Full data view for gene GJA3

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_021954.3 transcript reference sequence.

37 entries on 1 page. Showing entries 1 - 37.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

?/. 2 c.5G>A r.(?) p.(Gly2Asp) Maternal (inferred) - VUS g.20717423C>T g.20143284C>T - - GJA3_000001 - - - - Germline - - - 0 - DNA arraySEQ - - CTRCT - - - M - (China) - - 0 - - 1 Ke Yao
?/. - c.48G>T r.(?) p.(Glu16Asp) Unknown - VUS g.20717380C>A - GJA3(NM_021954.4):c.48G>T (p.E16D) - GJA3_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.56C>T r.(?) p.(Thr19Met) Unknown - pathogenic g.20717372G>A g.20143233G>A GJA3(NM_021954.4):c.56C>T (p.T19M) - GJA3_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.129C>A r.(?) p.(Asp43Glu) Unknown - VUS g.20717299G>T - GJA3(NM_021954.3):c.129C>A (p.D43E) - GJA3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.139G>A r.(?) p.(Asp47Asn) Unknown - VUS g.20717289C>T g.20143150C>T - - GJA3_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 2 c.148T>C r.(?) p.(Ser50Pro) Parent #1 - likely pathogenic g.20717280A>G g.20143141A>G - - GJA3_000004 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - CCTRCT - PubMed: Gillespie 2014, Journal: Gillespie 2014 has affected mother, grandmother, great grandmother, 3 maternal aunts M no - - - 0 - - 6 Johan den Dunnen
+?/. - c.148T>C r.(?) p.(Ser50Pro) Unknown ACMG likely pathogenic g.20717280A>G g.20143141A>G GJA3 c.148T>C p.(Ser50Pro) het - GJA3_000004 heterozygous PubMed: Lenassi 2020 - - Germline ? - - 0 - DNA SEQ-NG blood 114 genes panel tested retinal disease 15019910 PubMed: Lenassi 2020 retrospective analysis F - (United Kingdom (Great Britain)) - - 0 - - 1 LOVD
+?/. - c.148T>C r.(?) p.(Ser50Pro) Unknown ACMG likely pathogenic g.20717280A>G g.20143141A>G GJA3 c.148T>C p.(Ser50Pro) het - GJA3_000004 heterozygous PubMed: Lenassi 2020 - - Germline ? - - 0 - DNA SEQ-NG blood 144 genes panel tested retinal disease 17008393 PubMed: Lenassi 2020 retrospective analysis M - (United Kingdom (Great Britain)) - - 0 - - 1 LOVD
+/. 2 c.176C>T r.(?) p.(Pro59Leu) Parent #1 - pathogenic g.20717252G>A g.20143113G>A - - GJA3_000003 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - CCTRCT - PubMed: Gillespie 2014, Journal: Gillespie 2014 has affected brother F no - - - 0 - - 2 Johan den Dunnen
+?/. 2 c.184G>A r.(?) p.(Glu62Lys) Parent #1 - likely pathogenic g.20717244C>T g.20143105C>T - - GJA3_000005 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - CCTRCT - PubMed: Gillespie 2014, Journal: Gillespie 2014 has affected 2 has affected children F yes - - - 0 - - 3 Johan den Dunnen
+?/. - c.197A>G r.(?) p.(Tyr66Cys) Unknown - likely pathogenic g.20717231T>C g.20143092T>C - - GJA3_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.199G>C r.(?) p.(Asp67His) Unknown - likely pathogenic g.20717229C>G g.20143090C>G GJA3(NM_021954.3):c.199G>C(p.D67H) - GJA3_000032 - PubMed: Sun 2018 - - Germline/De novo (untested) ? 102 - 0 - DNA SEQ-NG-I blood - ? WHP2 PubMed: Sun 2018 - F - China - - 0 - - 1 LOVD
+?/. - c.199G>C r.(?) p.(Asp67His) Unknown - likely pathogenic g.20717229C>G g.20143090C>G GJA3(NM_021954.3):c.199G>C(p.D67H) - GJA3_000032 - PubMed: Sun 2018 - - Germline/De novo (untested) ? 103 - 0 - DNA SEQ-NG-I blood - ? WHP3 PubMed: Sun 2018 - F - China - - 0 - - 1 LOVD
+?/. - c.227G>T r.(?) p.(Arg76Leu) Unknown - likely pathogenic g.20717201C>A - GJA3(NM_021954.3):c.227G>T (p.R76L) - GJA3_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.231C>T r.(?) p.(Phe77=) Unknown - likely benign g.20717197G>A g.20143058G>A GJA3(NM_021954.3):c.231C>T (p.F77=) - GJA3_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.318_320del r.(?) p.(Lys107del) Unknown - VUS g.20717115_20717117del g.20142976_20142978del GJA3(NM_021954.3):c.318_320delGAA (p.K107del) - GJA3_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.375A>G r.(?) p.(Pro125=) Unknown - benign g.20717053T>C g.20142914T>C GJA3(NM_021954.3):c.375A>G (p.P125=) - GJA3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.395C>T r.(?) p.(Ser132Leu) Unknown - likely benign g.20717033G>A - GJA3(NM_021954.3):c.395C>T (p.S132L) - GJA3_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.398G>A r.(?) p.(Arg133Gln) Unknown - likely benign g.20717030C>T g.20142891C>T GJA3(NM_021954.3):c.398G>A (p.R133Q, p.(Arg133Gln)) - GJA3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.398G>A r.(?) p.(Arg133Gln) Unknown - likely benign g.20717030C>T g.20142891C>T GJA3(NM_021954.3):c.398G>A (p.R133Q, p.(Arg133Gln)) - GJA3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.427G>A r.(?) p.(Gly143Arg) Unknown - pathogenic g.20717001C>T - GJA3(NM_021954.3):c.427G>A (p.G143R) - GJA3_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.428G>T r.(?) p.(Gly143Val) Unknown - likely pathogenic g.20717000C>A g.20142861C>A - - GJA3_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.543C>T r.(=) p.(=) Parent #1 - benign g.20716885G>A g.20142746G>A - - GJA3_000024 37 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs74607195 Germline - 37/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - 0 - - 37 Mohammed Faruq
+?/. 2 c.578T>C r.(?) p.(Phe193Ser) Parent #1 - likely pathogenic g.20716850A>G g.20142711A>G - - GJA3_000002 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - CCTRCT - PubMed: Gillespie 2014, Journal: Gillespie 2014 has affected daughter M no - - - 0 - - 2 Johan den Dunnen
?/. - c.584C>T r.(?) p.(Ser195Phe) Unknown - VUS g.20716844G>A g.20142705G>A GJA3(NM_021954.3):c.584C>T (p.S195F) - GJA3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. 2 c.596A>C r.(?) p.(Glu199Ala) Parent #1 - likely pathogenic g.20716832T>G g.20142693T>G - - GJA3_000006 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - CCTRCT - PubMed: Gillespie 2014, Journal: Gillespie 2014 has affected mother M no - - - 0 - - 2 Johan den Dunnen
+?/. 5 c.727T>C r.(?) p.(Cys243Arg) Both (homozygous) - likely pathogenic g.20716701A>G g.20142562A>G - - GJA3_000007 - PubMed: Gillespie 2014, Journal: Gillespie 2014 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - CCTRCT - PubMed: Gillespie 2014, Journal: Gillespie 2014 3-generation family, affected son and father F yes - - - 0 - - 2 Johan den Dunnen
?/. - c.732_752del r.(?) p.(Glu244_Ala250del) Unknown - VUS g.20716680_20716700del - GJA3(NM_021954.3):c.732_752delGGCCCCGCTGGGGACAGCCGA (p.E244_A250del) - GJA3_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.771C>A r.(?) p.(Pro257=) Unknown - likely benign g.20716657G>T g.20142518G>T GJA3(NM_021954.3):c.771C>A (p.P257=) - GJA3_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.895C>A r.(?) p.(Leu299Met) Unknown - benign g.20716533G>T g.20142394G>T GJA3(NM_021954.4):c.895C>A (p.L299M) - GJA3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1083A>C r.(?) p.(Pro361=) Unknown - likely benign g.20716345T>G g.20142206T>G GJA3(NM_021954.3):c.1083A>C (p.P361=) - GJA3_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1086C>A r.(?) p.(Leu362=) Unknown - benign g.20716342G>T g.20142203G>T GJA3(NM_021954.3):c.1086C>A (p.L362=) - GJA3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1111G>A r.(?) p.(Ala371Thr) Unknown - likely benign g.20716317C>T g.20142178C>T GJA3(NM_021954.3):c.1111G>A (p.A371T) - GJA3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1112C>G r.(?) p.(Ala371Gly) Unknown - likely benign g.20716316G>C g.20142177G>C GJA3(NM_021954.3):c.1112C>G (p.A371G) - GJA3_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1152dup r.(?) p.(Ser385Glufs*83) Unknown - likely pathogenic g.20716279dup g.20142140dup GJA3(NM_021954.3):c.1152_1153insG(p.S385Efs*83) - GJA3_000031 - PubMed: Sun 2018 - - Germline/De novo (untested) ? 138 - 0 - DNA SEQ-NG-I blood - ? WHP38 PubMed: Sun 2018 - F - China - - 0 - - 1 LOVD
?/. - c.1234G>A r.(?) p.(Gly412Arg) Unknown - VUS g.20716194C>T g.20142055C>T GJA3(NM_021954.3):c.1234G>A (p.G412R, p.(Gly412Arg)) - GJA3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1234G>A r.(?) p.(Gly412Arg) Unknown - likely benign g.20716194C>T g.20142055C>T GJA3(NM_021954.3):c.1234G>A (p.G412R, p.(Gly412Arg)) - GJA3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query