Full data view for gene IGSF1

Information The variants shown are described using the NM_001170961.1 transcript reference sequence.

169 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

+/+ _1_20_ c.del r.del p.(del) Maternal (confirmed) - pathogenic g.? - 126kb deletion - IGSF1_000013 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - DNA SEQ - - CHTE - {DOI10.1038/ng.2453:Sun 2012} E-IV.1 M no Netherlands - - 0 - - 1 Yu Sun
+/+ _1_20_ c.del r.del p.(del) Maternal (confirmed) - pathogenic g.? - 126kb deletion - IGSF1_000013 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - DNA SEQ - - CHTE - - E-IV.3 M no Netherlands - - 0 - - 1 Yu Sun
+/+ _1_20_ c.del r.del p.(del) Maternal (confirmed) - pathogenic g.? - 328kb deletion - IGSF1_000014 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - DNA SEQ - - CHTE - - F-IV.1 M no Netherlands - - 0 - - 1 Yu Sun
+/+ _1_20_ c.del r.del p.(del) Maternal (confirmed) - pathogenic g.? - 328kb deletion - IGSF1_000014 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - DNA SEQ - - CHTE - - F-IV.2 M no Netherlands - - 0 - - 1 Yu Sun
+/+ _1_20_ c.del r.del p.(del) Unknown - pathogenic g.? - 328kb deletion - IGSF1_000014 - {DOI10.1038/ng.2453:Sun 2012} - - Unknown - 1/11 families - 0 - DNA SEQ - - CHTE - - F-II.8 M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.-239G>C r.(?) p.(=) Maternal (inferred) - VUS g.130423359C>G g.131289385C>G - - IGSF1_000044 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.-67-318_-67-315del r.(=) p.(=) Unknown - VUS g.130421030_130421033del g.131287056_131287059del - - IGSF1_000048 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.-67-317_-67-316del r.(=) p.(=) Maternal (inferred) - VUS g.130421044_130421045del g.131287070_131287071del - - IGSF1_000042 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.-67-317_-67-316del r.(=) p.(=) Maternal (inferred) - VUS g.130421044_130421045del g.131287070_131287071del - - IGSF1_000042 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.-67-316_-67-315del r.(=) p.(=) Maternal (inferred) - VUS g.130421030_130421031del g.131287056_131287057del - - IGSF1_000046 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.-67-316_-67-315del r.(=) p.(=) Unknown - VUS g.130421030_130421031del g.131287056_131287057del - - IGSF1_000046 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. - c.27G>T r.(?) p.(Gly9=) Unknown - likely benign g.130420622C>A - IGSF1(NM_001170961.1):c.27G>T (p.G9=) - IGSF1_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.93= r.(=) p.(Ser31=) Unknown - benign g.130420415T>C g.131286441T>C IGSF1(NM_001170961.1):c.93A>G (p.S31=) - IGSF1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.93= r.(=) p.(Ser31=) Unknown - benign g.130420415T>C g.131286441T>C IGSF1(NM_001170961.1):c.93A>G (p.S31=) - IGSF1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.93A>G - p.(=) Maternal (inferred) - VUS g.130420415T>C g.131286441T>C - - IGSF1_000036 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.93A>G - p.(=) Maternal (inferred) - VUS g.130420415T>C g.131286441T>C - - IGSF1_000036 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. - c.114= r.(=) p.(Pro38=) Unknown - benign g.130420006T>C g.131286032T>C IGSF1(NM_001170961.1):c.114A>G (p.P38=) - IGSF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.114= r.(=) p.(Pro38=) Unknown - benign g.130420006T>C g.131286032T>C IGSF1(NM_001170961.1):c.114A>G (p.P38=) - IGSF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.114A>G - p.(=) Maternal (inferred) - VUS g.130420006T>C g.131286032T>C - - IGSF1_000033 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.114A>G - p.(=) Maternal (inferred) - VUS g.130420006T>C g.131286032T>C - - IGSF1_000033 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. - c.165G>A r.(?) p.(Thr55=) Unknown - likely benign g.130419955C>T - IGSF1(NM_001170961.1):c.165G>A (p.T55=) - IGSF1_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.299A>G r.(?) p.(Asn100Ser) Unknown - VUS g.130419821T>C g.131285847T>C IGSF1(NM_001170961.1):c.299A>G (p.N100S, p.(Asn100Ser)) - IGSF1_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.299A>G r.(?) p.(Asn100Ser) Unknown - likely benign g.130419821T>C g.131285847T>C IGSF1(NM_001170961.1):c.299A>G (p.N100S, p.(Asn100Ser)) - IGSF1_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.299A>G r.(?) p.(Asn100Ser) Unknown - likely benign g.130419821T>C - IGSF1(NM_001170961.1):c.299A>G (p.N100S, p.(Asn100Ser)) - IGSF1_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.314G>A r.(?) p.(Arg105Gln) Unknown - likely benign g.130419806C>T - IGSF1(NM_001170961.1):c.314G>A (p.R105Q) - IGSF1_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.373G>T r.(?) p.(Ala125Ser) Unknown - VUS g.130419747C>A g.131285773C>A IGSF1(NM_001170961.1):c.373G>T (p.A125S) - IGSF1_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. 4i c.379+95T>C r.(?) p.(=) Maternal (inferred) - likely benign g.130419646A>G g.131285672A>G - - IGSF1_000027 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. 4i c.379+95T>C r.(?) p.(=) Maternal (inferred) - likely benign g.130419646A>G g.131285672A>G - - IGSF1_000027 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. 5 c.498G>C r.(?) p.(Glu166Asp) Maternal (inferred) - VUS g.130419322C>G g.131285348C>G - - IGSF1_000006 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - 0 - DNA SEQ - - MRX;IDX 19377351-Pat? PubMed: Tarpey 2009 - - - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
-?/. - c.498G>C r.(?) p.(Glu166Asp) Unknown - likely benign g.130419322C>G g.131285348C>G IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.498G>C r.(?) p.(Glu166Asp) Unknown - likely benign g.130419322C>G g.131285348C>G IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.498G>C r.(?) p.(Glu166Asp) Unknown - benign g.130419322C>G g.131285348C>G IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.498G>C r.(?) p.(Glu166Asp) Unknown - likely benign g.130419322C>G - IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.526G>C r.(?) p.(Val176Leu) Unknown - likely benign g.130419294C>G - IGSF1(NM_001170961.1):c.526G>C (p.V176L) - IGSF1_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.667+42C>G r.(=) p.(=) Unknown - likely benign g.130419111G>C g.131285137G>C IGSF1(NM_001170963.1):c.709C>G (p.(Pro237Ala)), IGSF1(NM_205833.3):c.709C>G (p.P237A), IGSF1(NM_205833.4):c.709C>G (p.P237A) - IGSF1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.667+42C>G r.(=) p.(=) Unknown - likely benign g.130419111G>C g.131285137G>C IGSF1(NM_001170963.1):c.709C>G (p.(Pro237Ala)), IGSF1(NM_205833.3):c.709C>G (p.P237A), IGSF1(NM_205833.4):c.709C>G (p.P237A) - IGSF1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.667+42C>G r.(=) p.(=) Unknown - likely benign g.130419111G>C - IGSF1(NM_001170963.1):c.709C>G (p.(Pro237Ala)), IGSF1(NM_205833.3):c.709C>G (p.P237A), IGSF1(NM_205833.4):c.709C>G (p.P237A) - IGSF1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.668-8G>A r.(=) p.(=) Unknown - likely benign g.130417246C>T g.131283272C>T IGSF1(NM_001170961.1):c.668-8G>A (p.(=)) - IGSF1_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.698A>G r.(?) p.(His233Arg) Unknown - likely benign g.130417208T>C g.131283234T>C IGSF1(NM_001170961.1):c.698A>G (p.H233R, p.(His233Arg)) - IGSF1_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.698A>G r.(?) p.(His233Arg) Unknown - likely benign g.130417208T>C - IGSF1(NM_001170961.1):c.698A>G (p.H233R, p.(His233Arg)) - IGSF1_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.701del r.(?) p.(Pro234LeufsTer11) Unknown - pathogenic g.130417206del g.131283232del IGSF1(NM_001170961.1):c.701delC (p.P234Lfs*11) - IGSF1_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 6 c.732G>A r.(?) p.(=) Maternal (inferred) - VUS g.130417174C>T g.131283200C>T L244L - IGSF1_000007 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - 0 - DNA SEQ - - MRX;IDX 19377352-Pat? PubMed: Tarpey 2009 - - - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
-?/. - c.732G>A r.(?) p.(Leu244=) Unknown - likely benign g.130417174C>T g.131283200C>T IGSF1(NM_001170961.1):c.732G>A (p.L244=) - IGSF1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.732G>A r.(?) p.(Leu244=) Unknown - benign g.130417174C>T g.131283200C>T IGSF1(NM_001170961.1):c.732G>A (p.L244=) - IGSF1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.758A>G r.(?) p.(Tyr253Cys) Unknown - likely benign g.130417148T>C g.131283174T>C IGSF1(NM_001170961.1):c.758A>G (p.Y253C) - IGSF1_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 6 c.765G>A r.(?) p.(Met255Ile) Maternal (inferred) - VUS g.130417141C>T g.131283167C>T - - IGSF1_000008 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - 0 - DNA SEQ - - MRX;IDX 19377353-Pat? PubMed: Tarpey 2009 - - - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
?/. - c.818_820del r.(?) p.(Lys273del) Unknown - VUS g.130417090_130417092del g.131283116_131283118del IGSF1(NM_001170961.1):c.818_820delAGA (p.K273del) - IGSF1_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.946G>A r.(?) p.(Val316Met) Unknown - VUS g.130416960C>T - IGSF1(NM_001170961.1):c.946G>A (p.V316M) - IGSF1_000099 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. 6 c.948G>A r.(?) p.(=) Maternal (inferred) - likely benign g.130416958C>T g.131282984C>T - - IGSF1_000028 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. 6 c.948G>A r.(?) p.(=) Maternal (inferred) - likely benign g.130416958C>T g.131282984C>T - - IGSF1_000028 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. - c.948G>A r.(?) p.(Val316=) Unknown - benign g.130416958C>T g.131282984C>T IGSF1(NM_001170961.1):c.948G>A (p.V316=) - IGSF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.948G>A r.(?) p.(Val316=) Unknown - benign g.130416958C>T g.131282984C>T IGSF1(NM_001170961.1):c.948G>A (p.V316=) - IGSF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 7 c.1184T>G r.(?) p.(Leu395Arg) Maternal (inferred) - VUS g.130416480A>C g.131282506A>C - - IGSF1_000001 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - 0 - DNA SEQ - - MRX;IDX 19377346-Pat? PubMed: Tarpey 2009 - - - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
-/. - c.1184T>G r.(?) p.(Leu395Arg) Unknown - benign g.130416480A>C g.131282506A>C IGSF1(NM_001170961.1):c.1184T>G (p.L395R, p.(Leu395Arg)) - IGSF1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1184T>G r.(?) p.(Leu395Arg) Unknown - likely benign g.130416480A>C g.131282506A>C IGSF1(NM_001170961.1):c.1184T>G (p.L395R, p.(Leu395Arg)) - IGSF1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/- 7i c.1246+132_1246+133dup r.(=) p.(=) Maternal (inferred) - benign g.130416295_130416296dup g.131282321_131282322dup 1246+121_1246+122insAC - IGSF1_000029 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1246+132_1246+133dup r.(=) p.(=) Unknown - VUS g.130416295_130416296dup g.131282321_131282322dup - - IGSF1_000051 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/- 7i c.1246+132_1246+133dup r.(=) p.(=) Maternal (inferred) - benign g.130416295_130416296dup g.131282321_131282322dup 1246+121_1246+122insAC - IGSF1_000029 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1246+132_1246+133dup r.(=) p.(=) Maternal (inferred) - VUS g.130416295_130416296dup g.131282321_131282322dup - - IGSF1_000051 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. - c.1247-8G>C r.(=) p.(=) Unknown - benign g.130415926C>G g.131281952C>G IGSF1(NM_001170961.1):c.1247-8G>C (, p.(=)) - IGSF1_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1247-8G>C r.(=) p.(=) Unknown - likely benign g.130415926C>G g.131281952C>G IGSF1(NM_001170961.1):c.1247-8G>C (, p.(=)) - IGSF1_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1280C>G r.(?) p.(Pro427Arg) Unknown - VUS g.130415885G>C - IGSF1(NM_001170961.1):c.1280C>G (p.P427R) - IGSF1_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1325G>A r.(?) p.(Arg442Gln) Unknown - VUS g.130415840C>T g.131281866C>T - - IGSF1_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/- 8 c.1347A>G r.(?) p.(Glu449=) Maternal (inferred) - benign g.130415818T>C g.131281844T>C - - IGSF1_000002 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/- 8 c.1347A>G r.(?) p.(Glu449=) Maternal (inferred) - benign g.130415818T>C g.131281844T>C - - IGSF1_000002 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. 8 c.1347A>G r.(?) p.(=) Maternal (inferred) - benign g.130415818T>C g.131281844T>C E449E - IGSF1_000002 recurrent, found 55 times PubMed: Tarpey 2009 - - Unknown - 55/208 - 0 - DNA SEQ - - MRX;IDX 19377347-Pat? PubMed: Tarpey 2009 - - - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 55 Lucy Raymond
-/. - c.1347A>G r.(?) p.(Glu449=) Unknown - benign g.130415818T>C g.131281844T>C IGSF1(NM_001170961.1):c.1347A>G (p.E449=) - IGSF1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1347A>G r.(?) p.(Glu449=) Unknown - benign g.130415818T>C g.131281844T>C IGSF1(NM_001170961.1):c.1347A>G (p.E449=) - IGSF1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1546G>A r.(?) p.(Val516Ile) Unknown - likely benign g.130415292C>T g.131281318C>T IGSF1(NM_001170961.1):c.1546G>A (p.V516I) - IGSF1_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1558G>A r.(?) p.(Ala520Thr) Unknown - likely benign g.130415280C>T g.131281306C>T IGSF1(NM_001170961.1):c.1558G>A (p.(Ala520Thr)) - IGSF1_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1581G>A r.(?) p.(Met527Ile) Unknown - likely benign g.130415257C>T g.131281283C>T IGSF1(NM_001170961.1):c.1581G>A (p.M527I) - IGSF1_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1631G>A r.(?) p.(Arg544Gln) Unknown - likely benign g.130415207C>T g.131281233C>T IGSF1(NM_001170961.1):c.1631G>A (p.R544Q) - IGSF1_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1646+11dup r.(=) p.(=) Unknown - benign g.130415182dup g.131281208dup IGSF1(NM_001170961.1):c.1646+11dupT - IGSF1_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1697T>C r.(?) p.(Val566Ala) Unknown - VUS g.130413265A>G g.131279291A>G IGSF1(NM_001170961.1):c.1697T>C (p.V566A) - IGSF1_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1701G>A r.(?) p.(Thr567=) Unknown - likely benign g.130413261C>T - IGSF1(NM_001170961.1):c.1701G>A (p.T567=) - IGSF1_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1765+18C>T r.(=) p.(=) Unknown - benign g.130413099G>A g.131279125G>A IGSF1(NM_001170961.1):c.1765+18C>T - IGSF1_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1770A>G r.(?) p.(Ile590Met) Unknown - VUS g.130412721T>C - IGSF1(NM_001170961.1):c.1770A>G (p.I590M) - IGSF1_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1811A>C r.(?) p.(Asn604Thr) Unknown - benign g.130412680T>G g.131278706T>G IGSF1(NM_001170961.1):c.1811A>C (p.N604T, p.(Asn604Thr)) - IGSF1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1811A>C r.(?) p.(Asn604Thr) Unknown - likely benign g.130412680T>G g.131278706T>G IGSF1(NM_001170961.1):c.1811A>C (p.N604T, p.(Asn604Thr)) - IGSF1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1827G>A r.(?) p.(Pro609=) Unknown - likely benign g.130412664C>T - IGSF1(NM_001170961.1):c.1827G>A (p.P609=) - IGSF1_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1827G>A r.(?) p.(Pro609=) Unknown - benign g.130412664C>T - IGSF1(NM_001170961.1):c.1827G>A (p.P609=) - IGSF1_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. ? c.1933C>T r.(?) p.(Gln645*) Unknown - VUS g.130412558G>A g.131278584G>A c.1933c->T - IGSF1_000021 - PubMed: Nakamura, Akie - - Unknown - - - 0 - DNA SEQ - - CHTE - PubMed: Nakamura, Akie carrier, mother of patient 4 F no Japan - - 0 - - 1 Yu Sun
+/. 12 c.1933C>T r.(?) p.(Gln645*) Maternal (confirmed) - pathogenic g.130412558G>A g.131278584G>A c.1933c->T - IGSF1_000021 - PubMed: Nakamura, Akie - - Germline - - - 0 - DNA SEQ - - CHTE - PubMed: Nakamura, Akie patient 4 M no Japan - - 0 - - 1 Yu Sun
?/. - c.1940G>A r.(?) p.(Arg647Gln) Unknown - VUS g.130412551C>T - IGSF1(NM_001170961.1):c.1940G>A (p.R647Q) - IGSF1_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1981G>A r.(?) p.(Gly661Arg) Unknown - pathogenic g.130412510C>T g.131278536C>T IGSF1(NM_001170961.1):c.1981G>A (p.G661R) - IGSF1_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.1981G>A r.(?) p.(Gly661Arg) Unknown - pathogenic g.130412510C>T g.131278536C>T IGSF1(NM_001170961.1):c.1981G>A (p.G661R) - IGSF1_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2013G>A r.(?) p.(Met671Ile) Unknown - VUS g.130412478C>T g.131278504C>T IGSF1(NM_001170961.1):c.2013G>A (p.M671I) - IGSF1_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. 12i c.2056+24G>A r.(?) p.(=) Maternal (inferred) - benign g.130412411C>T g.131278437C>T - - IGSF1_000031 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. 12i c.2056+24G>A r.(?) p.(=) Maternal (inferred) - benign g.130412411C>T g.131278437C>T - - IGSF1_000031 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. 12i c.2057-70G>C r.(?) p.(=) Maternal (inferred) - benign g.130412178C>G g.131278204C>G - - IGSF1_000030 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. 12i c.2057-70G>C r.(?) p.(=) Maternal (inferred) - benign g.130412178C>G g.131278204C>G - - IGSF1_000030 - - - - Germline - - - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) Maternal (inferred) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - PubMed: Sun 2011, Journal: Sun 2011, OMIM:var0001 - - Germline yes 1/11 families - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) Maternal (inferred) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - PubMed: Sun 2011, Journal: Sun 2011, OMIM:var0001 - - Germline yes 1/11 families - 0 - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) Maternal (confirmed) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - DNA SEQ - - CHTE - - - M no Netherlands - - 0 - - 1 Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) Maternal (inferred) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - DNA SEQ - - CHTE - - A-II.4 M no Netherlands - - 0 - - 1 Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) Maternal (inferred) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - DNA SEQ - - CHTE - - A-I.4 M no Netherlands - - 0 - - 1 Yu Sun
+/. - c.2138_2164del r.(?) p.(Ala713_Lys721del) Unknown - pathogenic g.130412003_130412029del g.131278029_131278055del IGSF1(NM_001170961.1):c.2138_2164delCAGGCATGGGGTTTGCTCTGTATAAGG (p.A713_K721del) - IGSF1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2139del r.(?) p.(Gly714Alafs*64) Maternal (inferred) - VUS g.130412026del g.131278052del - - IGSF1_000049 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.2139del r.(?) p.(Gly714Alafs*64) Maternal (inferred) - VUS g.130412026del g.131278052del - - IGSF1_000049 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. - c.2147G>C r.(?) p.(Gly716Ala) Unknown - benign g.130412018C>G g.131278044C>G IGSF1(NM_001170961.1):c.2147G>C (p.G716A, p.(Gly716Ala)) - IGSF1_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query   « First ‹ Prev     1 2     Next › Last »