Unique variants in the IGSF1 gene

Information The variants shown are described using the NM_001170961.1 transcript reference sequence.

88 entries on 1 page. Showing entries 1 - 88.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/+ 5 _1_20_ c.del r.del p.(del) - pathogenic g.? - 126kb deletion, 328kb deletion - IGSF1_000013, IGSF1_000014 - {DOI10.1038/ng.2453:Sun 2012} - - Germline, Unknown - 1/11 families - - - Yu Sun
?/. 1 - c.-239G>C r.(?) p.(=) - VUS g.130423359C>G g.131289385C>G - - IGSF1_000044 - - - - Germline - - - - - Yu Sun
?/. 1 - c.-67-318_-67-315del r.(=) p.(=) - VUS g.130421030_130421033del g.131287056_131287059del - - IGSF1_000048 - - - - Germline - - - - - Yu Sun
?/. 2 - c.-67-317_-67-316del r.(=) p.(=) - VUS g.130421044_130421045del g.131287070_131287071del - - IGSF1_000042 - - - - Germline - - - - - Yu Sun
?/. 2 - c.-67-316_-67-315del r.(=) p.(=) - VUS g.130421030_130421031del g.131287056_131287057del - - IGSF1_000046 - - - - Germline - - - - - Yu Sun
-/. 2 - c.93= r.(=) p.(Ser31=) - benign g.130420415T>C g.131286441T>C IGSF1(NM_001170961.1):c.93A>G (p.S31=) - IGSF1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
?/. 2 - c.93A>G - p.(=) - VUS g.130420415T>C g.131286441T>C - - IGSF1_000036 1 more item - - - Germline - - - - - Yu Sun
-/. 2 - c.114= r.(=) p.(Pro38=) - benign g.130420006T>C g.131286032T>C IGSF1(NM_001170961.1):c.114A>G (p.P38=) - IGSF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
?/. 2 - c.114A>G - p.(=) - VUS g.130420006T>C g.131286032T>C - - IGSF1_000033 1 more item - - - Germline - - - - - Yu Sun
-?/. 1 - c.165G>A r.(?) p.(Thr55=) - likely benign g.130419955C>T - IGSF1(NM_001170961.1):c.165G>A (p.T55=) - IGSF1_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - c.299A>G r.(?) p.(Asn100Ser) - likely benign, VUS g.130419821T>C g.131285847T>C IGSF1(NM_001170961.1):c.299A>G (p.N100S) - IGSF1_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.314G>A r.(?) p.(Arg105Gln) - likely benign g.130419806C>T - IGSF1(NM_001170961.1):c.314G>A (p.R105Q) - IGSF1_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.373G>T r.(?) p.(Ala125Ser) - VUS g.130419747C>A g.131285773C>A IGSF1(NM_001170961.1):c.373G>T (p.A125S) - IGSF1_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 4i c.379+95T>C r.(?) p.(=) - likely benign g.130419646A>G g.131285672A>G - - IGSF1_000027 - - - - Germline - - - - - Yu Sun
-/., -?/., ?/. 5 5 c.498G>C r.(?) p.(Glu166Asp) - benign, likely benign, VUS g.130419322C>G g.131285348C>G IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 found once, nonrecurrent change, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - - CLASSIFICATION record, Unknown - 1/208 - - - Lucy Raymond, VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 1 - c.526G>C r.(?) p.(Val176Leu) - likely benign g.130419294C>G - IGSF1(NM_001170961.1):c.526G>C (p.V176L) - IGSF1_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 3 - c.667+42C>G r.(=) p.(=) - likely benign g.130419111G>C g.131285137G>C 1 more item - IGSF1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.668-8G>A r.(=) p.(=) - likely benign g.130417246C>T g.131283272C>T IGSF1(NM_001170961.1):c.668-8G>A (p.(=)) - IGSF1_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.698A>G r.(?) p.(His233Arg) - likely benign g.130417208T>C g.131283234T>C IGSF1(NM_001170961.1):c.698A>G (p.(His233Arg)) - IGSF1_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.701del r.(?) p.(Pro234LeufsTer11) - pathogenic g.130417206del g.131283232del IGSF1(NM_001170961.1):c.701delC (p.P234Lfs*11) - IGSF1_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/., ?/. 3 6 c.732G>A r.(?) p.(=), p.(Leu244=) - benign, likely benign, VUS g.130417174C>T g.131283200C>T IGSF1(NM_001170961.1):c.732G>A (p.L244=), L244L - IGSF1_000007 found once, nonrecurrent change, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - - CLASSIFICATION record, Unknown - 1/208 - - - Lucy Raymond, VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.758A>G r.(?) p.(Tyr253Cys) - likely benign g.130417148T>C g.131283174T>C IGSF1(NM_001170961.1):c.758A>G (p.Y253C) - IGSF1_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 6 c.765G>A r.(?) p.(Met255Ile) - VUS g.130417141C>T g.131283167C>T - - IGSF1_000008 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - - - Lucy Raymond
?/. 1 - c.818_820del r.(?) p.(Lys273del) - VUS g.130417090_130417092del g.131283116_131283118del IGSF1(NM_001170961.1):c.818_820delAGA (p.K273del) - IGSF1_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.946G>A r.(?) p.(Val316Met) - VUS g.130416960C>T - IGSF1(NM_001170961.1):c.946G>A (p.V316M) - IGSF1_000099 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., -?/. 4 6 c.948G>A r.(?) p.(=), p.(Val316=) - benign, likely benign g.130416958C>T g.131282984C>T IGSF1(NM_001170961.1):c.948G>A (p.V316=) - IGSF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - Yu Sun, VKGL-NL_Groningen, VKGL-NL_AMC
-/., -?/., ?/. 3 7 c.1184T>G r.(?) p.(Leu395Arg) - benign, likely benign, VUS g.130416480A>C g.131282506A>C IGSF1(NM_001170961.1):c.1184T>G (p.L395R, p.(Leu395Arg)) - IGSF1_000001 found once, nonrecurrent change, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - - CLASSIFICATION record, Unknown - 1/208 - - - Lucy Raymond, VKGL-NL_Leiden, VKGL-NL_AMC
-/-, ?/. 4 7i c.1246+132_1246+133dup r.(=) p.(=) - benign, VUS g.130416295_130416296dup g.131282321_131282322dup 1246+121_1246+122insAC - IGSF1_000029, IGSF1_000051 - - - - Germline - - - - - Yu Sun
-/., -?/. 2 - c.1247-8G>C r.(=) p.(=) - benign, likely benign g.130415926C>G g.131281952C>G IGSF1(NM_001170961.1):c.1247-8G>C (, p.(=)) - IGSF1_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
?/. 1 - c.1280C>G r.(?) p.(Pro427Arg) - VUS g.130415885G>C - IGSF1(NM_001170961.1):c.1280C>G (p.P427R) - IGSF1_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1325G>A r.(?) p.(Arg442Gln) - VUS g.130415840C>T g.131281866C>T - - IGSF1_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/-, -/. 5 8 c.1347A>G r.(?) p.(=), p.(Glu449=) - benign g.130415818T>C g.131281844T>C E449E, IGSF1(NM_001170961.1):c.1347A>G (p.E449=) - IGSF1_000002 recurrent, found 55 times, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - - CLASSIFICATION record, Germline, Unknown - 55/208 - - - Yu Sun, Lucy Raymond, VKGL-NL_Groningen, VKGL-NL_AMC
-?/. 1 - c.1546G>A r.(?) p.(Val516Ile) - likely benign g.130415292C>T g.131281318C>T IGSF1(NM_001170961.1):c.1546G>A (p.V516I) - IGSF1_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1558G>A r.(?) p.(Ala520Thr) - likely benign g.130415280C>T g.131281306C>T IGSF1(NM_001170961.1):c.1558G>A (p.(Ala520Thr)) - IGSF1_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1581G>A r.(?) p.(Met527Ile) - likely benign g.130415257C>T g.131281283C>T IGSF1(NM_001170961.1):c.1581G>A (p.M527I) - IGSF1_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1631G>A r.(?) p.(Arg544Gln) - likely benign g.130415207C>T g.131281233C>T IGSF1(NM_001170961.1):c.1631G>A (p.R544Q) - IGSF1_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.1646+11dup r.(=) p.(=) - benign g.130415182dup g.131281208dup IGSF1(NM_001170961.1):c.1646+11dupT - IGSF1_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.1697T>C r.(?) p.(Val566Ala) - VUS g.130413265A>G g.131279291A>G IGSF1(NM_001170961.1):c.1697T>C (p.V566A) - IGSF1_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.1765+18C>T r.(=) p.(=) - benign g.130413099G>A g.131279125G>A IGSF1(NM_001170961.1):c.1765+18C>T - IGSF1_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.1770A>G r.(?) p.(Ile590Met) - VUS g.130412721T>C - IGSF1(NM_001170961.1):c.1770A>G (p.I590M) - IGSF1_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., -?/. 2 - c.1811A>C r.(?) p.(Asn604Thr) - benign, likely benign g.130412680T>G g.131278706T>G IGSF1(NM_001170961.1):c.1811A>C (p.N604T, p.(Asn604Thr)) - IGSF1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
-?/. 1 - c.1827G>A r.(?) p.(Pro609=) - likely benign g.130412664C>T - IGSF1(NM_001170961.1):c.1827G>A (p.P609=) - IGSF1_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., ?/. 2 12, ? c.1933C>T r.(?) p.(Gln645*) - pathogenic, VUS g.130412558G>A g.131278584G>A c.1933c->T - IGSF1_000021 - PubMed: Nakamura, Akie - - Germline, Unknown - - - - - Yu Sun
?/. 1 - c.1940G>A r.(?) p.(Arg647Gln) - VUS g.130412551C>T - IGSF1(NM_001170961.1):c.1940G>A (p.R647Q) - IGSF1_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 - c.1981G>A r.(?) p.(Gly661Arg) - pathogenic g.130412510C>T g.131278536C>T IGSF1(NM_001170961.1):c.1981G>A (p.G661R) - IGSF1_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
?/. 1 - c.2013G>A r.(?) p.(Met671Ile) - VUS g.130412478C>T g.131278504C>T IGSF1(NM_001170961.1):c.2013G>A (p.M671I) - IGSF1_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 2 12i c.2056+24G>A r.(?) p.(=) - benign g.130412411C>T g.131278437C>T - - IGSF1_000031 - - - - Germline - - - - - Yu Sun
-/., -?/. 2 12i c.2057-70G>C r.(?) p.(=) - benign g.130412178C>G g.131278204C>G - - IGSF1_000030 - - - - Germline - - - - - Yu Sun
+/+, +/. 6 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del, IGSF1(NM_001170961.1):c.2138_2164delCAGGCATGGGGTTTGCTCTGTATAAGG (p.A713_K721del) - IGSF1_000010 VKGL data sharing initiative Nederland {DOI10.1038/ng.2453:Sun 2012}, PubMed: Sun 2011, Journal: Sun 2011, OMIM:var0001 - - CLASSIFICATION record, Germline yes 1/11 families - - - Yu Sun, VKGL-NL_Rotterdam
?/. 2 - c.2139del r.(?) p.(Gly714Alafs*64) - VUS g.130412026del g.131278052del - - IGSF1_000049 - - - - Germline - - - - - Yu Sun
-/., -?/. 2 - c.2147G>C r.(?) p.(Gly716Ala) - benign, likely benign g.130412018C>G g.131278044C>G IGSF1(NM_001170961.1):c.2147G>C (p.G716A, p.(Gly716Ala)) - IGSF1_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
+/. 1 - c.2151del r.(?) p.(Phe717LeufsTer61) - pathogenic g.130412016del g.131278042del IGSF1(NM_001170961.1):c.2151delT (p.F717Lfs*61) - IGSF1_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/+, +/. 5 13 c.2248del r.(?) p.(Glu750LysfsTer28), p.(Glu750LysfsX28) - pathogenic g.130411917del g.131277943del IGSF1(NM_001170961.1):c.2248delG (p.E750Kfs*28) - IGSF1_000012 VKGL data sharing initiative Nederland {DOI10.1038/ng.2453:Sun 2012} - - CLASSIFICATION record, Germline, Unknown - 2/11 families - - - Yu Sun, VKGL-NL_AMC
?/. 1 - c.2299T>C r.(?) p.(Ser767Pro) - VUS g.130411866A>G g.131277892A>G IGSF1(NM_001170961.1):c.2299T>C (p.S767P) - IGSF1_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/+ 1 13 c.2309G>A r.(?) p.(Ser770Asn) - pathogenic g.130411856C>T g.131277882C>T - - IGSF1_000019 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - - - Yu Sun
+/. 1 - c.2343C>A r.(?) p.(Tyr781Ter) - pathogenic g.130411193G>T - IGSF1(NM_001170961.1):c.2343C>A (p.Y781*) - IGSF1_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.2373C>A r.(?) p.(Ser791Arg) - VUS g.130411163G>T - IGSF1(NM_001170961.1):c.2373C>A (p.S791R) - IGSF1_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.2388del r.(?) p.(Gly797ValfsTer4) - pathogenic g.130411148del g.131277174del IGSF1(NM_001170961.1):c.2388delT (p.G797Vfs*4) - IGSF1_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.2563C>T r.(?) p.(Arg855Ter) - pathogenic g.130410973G>A g.131276999G>A IGSF1(NM_001170961.1):c.2563C>T (p.R855*) - IGSF1_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 3 14 c.2571T>C r.(?) p.(=), p.(Tyr857=) - benign g.130410965A>G g.131276991A>G IGSF1(NM_001170961.1):c.2571T>C (p.Y857=), NM_001555.4:c.2556T>C (Y852Y) - IGSF1_000009 found 58 times, recurrent change, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - - CLASSIFICATION record, Unknown - 58/208 - - - Lucy Raymond, VKGL-NL_Groningen, VKGL-NL_AMC
?/. 1 - c.2572G>A r.(?) p.(Asp858Asn) - VUS g.130410964C>T g.131276990C>T IGSF1(NM_001170961.1):c.2572G>A (p.D858N) - IGSF1_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+ 3 14 c.2588C>T r.(?) p.(Ser863Phe) - pathogenic g.130410948G>A g.131276974G>A - - IGSF1_000015 - {DOI10.1038/ng.2453:Sun 2012} - - Germline, Unknown - 1/11 families - - - Yu Sun
-?/. 2 14i c.2623+116A>G r.(?) p.(=) - likely benign g.130410797T>C g.131276823T>C - - IGSF1_000026 - - - - Germline - - - - - Yu Sun
+/. 1 - c.2761C>T r.(?) p.(Gln921Ter) - pathogenic g.130410085G>A g.131276111G>A IGSF1(NM_001170961.1):c.2761C>T (p.Q921*) - IGSF1_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.2768G>A r.(?) p.(Arg923Gln) - likely benign g.130410078C>T g.131276104C>T IGSF1(NM_001170961.1):c.2768G>A (p.R923Q) - IGSF1_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+ 2 15 c.2839T>C r.(?) p.(Cys947Arg) - pathogenic g.130410007A>G g.131276033A>G - - IGSF1_000016 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - - - Yu Sun
-?/. 2 15i c.2911+34G>A r.(?) p.(=) - likely benign g.130409901C>T g.131275927C>T - - IGSF1_000025 - - - - Germline - - - - - Yu Sun
+/+ 4 16 c.2931G>A r.(?) p.(Trp977X) - pathogenic g.130409720C>T g.131275746C>T - - IGSF1_000011 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - - - Yu Sun
-?/., ?/. 3 16 c.2954T>C r.(?) p.(Val985Ala) - likely benign, VUS g.130409697A>G g.131275723A>G IGSF1(NM_001170961.1):c.2954T>C (p.V985A, p.(Val985Ala)), NM_001555.4:c.2939T>C - IGSF1_000003 found once, nonrecurrent change, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - - CLASSIFICATION record, Unknown - 1/208 - - - Lucy Raymond, VKGL-NL_Leiden, VKGL-NL_AMC
+/. 1 - c.2967dup r.(?) p.(Gln990AlafsTer35) - pathogenic g.130409687dup - IGSF1(NM_001170961.1):c.2967dupG (p.Q990Afs*35) - IGSF1_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.3159C>G r.(?) p.(Ile1053Met) - VUS g.130409492G>C - IGSF1(NM_001170961.1):c.3159C>G (p.I1053M) - IGSF1_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.3179C>T r.(?) p.(Thr1060Ile) - VUS g.130409472G>A - IGSF1(NM_001170961.1):c.3179C>T (p.T1060I) - IGSF1_000100 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., -?/., ?/. 4 17 c.3243G>C r.(?) p.(Met1081Ile) - benign, likely benign, VUS g.130409217C>G g.131275243C>G IGSF1(NM_001170961.1):c.3243G>C (p.M1081I, p.(Met1081Ile)), NM_001555.4:c.3228G>C - IGSF1_000004 found once, nonrecurrent change, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - - CLASSIFICATION record, Unknown - 1/208 - - - Lucy Raymond, VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_AMC
+/., ?/. 2 17, ? c.3245T>A r.(?) p.(Val1082Glu) - pathogenic, VUS g.130409215A>T g.131275241A>T - - IGSF1_000020 - PubMed: Nakamura, Akie - - Germline, Unknown - - - - - Yu Sun
+/. 1 17 c.3251dup r.(?) p.(Gly1085Trpfs*39) - pathogenic g.130409212dup g.131275238dup c.3528-3529insC - IGSF1_000023 - PubMed: Tajima, Toshihiro - - Unknown - - - - - Yu Sun
?/. 1 - c.3416G>T r.(?) p.(Cys1139Phe) - VUS g.130409044C>A g.131275070C>A IGSF1(NM_001170961.1):c.3416G>T (p.C1139F) - IGSF1_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.3421del r.(?) p.(Tyr1141IlefsTer21) - pathogenic g.130409041del g.131275067del IGSF1(NM_001170961.1):c.3421delT (p.Y1141Ifs*21) - IGSF1_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.3489T>G r.(?) p.(Asp1163Glu) - VUS g.130408850A>C - IGSF1(NM_001170961.1):c.3489T>G (p.D1163E) - IGSF1_000104 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+ 1 18 c.3518G>A r.(?) p.(Trp1173X) - pathogenic g.130408821C>T g.131274847C>T - - IGSF1_000017 - {DOI10.1038/ng.2453:Sun 2012} - - Unknown - 1/11 families - - - Yu Sun
+/., ?/. 3 18, ? c.3565C>T r.(?) p.(Arg1189*) - pathogenic, VUS g.130408774G>A g.131274800G>A c.3565C->T - IGSF1_000022 - PubMed: Nakamura, Akie - - Germline, Unknown - - - - - Yu Sun
?/. 1 - c.3566G>A r.(?) p.(Arg1189Gln) - VUS g.130408773C>T g.131274799C>T IGSF1(NM_001170961.1):c.3566G>A (p.(Arg1189Gln)) - IGSF1_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/-, -/. 4 17, 18 c.3594C>T r.(?) p.(=), p.(Val1193=), p.(Val1198=) - benign g.130408745G>A g.131274771G>A IGSF1(NM_001170961.1):c.3594C>T (p.V1198=), NM_001555.4:c.3579C>T (V1193V) - IGSF1_000005 recurrent, found 42 times, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - - CLASSIFICATION record, Germline, Unknown - 42/208 - - - Yu Sun, Lucy Raymond, VKGL-NL_AMC
+/+ 1 18 c.3596dup r.(?) p.(Glu1200ArgfsTer3) - pathogenic g.130408743dup g.131274769dup - - IGSF1_000018 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - - - Yu Sun
?/. 1 - c.3677T>C r.(?) p.(Ile1226Thr) - VUS g.130408662A>G g.131274688A>G IGSF1(NM_001170961.1):c.3677T>C (p.I1226T) - IGSF1_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.3766+18C>T r.(=) p.(=) - benign g.130408555G>A g.131274581G>A IGSF1(NM_001170961.1):c.3766+18C>T - IGSF1_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/. 2 18i c.3766+142A>G r.(?) p.(=) - likely benign g.130408431T>C g.131274457T>C - - IGSF1_000024 - - - - Germline - - - - - Yu Sun
-/. 2 - c.3921C>G r.(?) p.(Thr1307=) - benign g.130407875G>C g.131273901G>C IGSF1(NM_001170961.1):c.3921C>G (p.T1307=) - IGSF1_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
?/. 1 - c.3947_3949del r.(?) p.(Glu1316del) - VUS g.130407850_130407852del - IGSF1(NM_001170961.1):c.3947_3949delAAG (p.E1316del) - IGSF1_000094 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query