.(?_-21)_(343+1_344-1)conNM_030589.2(?_-542) _(340+1_341-1) r.(?) p.? CYP2A6*12A, CYP2A6*12B - likely benign, pathogenic g.(?_41349443)_(41354669_41355722)con(?_41388657)_(41386150_41386383) - exons1-2ofCYP2A7origin - CYP2A6_000009 reference haplotype CYP2A6*12A, reference haplotype CYP2A6*12B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 4 - c.(?_-21)_(*258_?)dup r.(?) p.? CYP2A6*1X2A, CYP2A6*1X2B - likely benign g.(?_41349443)_(41356352_?)dup - c.(?_-21)_(*258_?)dup - CYP2A6_000016 reference haplotype CYP2A6*1X2A, reference haplotype CYP2A6*1X2B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Fukami 2007, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.13G>A r.(?) p.(Gly5Arg) CYP2A6*13 - likely benign g.41356319C>T g.40850414C>T 13G>A - CYP2A6_000160 reference haplotype CYP2A6*13 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Kiyotani 2002 - rs28399434 Germline - - - - - Julia Lopez
-?/-? 4 1 c.16A>C r.(?) p.(Met6Leu) CYP2A6*31A, CYP2A6*31B - likely benign g.41356316T>G g.40850411T>G 16A>C - CYP2A6_000159 reference haplotype CYP2A6*31A, reference haplotype CYP2A6*31B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - rs72549432 Germline - - - - - Julia Lopez
-?/-? 10 1 c.22C>T r.(=) p.(=) CYP2A6*1B13, CYP2A6*1B16, CYP2A6*25, CYP2A6*26, CYP2A6*27 - likely benign g.41356310G>A g.40850405G>A 22C>T - CYP2A6_000158 reference haplotype CYP2A6*1B13, reference haplotype CYP2A6*1B16, reference haplotype CYP2A6*25, 2 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2007, 2 more items - - Germline - - - - - Julia Lopez
-?/-? 26 1 c.51= r.(?) p.(=) CYP2A6*14, CYP2A6*18B, CYP2A6*1B12, CYP2A6*1B14, CYP2A6*1B17, CYP2A6*2, CYP2A6*20, CYP2A6*21, 5 more items - likely benign g.41356281= g.40850376= 51G>A - CYP2A6_000156 reference haplotype CYP2A6*14, reference haplotype CYP2A6*18B, reference haplotype CYP2A6*1B12, 10 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Fukami 2005a, 8 more items - - Germline - - - - - Julia Lopez
-/. 1 - c.51A>G r.(?) p.(Val17=) - - benign g.41356281T>C g.40850376T>C CYP2A6(NM_000762.6):c.51A>G (p.V17=) - CYP2A6_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/-? 14 1 c.51G r.(?) p.(=) CYP2A6*1K, CYP2A6*24A, CYP2A6*25, CYP2A6*26, CYP2A6*27, CYP2A6*31A, CYP2A6*31B - likely benign g.41356281C - 51G - CYP2A6_000157 8 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.86G>A r.(?) p.(Ser29Asn) CYP2A6*14 - likely benign g.41356246C>T g.40850341C>T 86G>A - CYP2A6_000155 reference haplotype CYP2A6*14 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Kiyotani 2002 - rs28399435 Germline - - - - - Julia Lopez
-?/-? 3 1 c.144G>A r.(=) p.(=) CYP2A6*40 - likely benign g.41356188C>T g.40850283C>T 144G>A - CYP2A6_000154 reference haplotype CYP2A6*40 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.171C>A r.(=) p.(=) CYP2A6*39 - likely benign g.41356161G>T g.40850256G>T 171C>A - CYP2A6_000153 reference haplotype CYP2A6*39 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Piliguan 2014 - - Germline - - - - - Julia Lopez
-?/-? 3 1i c.180+29C>T r.(?) p.(=) CYP2A6*17 - likely benign g.41356123G>A g.40850218G>A 209C>T - CYP2A6_000152 reference haplotype CYP2A6*17 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Fukami 2004, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 1 1i c.180+57G>A r.(?) p.(=) - - likely benign g.41356095C>T g.40850190C>T 237G>A - CYP2A6_000151 - PubMed: Solus 2004 - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.181-109T>C r.(?) p.(=) CYP2A6*1B14 - likely benign g.41355994A>G g.40850089A>G 338T>C - CYP2A6_000150 reference haplotype CYP2A6*1B14 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2007 - - Germline - - - - - Julia Lopez
-?/-? 1 1 c.181-59C>G r.(?) p.(=) - - likely benign g.41355944G>C g.40850039G>C 388C>G - CYP2A6_000149 - PubMed: Solus 2004 - - Germline - - - - - Julia Lopez
-?/-? 1 1 c.181-34T>G r.(?) p.(=) - - likely benign g.41355919A>C g.40850014A>C 413T>G - CYP2A6_000148 - PubMed: Solus 2004 - - Germline - - - - - Julia Lopez
-?/-? 2 1 c.181-16C>T r.(?) p.(=) CYP2A6*1K - likely benign g.41355901G>A g.40849996G>A 431C>T - CYP2A6_000147 reference haplotype CYP2A6*1K Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
?/. 1 - c.181A>T r.(?) p.(Ile61Phe) - - VUS g.41355885T>A - CYP2A6(NM_000762.6):c.181A>T (p.(Ile61Phe)) - CYP2A6_000186 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.190C>T r.(?) p.(Arg64Cys) - - likely benign g.41355876G>A - CYP2A6(NM_000762.6):c.190C>T (p.(Arg64Cys)) - CYP2A6_000185 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/-? 3 2 c.201C>T r.(=) p.(=) CYP2A6*31B - likely benign g.41355865G>A g.40849960G>A 201C>T, 467C>T - CYP2A6_000146 reference haplotype CYP2A6*31B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
+/+ 2 2 c.202G>A r.(?) p.(Val68Met) CYP2A6*39 - pathogenic g.41355864C>T g.40849959C>T 468G>A - CYP2A6_000145 reference haplotype CYP2A6*39 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Piliguan 2014 - rs143690364 Germline - - - - - Julia Lopez
-?/. 1 - c.217T>C r.(?) p.(Leu73=) - - likely benign g.41355849A>G g.40849944A>G CYP2A6(NM_000762.5):c.217T>C (p.L73=) - CYP2A6_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/-? 2 2 c.241C>T r.(?) p.(=) CYP2A6*41 - likely benign g.41355825G>A g.40849920G>A 241C>T - CYP2A6_000144 reference haplotype CYP2A6*41 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Piliguian 2014 - - Germline - - - - - Julia Lopez
-?/-? 1 2 c.291G>A r.(?) p.(=) - - likely benign g.41355775C>T g.40849870C>T 557G>A - CYP2A6_000143 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 1 2 c.301C>T r.(?) p.(Arg101*) - - likely benign g.41355765G>A g.40849860G>A 567C>T - CYP2A6_000142 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 3 2 c.312A>G r.(?) p.(=) CYP2A6*24A - likely benign g.41355754T>C g.40849849T>C 312A>G, 578A>G - CYP2A6_000141 reference haplotype CYP2A6*24A Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
+/+ 2 2 c.328G>C r.(?) p.(Val110Leu) CYP2A6*24A - pathogenic g.41355738C>G g.40849833C>G 328G>C - CYP2A6_000140 reference haplotype CYP2A6*24A Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - rs72549435 Germline - - - - - Julia Lopez
-?/-? 1 3i c.343+9del r.(?) p.(=) - - likely benign g.41355718del g.40849813del 618delG - CYP2A6_000139 - PubMed: Solus 2004 - - Germline - - - - - Julia Lopez
-?/-? 2 3i c.343+47G>T r.(?) p.(=) CYP2A6*28A - likely benign g.41355676C>A g.40849771C>A 656G>T - CYP2A6_000138 reference haplotype CYP2A6*28A Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 4 3i c.343+111G>A r.(?) p.(=) CYP2A6*24A, CYP2A6*35A - likely benign g.41355612C>T g.40849707C>T 720G>A - CYP2A6_000137 reference haplotype CYP2A6*24A, reference haplotype CYP2A6*35A Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Koudsi 2009, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 2 3i c.343+159A>T r.(?) p.(=) CYP2A6*25 - likely benign g.41355564T>A g.40849659T>A 768A>T - CYP2A6_000136 reference haplotype CYP2A6*25 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 4 2i c.344-527C>G r.(?) p.(=) CYP2A6*24A, CYP2A6*35A - likely benign g.41355195G>C g.40849290G>C 1137C>G - CYP2A6_000135 reference haplotype CYP2A6*24A, reference haplotype CYP2A6*35A Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Koudsi 2009, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 2 2i c.344-499G>A r.(?) p.(=) CYP2A6*26 - likely benign g.41355167C>T g.40849262C>T 1165G>A - CYP2A6_000134 reference haplotype CYP2A6*26 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 2 2i c.344-400C>G r.(?) p.(=) CYP2A6*1B6 - likely benign g.41355068G>C g.40849163G>C 6285A>G - CYP2A6_000133 reference haplotype CYP2A6*1B6 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 4 2i c.344-325C>G r.(?) p.(=) CYP2A6*31A, CYP2A6*31B - likely benign g.41354993G>C g.40849088G>C 1339C>G - CYP2A6_000132 reference haplotype CYP2A6*31A, reference haplotype CYP2A6*31B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 39 2i c.344-44T>C r.(?) p.(=) CYP2A6*12B, CYP2A6*18C, CYP2A6*1B10, CYP2A6*1B11, CYP2A6*1B17, CYP2A6*1B5, CYP2A6*1B6, CYP2A6*1B7, 11 more items - likely benign g.41354712A>G g.40848807A>G 1620T>C - CYP2A6_000131 reference haplotype CYP2A6*12B, reference haplotype CYP2A6*18C, reference haplotype CYP2A6*1B10, 16 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 3 more items - - Germline - - - - - Julia Lopez
-?/-? 2 2i c.344-34T>C r.(?) p.(=) CYP2A6*1B16 - likely benign g.41354702A>G g.40848797A>G 1630T>C - CYP2A6_000130 reference haplotype CYP2A6*1B16 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2007 - - Germline - - - - - Julia Lopez
-?/-? 2 2i c.344-18C>T r.(?) p.(=) CYP2A6*1B17 - likely benign g.41354686G>A g.40848781G>A 1646C>T - CYP2A6_000129 reference haplotype CYP2A6*1B17 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
+/+, -?/-? 6 3 c.352T>C r.(?) p.(Phe118Leu) CYP2A6*25, CYP2A6*26, CYP2A6*27 - likely benign, pathogenic g.41354660A>G g.40848755A>G 352T>C - CYP2A6_000128 reference haplotype CYP2A6*25, reference haplotype CYP2A6*26, reference haplotype CYP2A6*27 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - rs2839940 Germline - - - - - Julia Lopez
-?/-? 2 3 c.383G>A r.(?) p.(Arg128Gln) CYP2A6*6 - likely benign g.41354629C>T g.40848724C>T 383G>A - CYP2A6_000126 reference haplotype CYP2A6*6 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Kitagawa 2001 - - Germline - - - - - Julia Lopez
+/+ 2 3 c.383G>T r.(?) p.(Arg128Leu) CYP2A6*26 - pathogenic g.41354629C>A g.40848724C>A 383G>T - CYP2A6_000127 reference haplotype CYP2A6*26 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - rs4986891 Germline - - - - - Julia Lopez
-?/-? 3 3 c.390C>T r.(=) p.(=) CYP2A6*26 - likely benign g.41354622G>A g.40848717G>A 1710C>T, 390C>T - CYP2A6_000125 reference haplotype CYP2A6*26 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
+/+ 2 3 c.391T>G r.(?) p.(Ser131Ala) CYP2A6*26 - pathogenic g.41354621A>C g.40848716A>C 391T>G - CYP2A6_000124 reference haplotype CYP2A6*26 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - rs59552350 Germline - - - - - Julia Lopez
+/+ 2 3 c.447C>G r.(?) p.(Ile149Met) CYP2A6*40 - pathogenic g.41354565G>C g.40848660G>C 447C>G - CYP2A6_000123 reference haplotype CYP2A6*40 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Piliguian 2014 - - Germline - - - - - Julia Lopez
-?/-? 12 3 c.459G>A r.(?) p.(=) CYP2A6*17, CYP2A6*1K, CYP2A6*39 - likely benign g.41354553C>T g.40848648C>T 1779G>A, 459G>A - CYP2A6_000122 reference haplotype CYP2A6*17, reference haplotype CYP2A6*1K, reference haplotype CYP2A6*39 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Fukami 2004, 2 more items - - Germline - - - - - Julia Lopez
-?/-?, -?/. 3 3 c.474C>G r.(?) p.(Asp158Glu) CYP2A6*22 - likely benign g.41354538G>C g.40848633G>C 474C>G, CYP2A6(NM_000762.6):c.474C>G (p.(Asp158Glu)) - CYP2A6_000121 reference haplotype CYP2A6*22, VKGL data sharing initiative Nederland Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005 - rs60605885 CLASSIFICATION record, Germline - - - - - Julia Lopez, VKGL-NL_Leiden
-?/-? 2 3 c.478C>A r.(?) p.(Leu160Ile) CYP2A6*22 - likely benign g.41354534G>T g.40848629G>T 478C>A - CYP2A6_000120 reference haplotype CYP2A6*22 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005 - rs60563539 Germline - - - - - Julia Lopez
+/+ 2 3 c.479T>A r.(?) p.(Leu160His) CYP2A6*2 - pathogenic g.41354533A>T g.40848628A>T 479T>A - CYP2A6_000119 reference haplotype CYP2A6*2 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, 1 more item - rs1801272 Germline - - - - - Julia Lopez
?/. 1 - c.491G>A r.(?) p.(Gly164Asp) - - VUS g.41354521C>T - CYP2A6(NM_000762.5):c.491G>A (p.G164D) - CYP2A6_000183 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/-? 3 3i c.493+23G>T r.(?) p.(=) CYP2A6*9B - likely benign g.41354496C>A g.40848591C>A 1836G>T - CYP2A6_000118 reference haplotype CYP2A6*9B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 1 3i c.493+61G>T r.(?) p.(=) - - likely benign g.41354458C>A g.40848553C>A 1874G>T - CYP2A6_000117 - PubMed: Kiyotani 2002 - - Germline - - - - - Julia Lopez
-?/-? 1 3i c.493+77G>C r.(?) p.(=) - - likely benign g.41354442C>G g.40848537C>G 1890G>C - CYP2A6_000116 - PubMed: Kiyotani 2002 - - Germline - - - - - Julia Lopez
-?/-? 1 2i c.494-22C>T r.(?) p.(=) - - likely benign g.41354306G>A g.40848401G>A 2026C>T - CYP2A6_000115 - PubMed: Kiyotani 2002 - - Germline - - - - - Julia Lopez
-?/-? 1 2i c.494-13G>T r.(?) p.(=) - - likely benign g.41354297C>A g.40848392C>A 2035G>T - CYP2A6_000114 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 1 2i c.494-9T>C r.(?) p.(=) - - likely benign g.41354293A>G g.40848388A>G 2039T>C - CYP2A6_000113 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 1 4 c.507T>G r.(?) p.(Asp169Glu) - - likely benign g.41354271A>C g.40848366A>C 2061T>G - CYP2A6_000112 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/. 1 - c.569G>T r.(?) p.(Arg190Leu) - - likely benign g.41354209C>A - CYP2A6(NM_000762.5):c.569G>T (p.R190L) - CYP2A6_000182 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/-? 2 4 c.580A>G r.(?) p.(Lys194Glu) CYP2A6*15 - likely benign g.41354198T>C g.40848293T>C 580A>G - CYP2A6_000111 reference haplotype CYP2A6*15 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Kiyotani 2002 - - Germline - - - - - Julia Lopez
+/+ 2 4 c.587_588del r.(?) p.(Lys196Argfs*25) CYP2A6*20 - pathogenic g.41354191_41354192del g.40848286_40848287del 587_588del - CYP2A6_000110 reference haplotype CYP2A6*20 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Fukami 2005b - - Germline - - - - - Julia Lopez
-?/-? 1 4 c.604T>C r.(?) p.(=) - - likely benign g.41354174A>G g.40848269A>G 2158T>C - CYP2A6_000109 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 2 4 c.607C>A r.(?) p.(Arg203Ser) CYP2A6*16 - likely benign g.41354171G>T g.40848266G>T 607C>A - CYP2A6_000107 reference haplotype CYP2A6*16 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Kiyotani 2002 - rs56256500 Germline - - - - - Julia Lopez
+/+ 2 4 c.607C>T r.(?) p.(Arg203Cys) CYP2A6*23 - pathogenic g.41354171G>A g.40848266G>A 607C>T - CYP2A6_000108 reference haplotype CYP2A6*23 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Ho 2008 - - Germline - - - - - Julia Lopez
-?/-? 2 4 c.608_609delinsA r.(?) p.(Arg203Glnfs*2) CYP2A6*27 - likely benign g.41354169_41354170delinsT g.40848264_40848265delinsT 608_609GC>A - CYP2A6_000106 reference haplotype CYP2A6*27 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - rs28399445 Germline - - - - - Julia Lopez
-?/-? 1 4i c.654+66G>C r.(?) p.(=) - - likely benign g.41354058C>G g.40848153C>G 2274G>C - CYP2A6_000105 - PubMed: Haberl 2005 - - Germline - - - - - Julia Lopez
-?/-? 10 4i c.654+88C>T r.(?) p.(=) CYP2A6*1B17, CYP2A6*20, CYP2A6*25, CYP2A6*26, CYP2A6*27 - likely benign g.41354036G>A g.40848131G>A 2296C>T - CYP2A6_000104 reference haplotype CYP2A6*1B17, reference haplotype CYP2A6*20, reference haplotype CYP2A6*25, 2 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Fukami 2005b, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 14 4i c.654+275G>A r.(?) p.(=) CYP2A6*1B17, CYP2A6*1K, CYP2A6*24A, CYP2A6*25, CYP2A6*26, CYP2A6*27, CYP2A6*35A - likely benign g.41353849C>T g.40847944C>T 2483G>A - CYP2A6_000103 reference haplotype CYP2A6*1B17, reference haplotype CYP2A6*1K, reference haplotype CYP2A6*24A, 4 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Koudsi 2009, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 2 4i c.654+397G>A r.(?) p.(=) CYP2A6*25 - likely benign g.41353727C>T g.40847822C>T 2605G>A - CYP2A6_000102 reference haplotype CYP2A6*25 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 4 4i c.654+513G>A r.(?) p.(=) CYP2A6*31A, CYP2A6*31B - likely benign g.41353611C>T g.40847706C>T 2721G>A - CYP2A6_000101 reference haplotype CYP2A6*31A, reference haplotype CYP2A6*31B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 2 3i c.655-455G>A r.(?) p.(=) CYP2A6*25 - likely benign g.41353411C>T g.40847506C>T 2921G>A - CYP2A6_000100 reference haplotype CYP2A6*25 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 14 3i c.655-382T>C r.(?) p.(=) CYP2A6*1B17, CYP2A6*1K, CYP2A6*25, CYP2A6*26, CYP2A6*27, CYP2A6*31A, CYP2A6*31B - likely benign g.41353338A>G g.40847433A>G 2994T>C - CYP2A6_000099 reference haplotype CYP2A6*1B17, reference haplotype CYP2A6*1K, reference haplotype CYP2A6*25, 4 more items Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 6 3i c.655-151A>G r.(?) p.(=) CYP2A6*24A, CYP2A6*31B, CYP2A6*35A - likely benign g.41353107T>C g.40847202T>C 3225A>G - CYP2A6_000098 reference haplotype CYP2A6*24A, reference haplotype CYP2A6*31B, reference haplotype CYP2A6*35A Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Koudsi 2009, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 2 3i c.655-121A>G r.(?) p.(=) CYP2A6*31A - likely benign g.41353077T>C g.40847172T>C 3255A>G - CYP2A6_000097 reference haplotype CYP2A6*31A Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
-?/-? 5 3i c.655-61C>T r.(?) p.(=) CYP2A6*31A, CYP2A6*31B - likely benign g.41353017G>A g.40847112G>A 3315C>T - CYP2A6_000096 reference haplotype CYP2A6*31A, reference haplotype CYP2A6*31B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 1 3i c.655-44G>A r.(?) p.(=) - - likely benign g.41353000C>T g.40847095C>T 3332G>A - CYP2A6_000095 - PubMed: Solus 2004 - - Germline - - - - - Julia Lopez
-?/-? 4 4 c.657C>T r.(=) p.(=) CYP2A6*1K - likely benign g.41352954G>A g.40847049G>A 3378C>T, 657C>T - CYP2A6_000094 reference haplotype CYP2A6*1K Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Mwenifumbo 2008 - - Germline - - - - - Julia Lopez
+/+, ?/. 3 4 c.670T>C r.(?) p.(Ser224Pro) CYP2A6*11 - pathogenic, VUS g.41352941A>G g.40847036A>G 670T>C - CYP2A6_000093 drug response; 24 heterozygous, no homozygous; Clinindb (India), reference haplotype CYP2A6*11 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Daigo 2002, 1 more item - rs111033610, rs28399447 Germline - 24/2794 individuals - - - Julia Lopez, Mohammed Faruq
-?/-? 3 4 c.675G>A r.(=) p.(=) CYP2A6*12B - likely benign g.41352936C>T g.40847031C>T 3396G>A - CYP2A6_000092 reference haplotype CYP2A6*12B Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
-?/-? 3 5 c.771C>T r.(=) p.(=) CYP2A6*40 - likely benign g.41352840G>A g.40846935G>A 3492C>T, 771C>T - CYP2A6_000091 reference haplotype CYP2A6*40 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - - Germline - - - - - Julia Lopez
-?/. 1 - c.786T>C r.(?) p.(Asn262=) - - likely benign g.41352825A>G g.40846920A>G CYP2A6(NM_000762.5):c.786T>C (p.N262=) - CYP2A6_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+, -?/-? 3 5 c.794G>A r.(?) p.(Arg265Gln) CYP2A6*41 - likely benign, pathogenic g.41352817C>T g.40846912C>T 3515G>A, 794G>A - CYP2A6_000090 reference haplotype CYP2A6*41 Reference haplotype - Human P450 (CYP) Allele Nomenclature Committee, PubMed: Haberl 2005, 1 more item - rs140471703 Germline - - - - - Julia Lopez
Legend   How to query   « First ‹ Prev     1 2     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.