Unique variants in gene PQBP1

Information The variants shown are described using the NM_001032383.1 transcript reference sequence.

33 entries on 1 page. Showing entries 1 - 33.
Legend  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.-3023G>A likely benign r.(?) p.(=) g.48752372G>A - TIMM17B(NM_001167947.1):c.289C>T (p.(Arg97Trp)) - TIMM17B_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-2691C>A likely benign r.(?) p.(=) g.48752704C>A - TIMM17B(NM_001167947.2):c.207G>T (p.E69D) - TIMM17B_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-19+4G>A likely benign r.spl? p.? g.48755380G>A - PQBP1(NM_001032383.1):c.-19+4G>A - TIMM17B_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.19C>G - r.(?) p.(Leu7Val) g.48755811C>G - - - PQBP1_000016 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - - - Lucy Raymond
?/. 1 - c.67+204_67+208del - - p.(=) g.48756063_48756067del g.48898780_48898784del - - PQBP1_000009 - - - - Germline - - - - - Yu Sun
?/. 2 - c.179+182_179+183del - - p.(=) g.48758760_48758761del g.48901483_48901484del - - PQBP1_000010 - - - - Germline - - - - - Yu Sun
?/. 2 - c.179+188_179+189del - - p.(=) g.48758766_48758767del g.48901489_48901490del - - PQBP1_000004 - - - - Germline - - - - - Yu Sun
-/., ?/. 3 - c.180-3C>T benign r.spl? p.?, p.(=) g.48759204C>T g.48901927C>T PQBP1(NM_005710.2):c.180-3C>T - PQBP1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - VKGL-NL, Yu Sun
-?/. 1 - c.250G>A likely benign r.(?) p.(Val84Met) g.48759277G>A - PQBP1(NM_005710.2):c.250G>A (p.V84M) - PQBP1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.334_354del - r.(?) p.(Gly113_Arg119del) g.48759551_48759571del - 334_354delAGGGGCCATGACAAGTCGGAC - PQBP1_000017 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - - - Lucy Raymond
-?/. 1 - c.341A>G likely benign r.(?) p.(His114Arg) g.48759558A>G - PQBP1(NM_005710.2):c.341A>G (p.H114R) - TIMM17B_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.430C>T VUS r.(?) p.(Arg144Cys) g.48759647C>T - PQBP1(NM_005710.2):c.430C>T (p.R144C) - TIMM17B_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
./. 1 - c.450_454delinsC - r.(?) p.(Arg153Serfs*40) g.48759667_48759671delCAGAGinsC g.48902390_48902394delinsC - - PQBP1_000011 - PubMed: DDDS 2015, Journal: DDDS 2015 - - Germline - - - - - Johan den Dunnen
+/. 1 5 c.459_462del ACMG: 5 r.(?) p.(Arg153Serfs*41) g.48759676_48759679del - 459_462delAGAG - PQBP1_000015 - PubMed: TumienÄ— 2018 - - Germline - - - - - Johan den Dunnen
-?/. 2 - c.585C>T likely benign r.(?) p.(=) g.48760016C>T - PQBP1(NM_005710.2):c.585C>T (p.S195=) - TIMM17B_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Rotterdam
+/., ./. 2 - c.586C>T pathogenic r.(?) p.(Arg196*) g.48760017C>T - PQBP1(NM_005710.2):c.586C>T (p.R196*), PQBP1 R196* - PQBP1_000018 VKGL data sharing initiative Nederland PubMed: Hu 2016 - - CLASSIFICATION record, Germline - - - - - VKGL-NL, Johan den Dunnen
./. 1 - c.719del - r.(?) p.(Phe240Serfs*36) g.48760282del - PQBP1 F240Sfs*26 - PQBP1_000019 - PubMed: Hu 2016 - - Germline yes - - - - Johan den Dunnen
-?/. 1 - c.732G>A likely benign r.(?) p.(=) g.48760295G>A - PQBP1(NM_005710.2):c.732G>A (p.P244=) - TIMM17B_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.*1628C>T likely benign r.(=) p.(=) g.48761989C>T - SLC35A2(NM_001032289.2):c.607G>A (p.G203R) - TIMM17B_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.*1763G>A likely benign r.(=) p.(=) g.48762124G>A - SLC35A2(NM_001032289.2):c.472C>T (p.R158C) - TIMM17B_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.*1818T>C VUS r.(=) p.(=) g.48762179T>C - SLC35A2(NM_001282651.1):c.1091A>G (p.Y364C) - SLC35A2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.*1884C>A VUS r.(=) p.(=) g.48762245C>A - SLC35A2(NM_001282651.1):c.1025G>T (p.R342L) - SLC35A2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.*1981C>T likely pathogenic r.(=) p.(=) g.48762342C>T - - - SLC35A2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.*1997G>A likely benign r.(=) p.(=) g.48762358G>A - SLC35A2(NM_001282651.1):c.912C>T (p.L304=) - TIMM17B_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.*2007C>T pathogenic r.(=) p.(=) g.48762368C>T - SLC35A2(NM_001042498.3):c.818G>A (p.G273D) - SLC35A2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.*2073del pathogenic r.(?) p.(=) g.48762434del - SLC35A2(NM_001042498.2):c.753delG (p.W251Cfs*98) - SLC35A2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.*2194G>C VUS r.(=) p.(=) g.48762555G>C - - - TIMM17B_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.*2209C>T VUS r.(=) p.(=) g.48762570C>T - - - SLC35A2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.*2210G>A likely benign r.(=) p.(=) g.48762571G>A - SLC35A2(NM_001282651.1):c.699C>T (p.A233=) - SLC35A2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.*2317C>G VUS r.(=) p.(=) g.48762678C>G - - - SLC35A2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.*2328C>T VUS r.(=) p.(=) g.48762689C>T - SLC35A2(NM_001282651.1):c.581G>A (p.R194Q) - SLC35A2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.*3384A>G likely benign r.(=) p.(=) g.48763745A>G - - - SLC35A2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.*3464G>A likely benign r.(=) p.(=) g.48763825G>A - SLC35A2(NM_001282651.2):c.359-5C>T - SLC35A2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
Legend