All variants in the FGD1 gene

Information The variants shown are described using the NM_004463.2 transcript reference sequence.

132 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-/. - c.-4G>C r.(?) p.(=) - benign g.54521869C>G g.54495436C>G FGD1(NM_004463.3):c.-4G>C - FGD1_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
+/? _1_18_ c.1-?_2885+?del r.0? p.0? - pathogenic g.54472543_54521865del g.54446110_54495432del complete deletion - FGD1_000032 Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Bedoyan 2009 - - Germline - - - 0 - Emmelien Aten
-?/. - c.69G>A r.(?) p.(Pro23=) - likely benign g.54521797C>T - FGD1(NM_004463.2):c.69G>A (p.P23=) - FGD1_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.85G>C r.(?) p.(Ala29Pro) - VUS g.54521781C>G g.54495348C>G FGD1(NM_004463.2):c.85G>C (p.A29P) - FGD1_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 c.110C>T r.(?) p.(Ala37Val) - VUS g.54521756G>A g.54495323G>A - - FGD1_000001 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - Lucy Raymond
-/. - c.110C>T r.(?) p.(Ala37Val) - benign g.54521756G>A g.54495323G>A FGD1(NM_004463.3):c.110C>T (p.A37V) - FGD1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.110C>T r.(?) p.(Ala37Val) - benign g.54521756G>A g.54495323G>A FGD1(NM_004463.3):c.110C>T (p.A37V) - FGD1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
?/. - c.113C>G r.(?) p.(Ser38Trp) - VUS g.54521753G>C - FGD1(NM_004463.2):c.113C>G (p.(Ser38Trp)) - FGD1_000094 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.134G>A r.(?) p.(Arg45His) - likely benign g.54521732C>T g.54495299C>T FGD1(NM_004463.2):c.134G>A (p.R45H) - FGD1_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.201C>A r.(?) p.(Ser67Arg) - likely benign g.54521665G>T g.54495232G>T FGD1(NM_004463.2):c.201C>A (p.(Ser67Arg)) - FGD1_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.281A>G r.(?) p.(His94Arg) - likely benign g.54521585T>C - FGD1(NM_004463.2):c.281A>G (p.(His94Arg)) - FGD1_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.395G>A r.(?) p.(Arg132Gln) - likely benign g.54497833C>T g.54471400C>T FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q) - FGD1_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.395G>A r.(?) p.(Arg132Gln) - likely benign g.54497833C>T g.54471400C>T FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q) - FGD1_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.395G>A r.(?) p.(Arg132Gln) - benign g.54497833C>T g.54471400C>T FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q) - FGD1_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-?/. - c.395G>A r.(?) p.(Arg132Gln) - likely benign g.54497833C>T g.54471400C>T FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q) - FGD1_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.395G>A r.(?) p.(Arg132Gln) - likely benign g.54497833C>T g.54471400C>T FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q) - FGD1_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.400C>T r.(?) p.(Arg134Cys) - likely benign g.54497828G>A - FGD1(NM_004463.2):c.400C>T (p.(Arg134Cys)) - FGD1_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.482-5T>G r.spl? p.? - likely benign g.54497198A>C - FGD1(NM_004463.2):c.482-5T>G (p.?) - FGD1_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. - c.527dup r.(?) p.(Leu177Thrfs*40) - pathogenic (recessive) g.54497148dup g.54470715dup - - FGD1_000064 - PubMed: White 2018 - - Germline - - - 0 - Johan den Dunnen
+/? 3 c.529dup r.(?) p.(Leu177Profs*40) - pathogenic g.54497146dup g.54470713dup 528 insC, p176fsX16 - FGD1_000005 - PubMed: Fryns 1992 - - Germline - ? +PspGI, -TspRI 0 - Emmelien Aten
+/? 3 c.529dup r.(?) p.(Leu177Profs*40) - pathogenic g.54497146dup g.54470713dup 528 insC, p176fsX16 - FGD1_000005 - PubMed: Orrico 2004 - - Germline - ? +PspGI, -TspRI 0 - Emmelien Aten
+/? 3 c.529dup r.(?) p.(Leu177Profs*40) - pathogenic g.54497146dup g.54470713dup 528 insC, p176fsX16 - FGD1_000005 - PubMed: Orrico 2004 - - Germline - ? +PspGI, -TspRI 0 - Emmelien Aten
?/. - c.530T>C r.(?) p.(Leu177Pro) - VUS g.54497145A>G g.54470712A>G FGD1(NM_004463.2):c.530T>C (p.(Leu177Pro)) - FGD1_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.546T>A r.(?) p.(Pro182=) - likely benign g.54497129A>T - FGD1(NM_004463.3):c.546T>A (p.P182=) - FGD1_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.563T>A r.(?) p.(Leu188Gln) - VUS g.54497112A>T - FGD1(NM_004463.3):c.563T>A (p.L188Q) - FGD1_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.577C>T r.(?) p.(Arg193Ter) - pathogenic g.54497098G>A g.54470665G>A - - FGD1_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/? 3 c.614G>T r.(?) p.(Ser205Ile) - pathogenic g.54497061C>A g.54470628C>A 614 G>T, S205I - FGD1_000006 - PubMed: Orrico 2004 - - Germline - ? +FokI, -CviKI_1 0 - Emmelien Aten
-?/. - c.676G>A r.(?) p.(Ala226Thr) - likely benign g.54496874C>T g.54470441C>T FGD1(NM_004463.2):c.676G>A (p.A226T, p.(Ala226Thr)), FGD1(NM_004463.3):c.676G>A (p.A226T) - FGD1_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.676G>A r.(?) p.(Ala226Thr) - likely benign g.54496874C>T g.54470441C>T FGD1(NM_004463.2):c.676G>A (p.A226T, p.(Ala226Thr)), FGD1(NM_004463.3):c.676G>A (p.A226T) - FGD1_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.676G>A r.(?) p.(Ala226Thr) - likely benign g.54496874C>T g.54470441C>T FGD1(NM_004463.2):c.676G>A (p.A226T, p.(Ala226Thr)), FGD1(NM_004463.3):c.676G>A (p.A226T) - FGD1_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.695C>T r.(?) p.(Pro232Leu) - likely benign g.54496855G>A - FGD1(NM_004463.2):c.695C>T (p.(Pro232Leu)) - FGD1_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.712C>T r.(?) p.(Pro238Ser) - VUS g.54496838G>A g.54470405G>A FGD1(NM_004463.2):c.712C>T (p.(Pro238Ser)) - FGD1_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.772G>A r.(?) p.(Glu258Lys) - VUS g.54496778C>T g.54470345C>T FGD1(NM_004463.2):c.772G>A (p.E258K) - FGD1_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/? 4 c.806del r.(?) p.(Ala269Valfs*91) - pathogenic g.54496744del g.54470311del 806 delC, L268fsX359 - FGD1_000007 - PubMed: Orrico 2010 - - Germline - ? +Sau96I, -Cac8I 0 - Emmelien Aten
-?/. - c.820G>A r.(?) p.(Asp274Asn) - likely benign g.54496730C>T g.54470297C>T FGD1(NM_004463.2):c.820G>A (p.D274N) - FGD1_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.889A>T r.(?) p.(Thr297Ser) - VUS g.54496661T>A - FGD1(NM_004463.2):c.889A>T (p.T297S) - FGD1_000099 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.892dup r.(?) p.(Cys298Leufs*5) - pathogenic (recessive) g.54496658dup g.54470225dup - - FGD1_000096 - PubMed: White 2018 - - Germline - - - 0 - Johan den Dunnen
?/? 4 c.935C>T r.(?) p.(Pro312Leu) - VUS g.54496615G>A g.54470182G>A - - FGD1_000004 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/2018 cases - 0 - Lucy Raymond
-?/. - c.935C>T r.(?) p.(Pro312Leu) - likely benign g.54496615G>A g.54470182G>A FGD1(NM_004463.2):c.935C>T (p.P312L), FGD1(NM_004463.3):c.935C>T (p.P312L) - FGD1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.935C>T r.(?) p.(Pro312Leu) - likely benign g.54496615G>A g.54470182G>A FGD1(NM_004463.2):c.935C>T (p.P312L), FGD1(NM_004463.3):c.935C>T (p.P312L) - FGD1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.935C>T r.(?) p.(Pro312Leu) - likely benign g.54496615G>A - FGD1(NM_004463.2):c.935C>T (p.P312L), FGD1(NM_004463.3):c.935C>T (p.P312L) - FGD1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.939_964del r.(?) p.(Pro314CysfsTer14) - pathogenic g.54496587_54496612del - FGD1(NM_004463.2):c.939_964delGCCCCCTGCCCTGGCTAGTGTGCCTG (p.P314Cfs*14) - FGD1_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/? 4 c.944_975del r.(?) p.(Pro315Argfs*11) - pathogenic g.54496577_54496608del g.54470144_54470175del 944 975 del 32, P314fsX325 - FGD1_000008 this mutation most probably arose de novo as it was not present in his mother and sister. PubMed: Orrico 2004 - - De novo - ? -EaeI, -BslI 0 - Emmelien Aten
+/? 4 c.945_946insC r.(?) p.(Ala316Argfs*4) - pathogenic g.54496604_54496605insG g.54470171_54470172insG 945 insC, P315fsX319 - FGD1_000009 The absence of the mutation in the maternal grandmother and in three maternal aunts suggests that the mutation likely occurred de novo or from a parental mosaicism. PubMed: Orrico 2007 - - De novo - ? +MnlI 0 - Emmelien Aten
-?/. - c.976G>A r.(?) p.(Asp326Asn) - likely benign g.54496574C>T - FGD1(NM_004463.2):c.976G>A (p.D326N) - FGD1_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/? 4 c.982del r.(?) p.(His328Thrfs*32) - pathogenic g.54496572del g.54470139del 982delC, P327fsX359 - FGD1_000010 The 982delC mutation was not present in his phenotypically normal mother. As he is the only affected member in his family, the mutation possibly arose de novo or from a maternal germline mosaicism. PubMed: Orrico 2004 - - De novo - ? - 0 - Emmelien Aten
?/. - c.1026G>C r.(?) p.(Glu342Asp) - VUS g.54496524C>G g.54470091C>G - - FGD1_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1032C>G r.(?) p.(Asp344Glu) - likely benign g.54496518G>C - FGD1(NM_004463.2):c.1032C>G (p.(Asp344Glu)) - FGD1_000109 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.1136A>G r.(?) p.(Asn379Ser) - likely benign g.54495275T>C g.54468842T>C - - FGD1_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/? 5 c.1139A>C r.(?) p.(Glu380Ala) - pathogenic g.54495272T>G g.54468839T>G 1139 A>C, E380A - FGD1_000019 - PubMed: Orrico 2004 - - Germline - ? +HhaI, -Bsp1286I 0 - Emmelien Aten
-?/. - c.1164C>T r.(?) p.(Tyr388=) - likely benign g.54495247G>A - FGD1(NM_004463.2):c.1164C>T (p.Y388=) - FGD1_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.1204C>T r.(?) p.(Arg402Trp) - pathogenic g.54494353G>A g.54467920G>A FGD1(NM_004463.2):c.1204C>T (p.R402W) - FGD1_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/? 6 c.1205G>A r.(?) p.(Arg402Gln) - pathogenic g.54494352C>T g.54467919C>T 1205 G>A, R402Q - FGD1_000011 - PubMed: Orrico 2010 - - Germline - ? +AlwNI, -HpaII 0 - Emmelien Aten
+/? 6 c.1223G>A r.(?) p.(Arg408Gln) - pathogenic g.54494334C>T g.54467901C>T 1223 G>A, R408Q - FGD1_000020 - PubMed: Orrico 2005 - - Germline - ? +DdeI, -NlaIV 0 - Emmelien Aten
+/? 6 c.1318_1321del r.(?) p.(Leu440Argfs*31) - pathogenic g.54494238_54494241del g.54467805_54467808del 1316_1319 del AGCT, P438fsX470 - FGD1_000021 - PubMed: Orrico 2004 - - Germline - ? -MwoI, -AluI 0 - Emmelien Aten
+/? 6 c.1318_1321del r.(?) p.(Leu440Argfs*31) - pathogenic g.54494238_54494241del g.54467805_54467808del 1316_1319 del AGCT, P438fsX470 - FGD1_000021 - PubMed: Orrico 2004 - - Germline - ? -MwoI, -AluI 0 - Emmelien Aten
+/? 6 c.1328G>A r.(?) p.(Arg443His) - pathogenic g.54494229C>T g.54467796C>T 1328 G>A, R443H - FGD1_000022 - PubMed: Orrico 2004 - - Germline - ? -HinP1I -HhaI 0 - Emmelien Aten
+/. - c.1328G>A r.(?) p.(Arg443His) - pathogenic g.54494229C>T - - - FGD1_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/? 6 c.1328G>T r.(?) p.(Arg443Leu) - pathogenic g.54494229C>A g.54467796C>A 1328 G>T, R443L - FGD1_000025 - PubMed: Kaname 2006 - - Germline - ? -HinP1I -HhaI 0 - Emmelien Aten
-?/. - c.1340+9C>T r.(=) p.(=) - likely benign g.54494208G>A g.54467775G>A FGD1(NM_004463.3):c.1340+9C>T - FGD1_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
?/. - c.1354C>T r.(?) p.(Arg452Cys) - VUS g.54492272G>A - - - FGD1_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/? 7 c.1392_1393insG r.(?) p.(Lys465Glufs*5) - pathogenic g.54492233_54492234insC g.54465800_54465801insC insG after 2122 (L464fsX469) - FGD1_000027 - PubMed: Pasteris 1994, OMIM:var0001 - - Germline - ? +TaqI, -Hpy188III 0 - Emmelien Aten
+/? 7 c.1396A>G r.(?) p.(Met466Val) - pathogenic g.54492230T>C g.54465797T>C 1396 A>G, M466V - FGD1_000028 - PubMed: Bottani 2007 - - Germline - ? -Hpy188III 0 - Emmelien Aten
?/. - c.1412T>C r.(?) p.(Val471Ala) - VUS g.54492214A>G g.54465781A>G FGD1(NM_004463.2):c.1412T>C (p.(Val471Ala)) - FGD1_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.1464C>T r.(?) p.(Ser488=) - likely benign g.54492162G>A g.54465729G>A FGD1(NM_004463.2):c.1464C>T (p.S488=) - FGD1_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1487A>G r.(?) p.(His496Arg) - VUS g.54492139T>C g.54465706T>C FGD1(NM_004463.2):c.1487A>G (p.H496R) - FGD1_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.1519C>G r.(?) p.(Leu507Val) - likely pathogenic g.54492001G>C g.54465568G>C - - FGD1_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+?/. - c.1546C>T r.(?) p.(Pro516Ser) - likely pathogenic g.54491974G>A g.54465541G>A - - FGD1_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/? 8 c.1555C>A r.(?) p.(Arg519Ser) - VUS g.54491965G>T g.54465532G>T - - FGD1_000034 - - - - Germline - - - 0 - Emmelien Aten
+?/. - c.1555C>T r.(?) p.(Arg519Cys) - likely pathogenic g.54491965G>A - FGD1(NM_004463.2):c.1555C>T (p.R519C) - FGD1_000108 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/. - c.1556G>A r.(?) p.(Arg519His) - pathogenic g.54491964C>T g.54465531C>T - - FGD1_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/? 8 c.1565G>A r.(?) p.(Arg522His) - pathogenic g.54491955C>T g.54465522C>T G2296A, R522H - FGD1_000029 - PubMed: Schwartz 2000, OMIM:var0003 - - Germline - ? -MwoI, -FauI 0 - Emmelien Aten
+/? 8 c.1565G>A r.(?) p.(Arg522His) - pathogenic g.54491955C>T g.54465522C>T G2296A, R522H - FGD1_000029 - PubMed: Schwartz 2000, OMIM:var0003 - - Germline - ? -MwoI, -FauI 0 - Emmelien Aten
+/? 8 c.1590T>A r.(?) p.(Tyr530*) - pathogenic g.54491930A>T g.54465497A>T 1590 T>A, Y530X - FGD1_000012 - PubMed: Orrico 2010 - - Germline - ? +HpyCH4III 0 - Emmelien Aten
-?/. - c.1617G>A r.(?) p.(Pro539=) - likely benign g.54491903C>T - FGD1(NM_004463.2):c.1617G>A (p.P539=) - FGD1_000104 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/? 8 c.1620del r.(?) p.(Asp540Glufs*11) - pathogenic g.54491900del g.54465467del 1620 delC, P539fsX550 - FGD1_000013 - PubMed: Orrico 2010 - - Germline - ? - 0 - Emmelien Aten
?/. - c.1625A>G r.(?) p.(Lys542Arg) - VUS g.54491895T>C - FGD1(NM_004463.2):c.1625A>G (p.K542R) - FGD1_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 8i c.1637-72dup r.(=) p.(=) - likely benign g.54483083dup g.54456650dup - - FGD1_000037 - - - - Germline - - - 0 - Yu Sun
+/. - c.1637_1638del r.(?) p.(Lys546IlefsTer24) - pathogenic g.54483001_54483002del g.54456568_54456569del - - FGD1_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/? 9_13 c.1659+?_2044-?del r.(?) p.0? - pathogenic g.54476706_54482978del g.54450273_54456545del ex9-12del, gross deletion - FGD1_000030 Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Schwartz 2000 - - Germline - - BsaI- 0 - Emmelien Aten
+/? 9 c.1673C>G r.(?) p.(Ser558Trp) - pathogenic g.54482964G>C g.54456531G>C 1673 C>G, S558W - FGD1_000014 - PubMed: Orrico 2010 - - Germline - ? +TspRI, -TaqI 0 - Emmelien Aten
-?/. - c.1695+10C>T r.(=) p.(=) - likely benign g.54482932G>A g.54456499G>A FGD1(NM_004463.3):c.1695+10C>T - FGD1_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/? 10 c.1829G>A r.(?) p.(Arg610Gln) - pathogenic g.54482666C>T g.54456233C>T 1829G>A, R610Q - FGD1_000024 - PubMed: Orrico 2000, OMIM:var0002 - - Germline - ? - 0 - Emmelien Aten
+/. - c.1833C>A r.(?) p.(Tyr611Ter) - pathogenic g.54482662G>T g.54456229G>T - - FGD1_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/? 10i c.1842+1G>T r.spl? p.? - VUS g.54482652C>A g.54456219C>A - - FGD1_000033 - - - - Germline - - - 0 - Emmelien Aten
-?/. - c.1842+20T>C r.(=) p.(=) - likely benign g.54482633A>G - FGD1(NM_004463.3):c.1842+20T>C - FGD1_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/. - c.1912_1913insCC r.(?) p.(Arg638ProfsTer5) - likely pathogenic g.54482148_54482149insGG - FGD1(NM_004463.2):c.1912_1913insCC (p.(Arg638ProfsTer5)) - FGD1_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/? 11i c.1935+3A>C r.spl? p.? - pathogenic g.54482122T>G g.54455689T>G IVS11 c.1935+3A>C, splicing - FGD1_000015 - PubMed: Orrico 2010 - - Germline - ? - 0 - Emmelien Aten
+/? 12 c.1966C>T r.(?) p.(Arg656*) - pathogenic g.54481930G>A g.54455497G>A 1966 C>T, R656X - FGD1_000016 - PubMed: Orrico 2010 - - Germline - ? -MnlI, -TaqI 0 - Emmelien Aten
+/? 12 c.1966C>T r.(?) p.(Arg656*) - pathogenic g.54481930G>A g.54455497G>A 1966 C>T, R656X - FGD1_000016 - PubMed: Orrico 2010 - - Germline - ? -MnlI, -TaqI 0 - Emmelien Aten
+/? 12 c.1966C>T r.(?) p.(Arg656*) - pathogenic g.54481930G>A g.54455497G>A 1966 C>T, R656X - FGD1_000016 - PubMed: Orrico 2010 - - Germline - ? -MnlI, -TaqI 0 - Emmelien Aten
+/. - c.1966C>T r.(?) p.(Arg656Ter) - pathogenic g.54481930G>A g.54455497G>A - - FGD1_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/+ 12i c.2016-35del r.2016_2046del p.Thr673Profs*7 - pathogenic g.54476770del g.54450337del - - FGD1_000035 splicing near complete, no NMD observed PubMed: Aten 2013 - - Germline yes - - 0 - Johan den Dunnen
+/? 13 c.2026_2028del r.(?) p.(Glu676del) - pathogenic g.54476728_54476730del g.54450295_54450297del 2020_2022 delGAG, E674del(inframe) - FGD1_000017 - PubMed: Orrico 2010 - - Germline - ? - 0 - Emmelien Aten
./. - c.2026_2028del r.(?) p.(Glu676del) - pathogenic g.54476728_54476730del g.54450295_54450297del FGD1 E676del - FGD1_000065 - PubMed: Hu 2016 - - Germline yes - - 0 - Johan den Dunnen
+/. 13 c.2037C>A r.(?) p.(Asp679Glu) - pathogenic g.54476713G>T g.54450280G>T - - FGD1_000036 - PubMed: DDDS 2015, Journal: DDDS 2015 - - Germline - - - 0 - Johan den Dunnen
-?/. - c.2043C>T r.(?) p.(Val681=) - likely benign g.54476707G>A g.54450274G>A FGD1(NM_004463.2):c.2043C>T (p.V681=), FGD1(NM_004463.3):c.2043C>T (p.V681=) - FGD1_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.2043C>T r.(?) p.(Val681=) - likely benign g.54476707G>A - FGD1(NM_004463.2):c.2043C>T (p.V681=), FGD1(NM_004463.3):c.2043C>T (p.V681=) - FGD1_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.2046+114C>G r.(=) p.(=) - benign g.54476590G>C g.54450157G>C FGD1(NM_004463.3):c.2046+114C>G - FGD1_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.2047-5C>A r.spl? p.? - likely benign g.54476198G>T g.54449765G>T FGD1(NM_004463.3):c.2047-5C>A - FGD1_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
Legend   How to query   « First ‹ Prev     1 2     Next › Last »