All variants in the GJA3 gene

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_021954.3 transcript reference sequence.

37 entries on 1 page. Showing entries 1 - 37.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 2 c.5G>A r.(?) p.(Gly2Asp) - VUS g.20717423C>T g.20143284C>T - - GJA3_000001 - - - - Germline - - - 0 - Ke Yao
?/. - c.48G>T r.(?) p.(Glu16Asp) - VUS g.20717380C>A - GJA3(NM_021954.4):c.48G>T (p.E16D) - GJA3_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.56C>T r.(?) p.(Thr19Met) - pathogenic g.20717372G>A g.20143233G>A GJA3(NM_021954.4):c.56C>T (p.T19M) - GJA3_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.129C>A r.(?) p.(Asp43Glu) - VUS g.20717299G>T - GJA3(NM_021954.3):c.129C>A (p.D43E) - GJA3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - c.139G>A r.(?) p.(Asp47Asn) - VUS g.20717289C>T g.20143150C>T - - GJA3_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 2 c.148T>C r.(?) p.(Ser50Pro) - likely pathogenic g.20717280A>G g.20143141A>G - - GJA3_000004 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - Johan den Dunnen
+?/. - c.148T>C r.(?) p.(Ser50Pro) ACMG likely pathogenic g.20717280A>G g.20143141A>G GJA3 c.148T>C p.(Ser50Pro) het - GJA3_000004 heterozygous PubMed: Lenassi 2020 - - Germline ? - - 0 - LOVD
+?/. - c.148T>C r.(?) p.(Ser50Pro) ACMG likely pathogenic g.20717280A>G g.20143141A>G GJA3 c.148T>C p.(Ser50Pro) het - GJA3_000004 heterozygous PubMed: Lenassi 2020 - - Germline ? - - 0 - LOVD
+/. 2 c.176C>T r.(?) p.(Pro59Leu) - pathogenic g.20717252G>A g.20143113G>A - - GJA3_000003 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - Johan den Dunnen
+?/. 2 c.184G>A r.(?) p.(Glu62Lys) - likely pathogenic g.20717244C>T g.20143105C>T - - GJA3_000005 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - Johan den Dunnen
+?/. - c.197A>G r.(?) p.(Tyr66Cys) - likely pathogenic g.20717231T>C g.20143092T>C - - GJA3_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+?/. - c.199G>C r.(?) p.(Asp67His) - likely pathogenic g.20717229C>G g.20143090C>G GJA3(NM_021954.3):c.199G>C(p.D67H) - GJA3_000032 - PubMed: Sun 2018 - - Germline/De novo (untested) ? 102 - 0 - LOVD
+?/. - c.199G>C r.(?) p.(Asp67His) - likely pathogenic g.20717229C>G g.20143090C>G GJA3(NM_021954.3):c.199G>C(p.D67H) - GJA3_000032 - PubMed: Sun 2018 - - Germline/De novo (untested) ? 103 - 0 - LOVD
+?/. - c.227G>T r.(?) p.(Arg76Leu) - likely pathogenic g.20717201C>A - GJA3(NM_021954.3):c.227G>T (p.R76L) - GJA3_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.231C>T r.(?) p.(Phe77=) - likely benign g.20717197G>A g.20143058G>A GJA3(NM_021954.3):c.231C>T (p.F77=) - GJA3_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.318_320del r.(?) p.(Lys107del) - VUS g.20717115_20717117del g.20142976_20142978del GJA3(NM_021954.3):c.318_320delGAA (p.K107del) - GJA3_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.375A>G r.(?) p.(Pro125=) - benign g.20717053T>C g.20142914T>C GJA3(NM_021954.3):c.375A>G (p.P125=) - GJA3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.395C>T r.(?) p.(Ser132Leu) - likely benign g.20717033G>A - GJA3(NM_021954.3):c.395C>T (p.S132L) - GJA3_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.398G>A r.(?) p.(Arg133Gln) - likely benign g.20717030C>T g.20142891C>T GJA3(NM_021954.3):c.398G>A (p.R133Q, p.(Arg133Gln)) - GJA3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.398G>A r.(?) p.(Arg133Gln) - likely benign g.20717030C>T g.20142891C>T GJA3(NM_021954.3):c.398G>A (p.R133Q, p.(Arg133Gln)) - GJA3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.427G>A r.(?) p.(Gly143Arg) - pathogenic g.20717001C>T - GJA3(NM_021954.3):c.427G>A (p.G143R) - GJA3_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+?/. - c.428G>T r.(?) p.(Gly143Val) - likely pathogenic g.20717000C>A g.20142861C>A - - GJA3_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.543C>T r.(=) p.(=) - benign g.20716885G>A g.20142746G>A - - GJA3_000024 37 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs74607195 Germline - 37/2795 individuals - 0 - Mohammed Faruq
+?/. 2 c.578T>C r.(?) p.(Phe193Ser) - likely pathogenic g.20716850A>G g.20142711A>G - - GJA3_000002 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - Johan den Dunnen
?/. - c.584C>T r.(?) p.(Ser195Phe) - VUS g.20716844G>A g.20142705G>A GJA3(NM_021954.3):c.584C>T (p.S195F) - GJA3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+?/. 2 c.596A>C r.(?) p.(Glu199Ala) - likely pathogenic g.20716832T>G g.20142693T>G - - GJA3_000006 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - Johan den Dunnen
+?/. 5 c.727T>C r.(?) p.(Cys243Arg) - likely pathogenic g.20716701A>G g.20142562A>G - - GJA3_000007 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - Johan den Dunnen
?/. - c.732_752del r.(?) p.(Glu244_Ala250del) - VUS g.20716680_20716700del - GJA3(NM_021954.3):c.732_752delGGCCCCGCTGGGGACAGCCGA (p.E244_A250del) - GJA3_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.771C>A r.(?) p.(Pro257=) - likely benign g.20716657G>T g.20142518G>T GJA3(NM_021954.3):c.771C>A (p.P257=) - GJA3_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.895C>A r.(?) p.(Leu299Met) - benign g.20716533G>T g.20142394G>T GJA3(NM_021954.4):c.895C>A (p.L299M) - GJA3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.1083A>C r.(?) p.(Pro361=) - likely benign g.20716345T>G g.20142206T>G GJA3(NM_021954.3):c.1083A>C (p.P361=) - GJA3_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1086C>A r.(?) p.(Leu362=) - benign g.20716342G>T g.20142203G>T GJA3(NM_021954.3):c.1086C>A (p.L362=) - GJA3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1111G>A r.(?) p.(Ala371Thr) - likely benign g.20716317C>T g.20142178C>T GJA3(NM_021954.3):c.1111G>A (p.A371T) - GJA3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1112C>G r.(?) p.(Ala371Gly) - likely benign g.20716316G>C g.20142177G>C GJA3(NM_021954.3):c.1112C>G (p.A371G) - GJA3_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.1152dup r.(?) p.(Ser385Glufs*83) - likely pathogenic g.20716279dup g.20142140dup GJA3(NM_021954.3):c.1152_1153insG(p.S385Efs*83) - GJA3_000031 - PubMed: Sun 2018 - - Germline/De novo (untested) ? 138 - 0 - LOVD
?/. - c.1234G>A r.(?) p.(Gly412Arg) - VUS g.20716194C>T g.20142055C>T GJA3(NM_021954.3):c.1234G>A (p.G412R, p.(Gly412Arg)) - GJA3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1234G>A r.(?) p.(Gly412Arg) - likely benign g.20716194C>T g.20142055C>T GJA3(NM_021954.3):c.1234G>A (p.G412R, p.(Gly412Arg)) - GJA3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
Legend   How to query