All variants in the IGSF1 gene

Information The variants shown are described using the NM_001170961.1 transcript reference sequence.

160 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/+ _1_20_ c.del r.del p.(del) - pathogenic g.? - 126kb deletion - IGSF1_000013 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - Yu Sun
+/+ _1_20_ c.del r.del p.(del) - pathogenic g.? - 126kb deletion - IGSF1_000013 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - Yu Sun
+/+ _1_20_ c.del r.del p.(del) - pathogenic g.? - 328kb deletion - IGSF1_000014 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - Yu Sun
+/+ _1_20_ c.del r.del p.(del) - pathogenic g.? - 328kb deletion - IGSF1_000014 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - Yu Sun
+/+ _1_20_ c.del r.del p.(del) - pathogenic g.? - 328kb deletion - IGSF1_000014 - {DOI10.1038/ng.2453:Sun 2012} - - Unknown - 1/11 families - 0 - Yu Sun
?/. - c.-239G>C r.(?) p.(=) - VUS g.130423359C>G g.131289385C>G - - IGSF1_000044 - - - - Germline - - - - - Yu Sun
?/. - c.-67-318_-67-315del r.(=) p.(=) - VUS g.130421030_130421033del g.131287056_131287059del - - IGSF1_000048 - - - - Germline - - - - - Yu Sun
?/. - c.-67-317_-67-316del r.(=) p.(=) - VUS g.130421044_130421045del g.131287070_131287071del - - IGSF1_000042 - - - - Germline - - - - - Yu Sun
?/. - c.-67-317_-67-316del r.(=) p.(=) - VUS g.130421044_130421045del g.131287070_131287071del - - IGSF1_000042 - - - - Germline - - - - - Yu Sun
?/. - c.-67-316_-67-315del r.(=) p.(=) - VUS g.130421030_130421031del g.131287056_131287057del - - IGSF1_000046 - - - - Germline - - - - - Yu Sun
?/. - c.-67-316_-67-315del r.(=) p.(=) - VUS g.130421030_130421031del g.131287056_131287057del - - IGSF1_000046 - - - - Germline - - - - - Yu Sun
-/. - c.93= r.(=) p.(Ser31=) - benign g.130420415T>C g.131286441T>C IGSF1(NM_001170961.1):c.93A>G (p.S31=) - IGSF1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.93= r.(=) p.(Ser31=) - benign g.130420415T>C g.131286441T>C IGSF1(NM_001170961.1):c.93A>G (p.S31=) - IGSF1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
?/. - c.93A>G - p.(=) - VUS g.130420415T>C g.131286441T>C - - IGSF1_000036 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. - - - Germline - - - - - Yu Sun
?/. - c.93A>G - p.(=) - VUS g.130420415T>C g.131286441T>C - - IGSF1_000036 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. - - - Germline - - - - - Yu Sun
-/. - c.114= r.(=) p.(Pro38=) - benign g.130420006T>C g.131286032T>C IGSF1(NM_001170961.1):c.114A>G (p.P38=) - IGSF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.114= r.(=) p.(Pro38=) - benign g.130420006T>C g.131286032T>C IGSF1(NM_001170961.1):c.114A>G (p.P38=) - IGSF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
?/. - c.114A>G - p.(=) - VUS g.130420006T>C g.131286032T>C - - IGSF1_000033 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. - - - Germline - - - - - Yu Sun
?/. - c.114A>G - p.(=) - VUS g.130420006T>C g.131286032T>C - - IGSF1_000033 Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message. - - - Germline - - - - - Yu Sun
-?/. - c.165G>A r.(?) p.(Thr55=) - likely benign g.130419955C>T - IGSF1(NM_001170961.1):c.165G>A (p.T55=) - IGSF1_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.299A>G r.(?) p.(Asn100Ser) - VUS g.130419821T>C g.131285847T>C IGSF1(NM_001170961.1):c.299A>G (p.N100S) - IGSF1_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.299A>G r.(?) p.(Asn100Ser) - likely benign g.130419821T>C g.131285847T>C IGSF1(NM_001170961.1):c.299A>G (p.N100S) - IGSF1_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.314G>A r.(?) p.(Arg105Gln) - likely benign g.130419806C>T - IGSF1(NM_001170961.1):c.314G>A (p.R105Q) - IGSF1_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.373G>T r.(?) p.(Ala125Ser) - VUS g.130419747C>A g.131285773C>A IGSF1(NM_001170961.1):c.373G>T (p.A125S) - IGSF1_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 4i c.379+95T>C r.(?) p.(=) - likely benign g.130419646A>G g.131285672A>G - - IGSF1_000027 - - - - Germline - - - 0 - Yu Sun
-?/. 4i c.379+95T>C r.(?) p.(=) - likely benign g.130419646A>G g.131285672A>G - - IGSF1_000027 - - - - Germline - - - 0 - Yu Sun
?/. 5 c.498G>C r.(?) p.(Glu166Asp) - VUS g.130419322C>G g.131285348C>G - - IGSF1_000006 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - 0 - Lucy Raymond
-?/. - c.498G>C r.(?) p.(Glu166Asp) - likely benign g.130419322C>G g.131285348C>G IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.498G>C r.(?) p.(Glu166Asp) - likely benign g.130419322C>G g.131285348C>G IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.498G>C r.(?) p.(Glu166Asp) - benign g.130419322C>G g.131285348C>G IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.498G>C r.(?) p.(Glu166Asp) - likely benign g.130419322C>G - IGSF1(NM_001170961.1):c.498G>C (p.E166D, p.(Glu166Asp)) - IGSF1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.526G>C r.(?) p.(Val176Leu) - likely benign g.130419294C>G - IGSF1(NM_001170961.1):c.526G>C (p.V176L) - IGSF1_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.667+42C>G r.(=) p.(=) - likely benign g.130419111G>C g.131285137G>C IGSF1(NM_001170963.1):c.709C>G (p.(Pro237Ala)), IGSF1(NM_205833.3):c.709C>G (p.P237A), IGSF1(NM_205833.4):c.709C>G (p.P237A) - IGSF1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.667+42C>G r.(=) p.(=) - likely benign g.130419111G>C g.131285137G>C IGSF1(NM_001170963.1):c.709C>G (p.(Pro237Ala)), IGSF1(NM_205833.3):c.709C>G (p.P237A), IGSF1(NM_205833.4):c.709C>G (p.P237A) - IGSF1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.667+42C>G r.(=) p.(=) - likely benign g.130419111G>C - IGSF1(NM_001170963.1):c.709C>G (p.(Pro237Ala)), IGSF1(NM_205833.3):c.709C>G (p.P237A), IGSF1(NM_205833.4):c.709C>G (p.P237A) - IGSF1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.668-8G>A r.(=) p.(=) - likely benign g.130417246C>T g.131283272C>T IGSF1(NM_001170961.1):c.668-8G>A (p.(=)) - IGSF1_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.698A>G r.(?) p.(His233Arg) - likely benign g.130417208T>C g.131283234T>C IGSF1(NM_001170961.1):c.698A>G (p.(His233Arg)) - IGSF1_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. - c.701del r.(?) p.(Pro234LeufsTer11) - pathogenic g.130417206del g.131283232del IGSF1(NM_001170961.1):c.701delC (p.P234Lfs*11) - IGSF1_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. 6 c.732G>A r.(?) p.(=) - VUS g.130417174C>T g.131283200C>T L244L - IGSF1_000007 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - 0 - Lucy Raymond
-?/. - c.732G>A r.(?) p.(Leu244=) - likely benign g.130417174C>T g.131283200C>T IGSF1(NM_001170961.1):c.732G>A (p.L244=) - IGSF1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.732G>A r.(?) p.(Leu244=) - benign g.130417174C>T g.131283200C>T IGSF1(NM_001170961.1):c.732G>A (p.L244=) - IGSF1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.758A>G r.(?) p.(Tyr253Cys) - likely benign g.130417148T>C g.131283174T>C IGSF1(NM_001170961.1):c.758A>G (p.Y253C) - IGSF1_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. 6 c.765G>A r.(?) p.(Met255Ile) - VUS g.130417141C>T g.131283167C>T - - IGSF1_000008 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - 0 - Lucy Raymond
?/. - c.818_820del r.(?) p.(Lys273del) - VUS g.130417090_130417092del g.131283116_131283118del IGSF1(NM_001170961.1):c.818_820delAGA (p.K273del) - IGSF1_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.946G>A r.(?) p.(Val316Met) - VUS g.130416960C>T - IGSF1(NM_001170961.1):c.946G>A (p.V316M) - IGSF1_000099 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 6 c.948G>A r.(?) p.(=) - likely benign g.130416958C>T g.131282984C>T - - IGSF1_000028 - - - - Germline - - - 0 - Yu Sun
-?/. 6 c.948G>A r.(?) p.(=) - likely benign g.130416958C>T g.131282984C>T - - IGSF1_000028 - - - - Germline - - - 0 - Yu Sun
-/. - c.948G>A r.(?) p.(Val316=) - benign g.130416958C>T g.131282984C>T IGSF1(NM_001170961.1):c.948G>A (p.V316=) - IGSF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.948G>A r.(?) p.(Val316=) - benign g.130416958C>T g.131282984C>T IGSF1(NM_001170961.1):c.948G>A (p.V316=) - IGSF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
?/. 7 c.1184T>G r.(?) p.(Leu395Arg) - VUS g.130416480A>C g.131282506A>C - - IGSF1_000001 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 - 0 - Lucy Raymond
-/. - c.1184T>G r.(?) p.(Leu395Arg) - benign g.130416480A>C g.131282506A>C IGSF1(NM_001170961.1):c.1184T>G (p.L395R, p.(Leu395Arg)) - IGSF1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.1184T>G r.(?) p.(Leu395Arg) - likely benign g.130416480A>C g.131282506A>C IGSF1(NM_001170961.1):c.1184T>G (p.L395R, p.(Leu395Arg)) - IGSF1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/- 7i c.1246+132_1246+133dup r.(=) p.(=) - benign g.130416295_130416296dup g.131282321_131282322dup 1246+121_1246+122insAC - IGSF1_000029 - - - - Germline - - - 0 - Yu Sun
?/. - c.1246+132_1246+133dup r.(=) p.(=) - VUS g.130416295_130416296dup g.131282321_131282322dup - - IGSF1_000051 - - - - Germline - - - - - Yu Sun
-/- 7i c.1246+132_1246+133dup r.(=) p.(=) - benign g.130416295_130416296dup g.131282321_131282322dup 1246+121_1246+122insAC - IGSF1_000029 - - - - Germline - - - 0 - Yu Sun
?/. - c.1246+132_1246+133dup r.(=) p.(=) - VUS g.130416295_130416296dup g.131282321_131282322dup - - IGSF1_000051 - - - - Germline - - - - - Yu Sun
-/. - c.1247-8G>C r.(=) p.(=) - benign g.130415926C>G g.131281952C>G IGSF1(NM_001170961.1):c.1247-8G>C (, p.(=)) - IGSF1_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.1247-8G>C r.(=) p.(=) - likely benign g.130415926C>G g.131281952C>G IGSF1(NM_001170961.1):c.1247-8G>C (, p.(=)) - IGSF1_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.1280C>G r.(?) p.(Pro427Arg) - VUS g.130415885G>C - IGSF1(NM_001170961.1):c.1280C>G (p.P427R) - IGSF1_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1325G>A r.(?) p.(Arg442Gln) - VUS g.130415840C>T g.131281866C>T - - IGSF1_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-/- 8 c.1347A>G r.(?) p.(Glu449=) - benign g.130415818T>C g.131281844T>C - - IGSF1_000002 - - - - Germline - - - 0 - Yu Sun
-/- 8 c.1347A>G r.(?) p.(Glu449=) - benign g.130415818T>C g.131281844T>C - - IGSF1_000002 - - - - Germline - - - 0 - Yu Sun
-/. 8 c.1347A>G r.(?) p.(=) - benign g.130415818T>C g.131281844T>C E449E - IGSF1_000002 recurrent, found 55 times PubMed: Tarpey 2009 - - Unknown - 55/208 - 0 - Lucy Raymond
-/. - c.1347A>G r.(?) p.(Glu449=) - benign g.130415818T>C g.131281844T>C IGSF1(NM_001170961.1):c.1347A>G (p.E449=) - IGSF1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.1347A>G r.(?) p.(Glu449=) - benign g.130415818T>C g.131281844T>C IGSF1(NM_001170961.1):c.1347A>G (p.E449=) - IGSF1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.1546G>A r.(?) p.(Val516Ile) - likely benign g.130415292C>T g.131281318C>T IGSF1(NM_001170961.1):c.1546G>A (p.V516I) - IGSF1_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.1558G>A r.(?) p.(Ala520Thr) - likely benign g.130415280C>T g.131281306C>T IGSF1(NM_001170961.1):c.1558G>A (p.(Ala520Thr)) - IGSF1_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.1581G>A r.(?) p.(Met527Ile) - likely benign g.130415257C>T g.131281283C>T IGSF1(NM_001170961.1):c.1581G>A (p.M527I) - IGSF1_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1631G>A r.(?) p.(Arg544Gln) - likely benign g.130415207C>T g.131281233C>T IGSF1(NM_001170961.1):c.1631G>A (p.R544Q) - IGSF1_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.1646+11dup r.(=) p.(=) - benign g.130415182dup g.131281208dup IGSF1(NM_001170961.1):c.1646+11dupT - IGSF1_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.1697T>C r.(?) p.(Val566Ala) - VUS g.130413265A>G g.131279291A>G IGSF1(NM_001170961.1):c.1697T>C (p.V566A) - IGSF1_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1765+18C>T r.(=) p.(=) - benign g.130413099G>A g.131279125G>A IGSF1(NM_001170961.1):c.1765+18C>T - IGSF1_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.1770A>G r.(?) p.(Ile590Met) - VUS g.130412721T>C - IGSF1(NM_001170961.1):c.1770A>G (p.I590M) - IGSF1_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1811A>C r.(?) p.(Asn604Thr) - benign g.130412680T>G g.131278706T>G IGSF1(NM_001170961.1):c.1811A>C (p.N604T, p.(Asn604Thr)) - IGSF1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.1811A>C r.(?) p.(Asn604Thr) - likely benign g.130412680T>G g.131278706T>G IGSF1(NM_001170961.1):c.1811A>C (p.N604T, p.(Asn604Thr)) - IGSF1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.1827G>A r.(?) p.(Pro609=) - likely benign g.130412664C>T - IGSF1(NM_001170961.1):c.1827G>A (p.P609=) - IGSF1_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. ? c.1933C>T r.(?) p.(Gln645*) - VUS g.130412558G>A g.131278584G>A c.1933c->T - IGSF1_000021 - PubMed: Nakamura, Akie - - Unknown - - - 0 - Yu Sun
+/. 12 c.1933C>T r.(?) p.(Gln645*) - pathogenic g.130412558G>A g.131278584G>A c.1933c->T - IGSF1_000021 - PubMed: Nakamura, Akie - - Germline - - - 0 - Yu Sun
?/. - c.1940G>A r.(?) p.(Arg647Gln) - VUS g.130412551C>T - IGSF1(NM_001170961.1):c.1940G>A (p.R647Q) - IGSF1_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.1981G>A r.(?) p.(Gly661Arg) - pathogenic g.130412510C>T g.131278536C>T IGSF1(NM_001170961.1):c.1981G>A (p.G661R) - IGSF1_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
+/. - c.1981G>A r.(?) p.(Gly661Arg) - pathogenic g.130412510C>T g.131278536C>T IGSF1(NM_001170961.1):c.1981G>A (p.G661R) - IGSF1_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.2013G>A r.(?) p.(Met671Ile) - VUS g.130412478C>T g.131278504C>T IGSF1(NM_001170961.1):c.2013G>A (p.M671I) - IGSF1_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 12i c.2056+24G>A r.(?) p.(=) - benign g.130412411C>T g.131278437C>T - - IGSF1_000031 - - - - Germline - - - 0 - Yu Sun
-/. 12i c.2056+24G>A r.(?) p.(=) - benign g.130412411C>T g.131278437C>T - - IGSF1_000031 - - - - Germline - - - 0 - Yu Sun
-?/. 12i c.2057-70G>C r.(?) p.(=) - benign g.130412178C>G g.131278204C>G - - IGSF1_000030 - - - - Germline - - - 0 - Yu Sun
-/. 12i c.2057-70G>C r.(?) p.(=) - benign g.130412178C>G g.131278204C>G - - IGSF1_000030 - - - - Germline - - - 0 - Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - PubMed: Sun 2011, Journal: Sun 2011, OMIM:var0001 - - Germline yes 1/11 families - 0 - Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - PubMed: Sun 2011, Journal: Sun 2011, OMIM:var0001 - - Germline yes 1/11 families - 0 - Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - Yu Sun
+/+ 13 c.2138_2164del r.(?) p.(Ala713_Lys721del) - pathogenic g.130412003_130412029del g.131278029_131278055del 2137_2163del - IGSF1_000010 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 1/11 families - 0 - Yu Sun
+/. - c.2138_2164del r.(?) p.(Ala713_Lys721del) - pathogenic g.130412003_130412029del g.131278029_131278055del IGSF1(NM_001170961.1):c.2138_2164delCAGGCATGGGGTTTGCTCTGTATAAGG (p.A713_K721del) - IGSF1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2139del r.(?) p.(Gly714Alafs*64) - VUS g.130412026del g.131278052del - - IGSF1_000049 - - - - Germline - - - - - Yu Sun
?/. - c.2139del r.(?) p.(Gly714Alafs*64) - VUS g.130412026del g.131278052del - - IGSF1_000049 - - - - Germline - - - - - Yu Sun
-/. - c.2147G>C r.(?) p.(Gly716Ala) - benign g.130412018C>G g.131278044C>G IGSF1(NM_001170961.1):c.2147G>C (p.G716A, p.(Gly716Ala)) - IGSF1_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.2147G>C r.(?) p.(Gly716Ala) - likely benign g.130412018C>G g.131278044C>G IGSF1(NM_001170961.1):c.2147G>C (p.G716A, p.(Gly716Ala)) - IGSF1_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. - c.2151del r.(?) p.(Phe717LeufsTer61) - pathogenic g.130412016del g.131278042del IGSF1(NM_001170961.1):c.2151delT (p.F717Lfs*61) - IGSF1_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/+ 13 c.2248del r.(?) p.(Glu750LysfsX28) - pathogenic g.130411917del g.131277943del - - IGSF1_000012 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 2/11 families - 0 - Yu Sun
+/+ 13 c.2248del r.(?) p.(Glu750LysfsX28) - pathogenic g.130411917del g.131277943del - - IGSF1_000012 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 2/11 families - 0 - Yu Sun
+/+ 13 c.2248del r.(?) p.(Glu750LysfsX28) - pathogenic g.130411917del g.131277943del - - IGSF1_000012 - {DOI10.1038/ng.2453:Sun 2012} - - Germline - 2/11 families - 0 - Yu Sun
Legend   How to query   « First ‹ Prev     1 2     Next › Last »