Unique variants in gene FGD1

Information The variants shown are described using the NM_004463.2 transcript reference sequence.

73 entries on 1 page. Showing entries 1 - 73.
Legend  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-/. 1 - c.-4G>C benign r.(?) p.(=) g.54521869C>G - FGD1(NM_004463.2):c.-4G>C - FGD1_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 _1_18_ c.1-?_2885+?del - r.0? p.0? g.54472543_54521865del g.54446110_54495432del complete deletion - FGD1_000032 - PubMed: Bedoyan 2009 - - Germline - - - - - Emmelien Aten
-/., ?/? 3 1 c.110C>T benign r.(?) p.(Ala37Val) g.54521756G>A g.54495323G>A FGD1(NM_004463.2):c.110C>T (p.A37V) - FGD1_000001 VKGL data sharing initiative Nederland, found once, nonrecurrent change PubMed: Tarpey 2009 - - CLASSIFICATION record, Germline - 1/208 cases - - - VKGL-NL_Utrecht, Lucy Raymond, VKGL-NL_Nijmegen
-?/., -/., ?/. 5 - c.395G>A likely benign, benign, VUS r.(?) p.(Arg132Gln) g.54497833C>T - FGD1(NM_004463.2):c.395G>A (p.R132Q) - FGD1_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_Groningen, VKGL-NL_Rotterdam, VKGL-NL_Leiden
-?/. 1 - c.515G>C likely benign r.(?) p.(Arg172Pro) g.54497160C>G - FGD1(NM_004463.2):c.515G>C (p.(Arg172Pro)) - FGD1_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 3 3 c.529dupC - r.(?) p.(Leu177Profs*40) g.54497146dup g.54470713dupG 528 insC, p176fsX16 - FGD1_000005 - PubMed: Fryns 1992, PubMed: Orrico 2004 - - Germline - ? +PspGI, -TspRI - - Emmelien Aten
?/. 1 - c.530T>C VUS r.(?) p.(Leu177Pro) g.54497145A>G - FGD1(NM_004463.2):c.530T>C (p.(Leu177Pro)) - FGD1_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.577C>T pathogenic r.(?) p.(Arg193*) g.54497098G>A - FGD1(NM_004463.2):c.577C>T (p.Arg193*) - FGD1_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 3 c.614G>T - r.(?) p.(Ser205Ile) g.54497061C>A g.54470628C>A 614 G>T, S205I - FGD1_000006 - PubMed: Orrico 2004 - - Germline - ? +FokI, -CviKI_1 - - Emmelien Aten
-?/. 3 - c.676G>A likely benign r.(?) p.(Ala226Thr) g.54496874C>T - FGD1(NM_004463.2):c.676G>A (p.A226T) - FGD1_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Rotterdam, VKGL-NL_Leiden
?/. 1 - c.712C>T VUS r.(?) p.(Pro238Ser) g.54496838G>A - FGD1(NM_004463.2):c.712C>T (p.(Pro238Ser)) - FGD1_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 4 c.806delC - r.(?) p.(Ala269Valfs*91) g.54496744delG g.54470311delG 806 delC, L268fsX359 - FGD1_000007 - PubMed: Orrico 2010 - - Germline - ? +Sau96I, -Cac8I - - Emmelien Aten
-?/., ?/? 3 4 c.935C>T likely benign r.(?) p.(Pro312Leu) g.54496615G>A g.54470182G>A FGD1(NM_004463.2):c.935C>T (p.P312L) - FGD1_000004 VKGL data sharing initiative Nederland, found once, nonrecurrent change PubMed: Tarpey 2009 - - CLASSIFICATION record, Germline - 1/2018 cases - - - VKGL-NL_Utrecht, Lucy Raymond, VKGL-NL_Groningen
+/. 1 - c.939_964del pathogenic r.(?) p.(Pro314Cysfs*14) g.54496587_54496612del - FGD1(NM_004463.2):c.939_964delGCCCCCTGCCCTGGCTAGTGTGCCTG (p.G313fs) - FGD1_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 4 c.944_975del - r.(?) p.(Pro315Argfs*11) g.54496575_54496606del g.54470142_54470173del 944 975 del 32, P314fsX325 - FGD1_000008 this mutation most probably arose de novo as it was not present in his mother and sister. PubMed: Orrico 2004 - - De novo - ? -EaeI, -BslI - - Emmelien Aten
+/? 1 4 c.945_946insC - r.(?) p.(Ala316Argfs*4) g.54496604_54496605insG g.54470171_54470172insG 945 insC, P315fsX319 - FGD1_000009 1 more item PubMed: Orrico 2007 - - De novo - ? +MnlI - - Emmelien Aten
+/? 1 4 c.982delC - r.(?) p.(His328Thrfs*32) g.54496568delG g.54470135delG 982delC, P327fsX359 - FGD1_000010 1 more item PubMed: Orrico 2004 - - De novo - ? - - - Emmelien Aten
?/. 1 - c.1026G>C VUS r.(?) p.(Glu342Asp) g.54496524C>G - FGD1(NM_004463,2):c.1026G>C (p.(Glu342Asp)) - FGD1_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1136A>G likely benign r.(?) p.(Asn379Ser) g.54495275T>C - FGD1(NM_004463.2):c.1136A>G (p.Asn379Ser) - FGD1_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 5 c.1139A>C - r.(?) p.(Glu380Ala) g.54495272T>G g.54468839T>G 1139 A>C, E380A - FGD1_000019 - PubMed: Orrico 2004 - - Germline - ? +HhaI, -Bsp1286I - - Emmelien Aten
-?/. 1 - c.1192-4A>G likely benign r.spl? p.? g.54494369T>C - FGD1(NM_004463.2):c.1192-4A>G (p.?) - FGD1_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.1204C>T pathogenic r.(?) p.(Arg402Trp) g.54494353G>A - FGD1(NM_004463.2):c.1204C>T (p.R402W) - FGD1_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 6 c.1205G>A - r.(?) p.(Arg402Gln) g.54494352C>T g.54467919C>T 1205 G>A, R402Q - FGD1_000011 - PubMed: Orrico 2010 - - Germline - ? +AlwNI, -HpaII - - Emmelien Aten
+/? 1 6 c.1223G>A - r.(?) p.(Arg408Gln) g.54494334C>T g.54467901C>T 1223 G>A, R408Q - FGD1_000020 - PubMed: Orrico 2005 - - Germline - ? +DdeI, -NlaIV - - Emmelien Aten
+/? 2 6 c.1316_1319del - r.(?) p.(Leu440Argfs*31) g.54494238_54494241del g.54467805_54467808del 1316_1319 del AGCT, P438fsX470 - FGD1_000021 - PubMed: Orrico 2004 - - Germline - ? -MwoI, -AluI - - Emmelien Aten
+/? 1 6 c.1328G>A - r.(?) p.(Arg443His) g.54494229C>T g.54467796C>T 1328 G>A, R443H - FGD1_000022 - PubMed: Orrico 2004 - - Germline - ? -HinP1I -HhaI - - Emmelien Aten
+/? 1 6 c.1328G>T - r.(?) p.(Arg443Leu) g.54494229C>A g.54467796C>A 1328 G>T, R443L - FGD1_000025 - PubMed: Kaname 2006 - - Germline - ? -HinP1I -HhaI - - Emmelien Aten
-?/. 1 - c.1340+9C>T likely benign r.(=) p.(=) g.54494208G>A - FGD1(NM_004463.2):c.1340+9C>T - FGD1_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 7 c.1392_1393insG - r.(?) p.(Lys465Glufs*5) g.54492233_54492234insC g.54465800_54465801insC insG after 2122 (L464fsX469) - FGD1_000027 - PubMed: Pasteris 1994, OMIM:var0001 - - Germline - ? +TaqI, -Hpy188III - - Emmelien Aten
+/? 1 7 c.1396A>G - r.(?) p.(Met466Val) g.54492230T>C g.54465797T>C 1396 A>G, M466V - FGD1_000028 - PubMed: Bottani 2007 - - Germline - ? -Hpy188III - - Emmelien Aten
?/. 1 - c.1412T>C VUS r.(?) p.(Val471Ala) g.54492214A>G - FGD1(NM_004463.2):c.1412T>C (p.(Val471Ala)) - FGD1_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1464C>T likely benign r.(?) p.(=) g.54492162G>A - FGD1(NM_004463.2):c.1464C>T (p.S488=) - FGD1_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1487A>G VUS r.(?) p.(His496Arg) g.54492139T>C - FGD1(NM_004463.2):c.1487A>G (p.H496R) - FGD1_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.1519C>G likely pathogenic r.(?) p.(Leu507Val) g.54492001G>C - FGD1(NM_004463.2):c.1519C>G (p.Leu507Val) - FGD1_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.1546C>T likely pathogenic r.(?) p.(Pro516Ser) g.54491974G>A - FGD1(NM_004463.2):c.1546C>T (p.Pro516Ser) - FGD1_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/? 1 8 c.1555C>A - r.(?) p.(Arg519Ser) g.54491965G>T g.54465532G>T - - FGD1_000034 - - - - Germline - - - - - Emmelien Aten
+?/. 1 - c.1556G>A likely pathogenic r.(?) p.(Arg519His) g.54491964C>T - FGD1(NM_004463.2):c.1556G>A (p.Arg519His) - FGD1_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 2 8 c.1565G>A - r.(?) p.(Arg522His) g.54491955C>T g.54465522C>T G2296A, R522H - FGD1_000029 - PubMed: Schwartz 2000, OMIM:var0003 - - Germline - ? -MwoI, -FauI - - Emmelien Aten
+/? 1 8 c.1590T>A - r.(?) p.(Tyr530*) g.54491930A>T g.54465497A>T 1590 T>A, Y530X - FGD1_000012 - PubMed: Orrico 2010 - - Germline - ? +HpyCH4III - - Emmelien Aten
+/? 1 8 c.1620delC - r.(?) p.(Asp540Glufs*11) g.54491900delG g.54465467delG 1620 delC, P539fsX550 - FGD1_000013 - PubMed: Orrico 2010 - - Germline - ? - - - Emmelien Aten
-?/. 1 8i c.1637-83dup - r.(?) p.(=) g.54483083dup g.54456650dup - - FGD1_000037 - - - - Germline - - - - - Yu Sun
+/. 1 - c.1637_1638del pathogenic r.(?) p.(Lys546Ilefs*24) g.54483001_54483002del - FGD1(NM_004463.2):c.1637_1638del (p.(Lys546fs)) - FGD1_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 9_13 c.1659+?_2044-?del - r.(?) p.0? g.54476706_54482978del g.54450273_54456545del ex9-12del, gross deletion - FGD1_000030 - PubMed: Schwartz 2000 - - Germline - - BsaI- - - Emmelien Aten
+/? 1 9 c.1673C>G - r.(?) p.(Ser558Trp) g.54482964G>C g.54456531G>C 1673 C>G, S558W - FGD1_000014 - PubMed: Orrico 2010 - - Germline - ? +TspRI, -TaqI - - Emmelien Aten
+/? 1 10 c.1829G>A - r.(?) p.(Arg610Gln) g.54482666C>T g.54456233C>T 1829G>A, R610Q - FGD1_000024 - PubMed: Orrico 2000, OMIM:var0002 - - Germline - ? - - - Emmelien Aten
?/? 1 10i c.1842+1G>T - r.spl? p.? g.54482652C>A g.54456219C>A - - FGD1_000033 - - - - Germline - - - - - Emmelien Aten
+/? 1 11i c.1935+3A>C - r.spl? p.? g.54482122T>G g.54455689T>G IVS11 c.1935+3A>C, splicing - FGD1_000015 - PubMed: Orrico 2010 - - Germline - ? - - - Emmelien Aten
+/?, +/. 4 12 c.1966C>T pathogenic r.(?) p.(Arg656*) g.54481930G>A g.54455497G>A 1966 C>T, R656X, FGD1(NM_004463.2):c.1966C>T (p.Arg656*) - FGD1_000016 VKGL data sharing initiative Nederland PubMed: Orrico 2010 - - Germline, CLASSIFICATION record - ? -MnlI, -TaqI - - Emmelien Aten, VKGL-NL
+/+ 1 12i c.2016-35del - r.2016_2046del p.Thr673Profs*7 g.54476769del g.54450336del - - FGD1_000035 splicing near complete, no NMD observed PubMed: Aten 2013 - - Germline yes - - - - Johan den Dunnen
./. 1 - c.2020_2022del - r.(?) p.(Glu676del) g.54476728_54476730del - FGD1 E676del - FGD1_000065 - PubMed: Hu 2016 - - Germline yes - - - - Johan den Dunnen
+/? 1 13 c.2026_2028del - r.(?) p.(Glu676del) g.54476722_54476724del g.54450289_54450291del 2020_2022 delGAG, E674del(inframe) - FGD1_000017 - PubMed: Orrico 2010 - - Germline - ? - - - Emmelien Aten
+/. 1 13 c.2037C>A - r.(?) p.(Asp679Glu) g.54476713G>T g.54450280G>T - - FGD1_000036 - PubMed: DDDS 2015, Journal: DDDS 2015 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.2043C>T likely benign r.(?) p.(=) g.54476707G>A - FGD1(NM_004463.2):c.2043C>T (p.V681=) - FGD1_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.2046+114C>G benign r.(=) p.(=) g.54476590G>C - FGD1(NM_004463.2):c.2046+114C>G - FGD1_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 2 - c.2047-5C>A likely benign r.spl? p.? g.54476198G>T - FGD1(NM_004463.2):c.2047-5C>A - FGD1_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC, VKGL-NL_Utrecht
+/. 1 - c.2048C>A pathogenic r.(?) p.(Ala683Asp) g.54476192G>T - FGD1(NM_004463.2):c.2048C>A (p.Ala683Asp) - FGD1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/? 1 14 c.2091T>C - r.(?) p.(=) g.54476149A>G g.54449716A>G p.T697T - FGD1_000002 recurrent, found 3 times PubMed: Tarpey 2009 - - Germline - 3/208 cases - - - Lucy Raymond
+/. 1 - c.2116_2117del pathogenic r.(?) p.(Arg706Glyfs*3) g.54476123_54476124del - FGD1(NM_004463.2):c.2116_2117delAG (p.R706Gfs*3) - FGD1_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/? 1 14 c.2136A>G - r.(?) p.(=) g.54476104T>C g.54449671T>C p.P712P - FGD1_000003 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 3/208 cases - - - Lucy Raymond
-?/. 1 - c.2149-7C>G likely benign r.(=) p.(=) g.54475708G>C - FGD1(NM_004463.2):c.2149-7C>G (p.(=)) - FGD1_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 3 - c.2168G>A VUS r.(?) p.(Arg723Gln) g.54475682C>T - FGD1(NM_004463.2):c.2168G>A (p.R723Q) - FGD1_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_Leiden, VKGL-NL_Groningen
+/? 1 15 c.2192delA - r.(?) p.(Lys731Argfs*132) g.54475658delT g.54449225delT 2189 delA, E730fsX862 - FGD1_000031 - PubMed: Shalev 2006 - - Germline - ? -BslI - - Emmelien Aten
+/? 1 15 c.2221G>T - r.(?) p.(Glu741*) g.54475629C>A g.54449196C>A 2221 G>T, E741X - FGD1_000026 - PubMed: Kaname 2006 - - Germline - ? +BsrI, -NlaIV - - Emmelien Aten
+/? 1 15 c.2242A>G - r.(?) p.(Lys748Glu) g.54475608T>C g.54449175T>C 2242 A>G, K748E - FGD1_000018 - PubMed: Orrico 2010 - - Germline - ? - - - Emmelien Aten
?/. 1 - c.2245C>T VUS r.(?) p.(Arg749Cys) g.54475605G>A - FGD1(NM_004463.2):c.2245C>T (p.(Arg749Cys)) - FGD1_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.2268C>T likely benign r.(?) p.(=) g.54475582G>A - FGD1(NM_004463.2):c.2268C>T (p.C756=) - FGD1_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.2309G>A VUS r.(?) p.(Arg770His) g.54475366C>T - FGD1(NM_004463.2):c.2309G>A (p.R770H) - FGD1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.2467G>A likely benign r.(?) p.(Val823Ile) g.54473857C>T - FGD1(NM_004463.2):c.2467G>A (p.V823I) - FGD1_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/? 1 17 c.2530delG - r.(?) p.(Val844Trpfs*19) g.54473794delC g.54447361delC 2530 delG, F843fsX862 - FGD1_000023 - PubMed: Orrico 2004 - - Germline - ? - - - Emmelien Aten
?/., -/. 2 - c.2729G>A VUS, benign r.(?) p.(Arg910Gln) g.54472699C>T - FGD1(NM_004463.2):c.2729G>A (p.(Arg910Gln)) - FGD1_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - c.2822C>T VUS r.(?) p.(Pro941Leu) g.54472606G>A - FGD1(NM_004463.2):c.2822C>T (p.P941L) - FGD1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 18 c.*623del - r.(=) p.(=) g.54471920del - - - FGD1_000038 - - - - Germline - - - - - Yu Sun
-?/. 1 - c.*2648A>G likely benign r.(=) p.(=) g.54469894T>C - TSR2(NM_058163.1):c.234T>C (p.(=)) - FGD1_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
Legend