All variants in the GIGYF2 gene

Information The variants shown are described using the NM_001103146.1 transcript reference sequence.

63 entries on 1 page. Showing entries 1 - 63.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-/. - c.-4A>C r.(?) p.(=) - benign g.233599904A>C g.232735194A>C GIGYF2(NM_001103147.1):c.-4A>C - GIGYF2_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.73A>G r.(?) p.(Thr25Ala) - likely benign g.233612356A>G g.232747646A>G GIGYF2(NM_015575.3):c.73A>G (p.T25A) - GIGYF2_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.102G>A r.(?) p.(Pro34=) - likely benign g.233612385G>A g.232747675G>A GIGYF2(NM_001103147.1):c.102G>A (p.P34=) - GIGYF2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.167A>G r.(?) p.(Asn56Ser) - likely benign g.233612450A>G g.232747740A>G GIGYF2(NM_015575.3):c.167A>G (p.N56S) - GIGYF2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.339G>C r.(?) p.(Val113=) - likely benign g.233621004G>C g.232756294G>C GIGYF2(NM_015575.3):c.339G>C (p.V113=) - GIGYF2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.349C>T r.(?) p.(Pro117Ser) - VUS g.233621014C>T g.232756304C>T GIGYF2(NM_015575.3):c.349C>T (p.P117S) - GIGYF2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.532+6741A>G r.(=) p.(=) - benign g.233632887A>G g.232768177A>G KCNJ13(NM_002242.4):c.*14T>C - GIGYF2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.532+7011T>G r.(=) p.(=) - VUS g.233633157T>G g.232768447T>G KCNJ13(NM_002242.4):c.827A>C (p.E276A) - KCNJ13_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.532+7149C>T r.(=) p.(=) - VUS g.233633295C>T g.232768585C>T KCNJ13(NM_002242.4):c.689G>A (p.S230N) - GIGYF2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.532+7149C>T r.(=) p.(=) - likely benign g.233633295C>T g.232768585C>T KCNJ13(NM_002242.4):c.689G>A (p.S230N) - GIGYF2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.532+7354G>A r.(=) p.(=) - likely pathogenic g.233633500G>A g.232768790G>A KCNJ13(NM_002242.4):c.484C>T (p.R162W) - KCNJ13_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.789T>A r.(?) p.(Asp263Glu) - VUS g.233655484T>A - GIGYF2(NM_001103146.1):c.789T>A (p.D263E) - GIGYF2_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.818C>T r.(?) p.(Ser273Phe) - likely benign g.233655513C>T g.232790803C>T GIGYF2(NM_001103147.2):c.884C>T (p.S295F) - GIGYF2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-?/. - c.1047T>A r.(?) p.(Asp349Glu) - likely benign g.233655834T>A g.232791124T>A GIGYF2(NM_015575.3):c.1047T>A (p.D349E) - GIGYF2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1238G>A r.(?) p.(Arg413Gln) - likely benign g.233656112G>A g.232791402G>A GIGYF2(NM_001103147.1):c.1301G>A (p.R434Q) - GIGYF2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1262A>G r.(?) p.(Lys421Arg) - likely benign g.233656136A>G g.232791426A>G GIGYF2(NM_015575.3):c.1262A>G (p.K421R) - GIGYF2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1370A>C r.(?) p.(Asn457Thr) - likely benign g.233659545A>C g.232794835A>C GIGYF2(NM_015575.3):c.1370A>C (p.N457T) - GIGYF2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1378C>A r.(?) p.(Pro460Thr) - likely benign g.233659553C>A g.232794843C>A GIGYF2(NM_015575.3):c.1378C>A (p.P460T) - GIGYF2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-/. - c.1554G>A r.(?) p.(Glu518=) - benign g.233660846G>A g.232796136G>A GIGYF2(NM_001103147.1):c.1617G>A (p.E539=), GIGYF2(NM_001103147.2):c.1617G>A (p.E539=) - GIGYF2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1554G>A r.(?) p.(Glu518=) - likely benign g.233660846G>A g.232796136G>A GIGYF2(NM_001103147.1):c.1617G>A (p.E539=), GIGYF2(NM_001103147.2):c.1617G>A (p.E539=) - GIGYF2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - c.1574C>T r.(?) p.(Ser525Leu) - VUS g.233660866C>T g.232796156C>T GIGYF2(NM_015575.3):c.1574C>T (p.S525L) - GIGYF2_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1716G>T r.(?) p.(Ala572=) - likely benign g.233671277G>T g.232806567G>T GIGYF2(NM_001103147.1):c.1779G>T (p.A593=) - GIGYF2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1905A>G r.(?) p.(Gln635=) - likely benign g.233675960A>G g.232811250A>G GIGYF2(NM_015575.3):c.1905A>G (p.Q635=) - GIGYF2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2006+7G>A r.(=) p.(=) - likely benign g.233676068G>A g.232811358G>A GIGYF2(NM_015575.3):c.2006+7G>A - GIGYF2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2742_2744dup r.(?) p.(Gln917dup) - VUS g.233697779_233697781dup g.232833069_232833071dup GIGYF2(NM_001103147.1):c.2805_2807dupGCA (p.Q938dup) - GIGYF2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2784G>C r.(?) p.(Thr928=) - likely benign g.233704576G>C g.232839866G>C GIGYF2(NM_015575.3):c.2784G>C (p.T928=) - GIGYF2_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2835G>T r.(?) p.(Ser945=) - likely benign g.233704627G>T g.232839917G>T GIGYF2(NM_001103147.1):c.2898G>T (p.S966=), GIGYF2(NM_015575.3):c.2835G>T (p.S945=) - GIGYF2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.2835G>T r.(?) p.(Ser945=) - benign g.233704627G>T g.232839917G>T GIGYF2(NM_001103147.1):c.2898G>T (p.S966=), GIGYF2(NM_015575.3):c.2835G>T (p.S945=) - GIGYF2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.2882G>A r.(?) p.(Arg961Gln) - likely benign g.233704674G>A g.232839964G>A GIGYF2(NM_015575.3):c.2882G>A (p.R961Q) - GIGYF2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2927A>G r.(?) p.(Gln976Arg) - likely benign g.233708793A>G g.232844083A>G GIGYF2(NM_015575.3):c.2927A>G (p.Q976R) - GIGYF2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.2940A>G r.(?) p.(Gln980=) - benign g.233708806A>G g.232844096A>G GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.3):c.2940A>G (p.Q980=) - GIGYF2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.2940A>G r.(?) p.(Gln980=) - benign g.233708806A>G g.232844096A>G GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.3):c.2940A>G (p.Q980=) - GIGYF2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-/. - c.2940A>G r.(?) p.(Gln980=) - benign g.233708806A>G g.232844096A>G GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.3):c.2940A>G (p.Q980=) - GIGYF2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.3099+6del r.(=) p.(=) - VUS g.233708971del g.232844261del GIGYF2(NM_015575.3):c.3099+6delT - GIGYF2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.3104C>G r.(?) p.(Ser1035Cys) - VUS g.233709083C>G g.232844373C>G GIGYF2(NM_015575.3):c.3104C>G (p.S1035C) - GIGYF2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.3461-9G>A r.(=) p.(=) - benign g.233712049G>A g.232847339G>A GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_015575.3):c.3461-9G>A - GIGYF2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.3461-9G>A r.(=) p.(=) - benign g.233712049G>A g.232847339G>A GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_015575.3):c.3461-9G>A - GIGYF2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-/. - c.3461-9G>A r.(=) p.(=) - benign g.233712049G>A g.232847339G>A GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_015575.3):c.3461-9G>A - GIGYF2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.3512A>G r.(?) p.(His1171Arg) - VUS g.233712109A>G g.232847399A>G GIGYF2(NM_015575.3):c.3512A>G (p.H1171R) - GIGYF2_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.3581G>A r.(?) p.(Arg1194His) - VUS g.233712178G>A g.232847468G>A GIGYF2(NM_015575.3):c.3581G>A (p.R1194H) - GIGYF2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3626_3646del r.(?) p.(Leu1209_Gln1215del) - likely benign g.233712223_233712243del g.232847513_232847533del GIGYF2(NM_015575.3):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1215del) - GIGYF2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-/. - c.3626_3646del r.(?) p.(Leu1209_Gln1215del) - benign g.233712223_233712243del g.232847513_232847533del GIGYF2(NM_015575.3):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1215del) - GIGYF2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.3629_3630insGC r.(?) p.(Gln1211HisfsTer25) - benign g.233712226_233712227insGC g.232847516_232847517insGC GIGYF2(NM_015575.3):c.3629_3630insGC (p.Q1211Hfs*25) - GIGYF2_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3629_3630insGC r.(?) p.(Gln1211HisfsTer25) - likely benign g.233712226_233712227insGC g.232847516_232847517insGC GIGYF2(NM_015575.3):c.3629_3630insGC (p.Q1211Hfs*25) - GIGYF2_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - c.3629_3630insGCA r.(?) p.(Gln1216dup) - VUS g.233712226_233712227insGCA g.232847516_232847517insGCA GIGYF2(NM_001103147.1):c.3693_3695delACAinsGCAACA (p.Q1237dup) - GIGYF2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3630A>G r.(?) p.(Pro1210=) - likely benign g.233712227A>G g.232847517A>G GIGYF2(NM_001103147.1):c.3693A>G (p.P1231=) - GIGYF2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3630_3631insG r.(?) p.(Gln1211AlafsTer46) - likely benign g.233712227_233712228insG g.232847517_232847518insG GIGYF2(NM_015575.3):c.3630_3631insG (p.Q1211Afs*46) - GIGYF2_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - c.3630_3632del r.(?) p.(Gln1216del) - likely benign g.233712227_233712229del g.232847517_232847519del GIGYF2(NM_001103147.1):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_015575.3):c.3630_3632delACA (p.Q1216del), GIGYF2(NM_015575.3):c.3630_3635delACAGCA... - GIGYF2_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.3630_3632del r.(?) p.(Gln1216del) - benign g.233712227_233712229del g.232847517_232847519del GIGYF2(NM_001103147.1):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_015575.3):c.3630_3632delACA (p.Q1216del), GIGYF2(NM_015575.3):c.3630_3635delACAGCA... - GIGYF2_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.3638A>C r.(?) p.(Gln1213Pro) - likely benign g.233712235A>C g.232847525A>C GIGYF2(NM_015575.3):c.3638A>C (p.Q1213P) - GIGYF2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.3647A>C r.(?) p.(Gln1216Pro) - benign g.233712244A>C g.232847534A>C GIGYF2(NM_015575.3):c.3647A>C (p.Q1216P) - GIGYF2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.3647_3649dup r.(?) p.(Gln1216dup) - VUS g.233712244_233712246dup g.232847534_232847536dup GIGYF2(NM_015575.3):c.3647_3649dupAGC (p.Q1216dup) - GIGYF2_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.3651G>A r.(?) p.(Pro1217=) - benign g.233712248G>A g.232847538G>A GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_015575.3):c.3651G>A (p.P1217=) - GIGYF2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.3651G>A r.(?) p.(Pro1217=) - benign g.233712248G>A g.232847538G>A GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_015575.3):c.3651G>A (p.P1217=) - GIGYF2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-/. - c.3651G>A r.(?) p.(Pro1217=) - benign g.233712248G>A g.232847538G>A GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_015575.3):c.3651G>A (p.P1217=) - GIGYF2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.3663_3674del r.(?) p.(Pro1222_Pro1225del) - VUS g.233712260_233712271del g.232847550_232847561del GIGYF2(NM_015575.3):c.3663_3674delGCCACAGCAGCC (p.P1222_P1225del) - GIGYF2_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3677A>C r.(?) p.(Gln1226Pro) - likely benign g.233712274A>C g.232847564A>C GIGYF2(NM_001103147.1):c.3740A>C (p.Q1247P) - GIGYF2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.3684+15G>A r.(=) p.(=) - benign g.233712296G>A g.232847586G>A GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_001103147.2):c.3747+15G>A, GIGYF2(NM_015575.3):c.3684+15G>A - GIGYF2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.3684+15G>A r.(=) p.(=) - benign g.233712296G>A g.232847586G>A GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_001103147.2):c.3747+15G>A, GIGYF2(NM_015575.3):c.3684+15G>A - GIGYF2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-/. - c.3684+15G>A r.(=) p.(=) - benign g.233712296G>A g.232847586G>A GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_001103147.2):c.3747+15G>A, GIGYF2(NM_015575.3):c.3684+15G>A - GIGYF2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3774G>A r.(?) p.(Val1258=) - likely benign g.233715061G>A g.232850351G>A GIGYF2(NM_001103147.1):c.3837G>A (p.V1279=) - GIGYF2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3846T>C r.(?) p.(Asn1282=) - likely benign g.233721516T>C g.232856806T>C GIGYF2(NM_015575.3):c.3846T>C (p.N1282=) - GIGYF2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.3855G>A r.(?) p.(Ser1285=) - benign g.233721525G>A g.232856815G>A GIGYF2(NM_001103147.2):c.3918G>A (p.S1306=) - GIGYF2_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
Legend   How to query