Full data view for gene GIGYF2

Information The variants shown are described using the NM_001103146.1 transcript reference sequence.

64 entries on 1 page. Showing entries 1 - 64.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

-/. - c.-4A>C r.(?) p.(=) Unknown - benign g.233599904A>C g.232735194A>C GIGYF2(NM_001103147.1):c.-4A>C - GIGYF2_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.73A>G r.(?) p.(Thr25Ala) Unknown - likely benign g.233612356A>G g.232747646A>G GIGYF2(NM_015575.3):c.73A>G (p.T25A) - GIGYF2_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.102G>A r.(?) p.(Pro34=) Unknown - likely benign g.233612385G>A g.232747675G>A GIGYF2(NM_001103147.1):c.102G>A (p.P34=) - GIGYF2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.167A>G r.(?) p.(Asn56Ser) Unknown - likely benign g.233612450A>G g.232747740A>G GIGYF2(NM_015575.3):c.167A>G (p.N56S) - GIGYF2_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.339G>C r.(?) p.(Val113=) Unknown - likely benign g.233621004G>C g.232756294G>C GIGYF2(NM_015575.3):c.339G>C (p.V113=) - GIGYF2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.349C>T r.(?) p.(Pro117Ser) Unknown - VUS g.233621014C>T g.232756304C>T GIGYF2(NM_015575.3):c.349C>T (p.P117S) - GIGYF2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.532+6741A>G r.(=) p.(=) Unknown - benign g.233632887A>G g.232768177A>G KCNJ13(NM_002242.4):c.*14T>C - GIGYF2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.532+7011T>G r.(=) p.(=) Unknown - VUS g.233633157T>G g.232768447T>G KCNJ13(NM_002242.4):c.827A>C (p.E276A) - KCNJ13_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.532+7149C>T r.(=) p.(=) Unknown - VUS g.233633295C>T g.232768585C>T KCNJ13(NM_002242.4):c.689G>A (p.S230N) - GIGYF2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.532+7149C>T r.(=) p.(=) Unknown - likely benign g.233633295C>T g.232768585C>T KCNJ13(NM_002242.4):c.689G>A (p.S230N) - GIGYF2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.532+7354G>A r.(=) p.(=) Unknown - likely pathogenic g.233633500G>A g.232768790G>A KCNJ13(NM_002242.4):c.484C>T (p.R162W) - KCNJ13_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.532+9469G>A r.(=) p.(=) Both (homozygous) - likely pathogenic g.233635615G>A g.232770905G>A NM_001172417.1:c.218C>T - KCNJ13_000010 r.(del-exon) effect on splicing predicted from mini-gene splicing assay PubMed: Soens 2017 - - Germline - - - 0 - DNA SEQ - - retinal disease 1302 PubMed: Soens 2017 possible duplicate - - - - - 0 - - 1 LOVD
?/. - c.789T>A r.(?) p.(Asp263Glu) Unknown - VUS g.233655484T>A - GIGYF2(NM_001103146.1):c.789T>A (p.D263E) - GIGYF2_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.818C>T r.(?) p.(Ser273Phe) Unknown - likely benign g.233655513C>T g.232790803C>T GIGYF2(NM_001103147.2):c.884C>T (p.S295F) - GIGYF2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1047T>A r.(?) p.(Asp349Glu) Unknown - likely benign g.233655834T>A g.232791124T>A GIGYF2(NM_015575.3):c.1047T>A (p.D349E) - GIGYF2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1238G>A r.(?) p.(Arg413Gln) Unknown - likely benign g.233656112G>A g.232791402G>A GIGYF2(NM_001103147.1):c.1301G>A (p.R434Q) - GIGYF2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1262A>G r.(?) p.(Lys421Arg) Unknown - likely benign g.233656136A>G g.232791426A>G GIGYF2(NM_015575.3):c.1262A>G (p.K421R) - GIGYF2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1282+6T>C r.(=) p.(=) Unknown - VUS g.233656162T>C - GIGYF2(NM_015575.3):c.1282+6T>C - GIGYF2_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1370A>C r.(?) p.(Asn457Thr) Unknown - likely benign g.233659545A>C g.232794835A>C GIGYF2(NM_015575.3):c.1370A>C (p.N457T) - GIGYF2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1378C>A r.(?) p.(Pro460Thr) Unknown - likely benign g.233659553C>A g.232794843C>A GIGYF2(NM_001103147.2):c.1441C>A (p.P481T) - GIGYF2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1554G>A r.(?) p.(Glu518=) Unknown - benign g.233660846G>A g.232796136G>A GIGYF2(NM_001103147.1):c.1617G>A (p.E539=), GIGYF2(NM_015575.3):c.1554G>A (p.E518=) - GIGYF2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1554G>A r.(?) p.(Glu518=) Unknown - likely benign g.233660846G>A g.232796136G>A GIGYF2(NM_001103147.1):c.1617G>A (p.E539=), GIGYF2(NM_015575.3):c.1554G>A (p.E518=) - GIGYF2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1574C>T r.(?) p.(Ser525Leu) Unknown - VUS g.233660866C>T g.232796156C>T GIGYF2(NM_015575.3):c.1574C>T (p.S525L) - GIGYF2_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1716G>T r.(?) p.(Ala572=) Unknown - likely benign g.233671277G>T g.232806567G>T GIGYF2(NM_001103147.1):c.1779G>T (p.A593=) - GIGYF2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1905A>G r.(?) p.(Gln635=) Unknown - likely benign g.233675960A>G g.232811250A>G GIGYF2(NM_015575.3):c.1905A>G (p.Q635=) - GIGYF2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2006+7G>A r.(=) p.(=) Unknown - likely benign g.233676068G>A g.232811358G>A GIGYF2(NM_015575.3):c.2006+7G>A - GIGYF2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2742_2744dup r.(?) p.(Gln917dup) Unknown - VUS g.233697779_233697781dup g.232833069_232833071dup GIGYF2(NM_001103147.1):c.2805_2807dupGCA (p.Q938dup) - GIGYF2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2784G>C r.(?) p.(Thr928=) Unknown - likely benign g.233704576G>C g.232839866G>C GIGYF2(NM_015575.3):c.2784G>C (p.T928=) - GIGYF2_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2835G>T r.(?) p.(Ser945=) Unknown - likely benign g.233704627G>T g.232839917G>T GIGYF2(NM_001103147.1):c.2898G>T (p.S966=) - GIGYF2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.2882G>A r.(?) p.(Arg961Gln) Unknown - likely benign g.233704674G>A g.232839964G>A GIGYF2(NM_015575.3):c.2882G>A (p.R961Q) - GIGYF2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.2927A>G r.(?) p.(Gln976Arg) Unknown - likely benign g.233708793A>G g.232844083A>G GIGYF2(NM_015575.3):c.2927A>G (p.Q976R) - GIGYF2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.2940A>G r.(?) p.(Gln980=) Unknown - benign g.233708806A>G g.232844096A>G GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_001103147.2):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.3):c.2940A>G (p.Q980=) - GIGYF2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.2940A>G r.(?) p.(Gln980=) Unknown - benign g.233708806A>G g.232844096A>G GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_001103147.2):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.3):c.2940A>G (p.Q980=) - GIGYF2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.2940A>G r.(?) p.(Gln980=) Unknown - benign g.233708806A>G g.232844096A>G GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_001103147.2):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.3):c.2940A>G (p.Q980=) - GIGYF2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3099+6del r.(=) p.(=) Unknown - VUS g.233708971del g.232844261del GIGYF2(NM_015575.3):c.3099+6delT - GIGYF2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.3104C>G r.(?) p.(Ser1035Cys) Unknown - VUS g.233709083C>G g.232844373C>G GIGYF2(NM_015575.3):c.3104C>G (p.S1035C) - GIGYF2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3461-9G>A r.(=) p.(=) Unknown - benign g.233712049G>A g.232847339G>A GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_001103147.2):c.3524-9G>A, GIGYF2(NM_015575.3):c.3461-9G>A - GIGYF2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3461-9G>A r.(=) p.(=) Unknown - benign g.233712049G>A g.232847339G>A GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_001103147.2):c.3524-9G>A, GIGYF2(NM_015575.3):c.3461-9G>A - GIGYF2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3461-9G>A r.(=) p.(=) Unknown - benign g.233712049G>A g.232847339G>A GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_001103147.2):c.3524-9G>A, GIGYF2(NM_015575.3):c.3461-9G>A - GIGYF2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3512A>G r.(?) p.(His1171Arg) Unknown - VUS g.233712109A>G g.232847399A>G GIGYF2(NM_015575.3):c.3512A>G (p.H1171R) - GIGYF2_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.3581G>A r.(?) p.(Arg1194His) Unknown - VUS g.233712178G>A g.232847468G>A GIGYF2(NM_015575.3):c.3581G>A (p.R1194H) - GIGYF2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.3626_3646del r.(?) p.(Leu1209_Gln1215del) Unknown - likely benign g.233712223_233712243del g.232847513_232847533del GIGYF2(NM_015575.3):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1215del) - GIGYF2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3626_3646del r.(?) p.(Leu1209_Gln1215del) Unknown - benign g.233712223_233712243del g.232847513_232847533del GIGYF2(NM_015575.3):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1215del) - GIGYF2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.3629_3630insGC r.(?) p.(Gln1211HisfsTer25) Unknown - benign g.233712226_233712227insGC g.232847516_232847517insGC GIGYF2(NM_001103147.2):c.3692_3693insGC (p.Q1232Hfs*25), GIGYF2(NM_015575.3):c.3629_3630insGC (p.Q1211Hfs*25) - GIGYF2_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.3629_3630insGC r.(?) p.(Gln1211HisfsTer25) Unknown - likely benign g.233712226_233712227insGC g.232847516_232847517insGC GIGYF2(NM_001103147.2):c.3692_3693insGC (p.Q1232Hfs*25), GIGYF2(NM_015575.3):c.3629_3630insGC (p.Q1211Hfs*25) - GIGYF2_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.3629_3630insGCA r.(?) p.(Gln1216dup) Unknown - VUS g.233712226_233712227insGCA g.232847516_232847517insGCA GIGYF2(NM_001103147.1):c.3693_3695delACAinsGCAACA (p.Q1237dup) - GIGYF2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3630A>G r.(?) p.(Pro1210=) Unknown - likely benign g.233712227A>G g.232847517A>G GIGYF2(NM_001103147.1):c.3693A>G (p.P1231=) - GIGYF2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3630_3631insG r.(?) p.(Gln1211AlafsTer46) Unknown - likely benign g.233712227_233712228insG g.232847517_232847518insG GIGYF2(NM_015575.3):c.3630_3631insG (p.Q1211Afs*46) - GIGYF2_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.3630_3632del r.(?) p.(Gln1216del) Unknown - likely benign g.233712227_233712229del g.232847517_232847519del GIGYF2(NM_001103147.1):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_015575.3):c.3630_3632delACA (p.Q1216del), GIGYF2(NM_015575.3):c.3630_3635delACAGCA... - GIGYF2_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.3630_3632del r.(?) p.(Gln1216del) Unknown - benign g.233712227_233712229del g.232847517_232847519del GIGYF2(NM_001103147.1):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_015575.3):c.3630_3632delACA (p.Q1216del), GIGYF2(NM_015575.3):c.3630_3635delACAGCA... - GIGYF2_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.3638A>C r.(?) p.(Gln1213Pro) Unknown - likely benign g.233712235A>C g.232847525A>C GIGYF2(NM_015575.3):c.3638A>C (p.Q1213P) - GIGYF2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3647A>C r.(?) p.(Gln1216Pro) Unknown - benign g.233712244A>C g.232847534A>C GIGYF2(NM_015575.3):c.3647A>C (p.Q1216P) - GIGYF2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3647_3649dup r.(?) p.(Gln1216dup) Unknown - VUS g.233712244_233712246dup g.232847534_232847536dup GIGYF2(NM_015575.3):c.3647_3649dupAGC (p.Q1216dup) - GIGYF2_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.3651G>A r.(?) p.(Pro1217=) Unknown - benign g.233712248G>A g.232847538G>A GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_015575.3):c.3651G>A (p.P1217=) - GIGYF2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3651G>A r.(?) p.(Pro1217=) Unknown - benign g.233712248G>A g.232847538G>A GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_015575.3):c.3651G>A (p.P1217=) - GIGYF2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3651G>A r.(?) p.(Pro1217=) Unknown - benign g.233712248G>A g.232847538G>A GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_015575.3):c.3651G>A (p.P1217=) - GIGYF2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.3663_3674del r.(?) p.(Pro1222_Pro1225del) Unknown - VUS g.233712260_233712271del g.232847550_232847561del GIGYF2(NM_015575.3):c.3663_3674delGCCACAGCAGCC (p.P1222_P1225del) - GIGYF2_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.3677A>C r.(?) p.(Gln1226Pro) Unknown - likely benign g.233712274A>C g.232847564A>C GIGYF2(NM_001103147.1):c.3740A>C (p.Q1247P) - GIGYF2_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3684+15G>A r.(=) p.(=) Unknown - benign g.233712296G>A g.232847586G>A GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_001103147.2):c.3747+15G>A, GIGYF2(NM_015575.3):c.3684+15G>A - GIGYF2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3684+15G>A r.(=) p.(=) Unknown - benign g.233712296G>A g.232847586G>A GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_001103147.2):c.3747+15G>A, GIGYF2(NM_015575.3):c.3684+15G>A - GIGYF2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.3684+15G>A r.(=) p.(=) Unknown - benign g.233712296G>A g.232847586G>A GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_001103147.2):c.3747+15G>A, GIGYF2(NM_015575.3):c.3684+15G>A - GIGYF2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3774G>A r.(?) p.(Val1258=) Unknown - likely benign g.233715061G>A g.232850351G>A GIGYF2(NM_001103147.1):c.3837G>A (p.V1279=) - GIGYF2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.3846T>C r.(?) p.(Asn1282=) Unknown - likely benign g.233721516T>C g.232856806T>C GIGYF2(NM_015575.3):c.3846T>C (p.N1282=) - GIGYF2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.3855G>A r.(?) p.(Ser1285=) Unknown - benign g.233721525G>A g.232856815G>A GIGYF2(NM_001103147.2):c.3918G>A (p.S1306=) - GIGYF2_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query