Unique variants in the PQBP1 gene

Information The variants shown are described using the NM_001032383.1 transcript reference sequence.

40 entries on 1 page. Showing entries 1 - 40.
Legend  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.-3023G>A r.(?) p.(=) - likely benign g.48752372G>A g.48895089G>A TIMM17B(NM_001167947.1):c.289C>T (p.(Arg97Trp)) - TIMM17B_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-2691C>A r.(?) p.(=) - likely benign g.48752704C>A g.48895421C>A TIMM17B(NM_001167947.2):c.207G>T (p.E69D) - TIMM17B_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-19+4G>A r.spl? p.? - likely benign g.48755380G>A g.48898097G>A PQBP1(NM_001032383.1):c.-19+4G>A - TIMM17B_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.19C>G r.(?) p.(Leu7Val) - VUS g.48755811C>G g.48898528C>G - - PQBP1_000016 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - - - Lucy Raymond
?/. 1 - c.67+204_67+208del r.(=) p.(=) - VUS g.48756063_48756067del g.48898780_48898784del - - PQBP1_000009 - - - - Germline - - - - - Yu Sun
?/. 1 - c.82A>G r.(?) p.(Ile28Val) - VUS g.48758481A>G - PQBP1(NM_005710.2):c.82A>G (p.I28V) - TIMM17B_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 2 - c.179+182_179+183del r.(=) p.(=) - VUS g.48758760_48758761del g.48901483_48901484del - - PQBP1_000010 - - - - Germline - - - - - Yu Sun
?/. 2 - c.179+188_179+189del r.(=) p.(=) - VUS g.48758766_48758767del g.48901489_48901490del - - PQBP1_000004 - - - - Germline - - - - - Yu Sun
-/., ?/. 3 - c.180-3C>T r.spl? p.?, p.(=) - benign, VUS g.48759204C>T g.48901927C>T PQBP1(NM_005710.2):c.180-3C>T - PQBP1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Groningen, Yu Sun
-?/. 1 - c.180C>T r.(?) p.(Cys60=) - likely benign g.48759207C>T g.48901930C>T PQBP1(NM_005710.2):c.180C>T (p.C60=) - TIMM17B_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.250G>A r.(?) p.(Val84Met) - likely benign g.48759277G>A g.48902000G>A PQBP1(NM_005710.2):c.250G>A (p.V84M) - PQBP1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/. 1 - c.292+1G>A r.spl p.? - likely pathogenic g.48759320G>A g.48902043G>A - - PQBP1_000021 - PubMed: Grozeva 2015, Journal: Grozeva 2015 - - Germline/De novo (untested) - - - - - Johan den Dunnen
?/. 1 - c.334_354del r.(?) p.(Gly113_Arg119del) - VUS g.48759551_48759571del g.48902274_48902294del 334_354delAGGGGCCATGACAAGTCGGAC - PQBP1_000017 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - - - Lucy Raymond
-?/. 1 - c.341A>G r.(?) p.(His114Arg) - likely benign g.48759558A>G g.48902281A>G PQBP1(NM_005710.2):c.341A>G (p.H114R) - TIMM17B_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.397C>T r.(?) p.(Arg133Trp) - likely benign g.48759614C>T g.48902337C>T PQBP1(NM_001032381.1):c.397C>T (p.(Arg133Trp)) - PQBP1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.430C>T r.(?) p.(Arg144Cys) - VUS g.48759647C>T g.48902370C>T PQBP1(NM_005710.2):c.430C>T (p.R144C) - TIMM17B_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/., +/., ./. 3 5 c.459_462del r.(?) p.(Arg153Serfs*41), p.(Arg153SerfsTer41) ACMG likely pathogenic, pathogenic g.48759676_48759679del g.48902399_48902402del 459_462delAGAG - PQBP1_000011, PQBP1_000015 - PubMed: Grozeva 2015, Journal: Grozeva 2015, PubMed: TumienÄ— 2018, 1 more item - - Germline/De novo (untested), Germline - - - - - Johan den Dunnen
-?/. 2 - c.585C>T r.(?) p.(Ser195=) - likely benign g.48760016C>T g.48902739C>T PQBP1(NM_005710.2):c.585C>T (p.S195=) - TIMM17B_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Rotterdam
+/., ./. 2 - c.586C>T r.(?) p.(Arg196Ter), p.(Arg196*) - pathogenic g.48760017C>T g.48902740C>T PQBP1(NM_005710.2):c.586C>T (p.R196*), PQBP1 R196* - PQBP1_000018 VKGL data sharing initiative Nederland PubMed: Hu 2016 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Rotterdam, Johan den Dunnen
./. 1 - c.719del r.(?) p.(Phe240Serfs*36) - pathogenic g.48760282del g.48903005del PQBP1 F240Sfs*26 - PQBP1_000019 - PubMed: Hu 2016 - - Germline yes - - - - Johan den Dunnen
+?/. 1 - c.731C>T r.(?) p.(Pro244Leu) - pathogenic (recessive) g.48760294C>T g.48903017C>T - - PQBP1_000020 - PubMed: Redin 2014 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.732G>A r.(?) p.(Pro244=) - likely benign g.48760295G>A g.48903018G>A PQBP1(NM_005710.2):c.732G>A (p.P244=) - TIMM17B_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.*275A>G r.(=) p.(=) - likely benign g.48760636A>G g.48903359A>G SLC35A2(NM_005660.2):c.*79T>C - TIMM17B_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.*1628C>T r.(=) p.(=) - likely benign g.48761989C>T g.48904712C>T SLC35A2(NM_001032289.2):c.607G>A (p.G203R) - TIMM17B_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*1696G>A r.(=) p.(=) - likely benign g.48762057G>A g.48904780G>A SLC35A2(NM_001032289.1):c.539C>T (p.(Pro180Leu)) - SLC35A2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.*1763G>A r.(=) p.(=) - likely benign g.48762124G>A g.48904847G>A SLC35A2(NM_001032289.2):c.472C>T (p.R158C) - TIMM17B_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*1786C>T r.(=) p.(=) - likely benign g.48762147C>T - SLC35A2(NM_001282651.1):c.1123G>A (p.A375T) - TIMM17B_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.*1818T>C r.(=) p.(=) - VUS g.48762179T>C g.48904902T>C SLC35A2(NM_001282651.1):c.1091A>G (p.Y364C) - SLC35A2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*1884C>A r.(=) p.(=) - VUS g.48762245C>A g.48904968C>A SLC35A2(NM_001282651.1):c.1025G>T (p.R342L) - SLC35A2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.*1981C>T r.(=) p.(=) - likely pathogenic g.48762342C>T g.48905065C>T - - SLC35A2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.*1997G>A r.(=) p.(=) - likely benign g.48762358G>A g.48905081G>A SLC35A2(NM_001282651.1):c.912C>T (p.L304=) - TIMM17B_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.*2007C>T r.(=) p.(=) - pathogenic g.48762368C>T g.48905091C>T SLC35A2(NM_001042498.3):c.818G>A (p.G273D) - SLC35A2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/. 1 - c.*2073del r.(?) p.(=) - pathogenic g.48762434del g.48905157del SLC35A2(NM_001042498.2):c.753delG (p.W251Cfs*98) - SLC35A2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*2194G>C r.(=) p.(=) - VUS g.48762555G>C g.48905278G>C - - TIMM17B_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.*2209C>T r.(=) p.(=) - VUS g.48762570C>T g.48905293C>T - - SLC35A2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.*2210G>A r.(=) p.(=) - likely benign g.48762571G>A g.48905294G>A SLC35A2(NM_001282651.1):c.699C>T (p.A233=) - SLC35A2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*2317C>G r.(=) p.(=) - VUS g.48762678C>G g.48905401C>G - - SLC35A2_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.*2328C>T r.(=) p.(=) - VUS g.48762689C>T g.48905412C>T SLC35A2(NM_001282651.1):c.581G>A (p.R194Q) - SLC35A2_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*3384A>G r.(=) p.(=) - likely benign g.48763745A>G g.48906468A>G - - SLC35A2_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.*3464G>A r.(=) p.(=) - likely benign g.48763825G>A g.48906548G>A SLC35A2(NM_001282651.2):c.359-5C>T - SLC35A2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
Legend