Full data view for gene PQBP1

Information The variants shown are described using the NM_001032383.1 transcript reference sequence.

19 entries on 1 page. Showing entries 1 - 19.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

Allele     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age/Death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/. - c.-19+4G>A likely benign r.spl? p.? Unknown g.48755380G>A - PQBP1:c.-19+4G>A - TIMM17B_000003 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.19C>G - r.(?) p.(Leu7Val) Parent #1 g.48755811C>G - - - PQBP1_000016 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
?/. - c.67+204_67+208del - - p.(=) Unknown g.48756063_48756067del g.48898780_48898784del - - PQBP1_000009 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.179+182_179+183del - - p.(=) Maternal (inferred) g.48758760_48758761del g.48901483_48901484del - - PQBP1_000010 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.179+182_179+183del - - p.(=) Maternal (inferred) g.48758760_48758761del g.48901483_48901484del - - PQBP1_000010 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.179+188_179+189del - - p.(=) Maternal (inferred) g.48758766_48758767del g.48901489_48901490del - - PQBP1_000004 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.179+188_179+189del - - p.(=) Maternal (inferred) g.48758766_48758767del g.48901489_48901490del - - PQBP1_000004 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.180-3C>T - - p.(=) Maternal (inferred) g.48759204C>T g.48901927C>T - - PQBP1_000006 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.180-3C>T - - p.(=) Maternal (inferred) g.48759204C>T g.48901927C>T - - PQBP1_000006 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-/. - c.180-3C>T benign r.spl? p.? Unknown g.48759204C>T - PQBP1:c.180-3C>T - PQBP1_000006 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.250G>A likely benign r.(?) p.(Val84Met) Unknown g.48759277G>A - PQBP1:c.250G>A (V84M) - PQBP1_000012 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.334_354del - r.(?) p.(Gly113_Arg119del) Parent #1 g.48759551_48759571del - 334_354delAGGGGCCATGACAAGTCGGAC - PQBP1_000017 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
-?/. - c.397C>T likely benign - - Unknown g.48759614C>T - TIMM17B:NM_001032289.1:c.*2253G>A, NM_001032381.1:c.397C>T, … - PQBP1_000013 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.450_453del pathogenic r.(?) p.(Asp150Glufs*44) Unknown g.48759667_48759670del - PQBP1:NM_005710.2:c.450_453del (Asp150fs) - PQBP1_000014 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
./. - c.450_454delinsC - r.(?) p.(Arg153Serfs*40) Maternal (confirmed) g.48759667_48759671delCAGAGinsC g.48902390_48902394delinsC - - PQBP1_000011 - PubMed: DDDS 2015, Journal: DDDS 2015 - - Germline - - - 0 - DNA SEQ, SEQ-NG-I - - ? - PubMed: DDDS 2015, Journal: DDDS 2015 family, affected and affected2nd degree relatives M - United Kingdom (Great Britain) - - 0 Decipher - 1 Johan den Dunnen
+/. - c.459_462del pathogenic r.(?) p.(Arg153Serfs*41) Unknown g.48759676_48759679del - PQBP1:NM_005710.2:c.459_462del (Arg153fs) - PQBP1_000015 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. 5 c.459_462del ACMG: 5 r.(?) p.(Arg153Serfs*41) Parent #1 g.48759676_48759679del - 459_462delAGAG - PQBP1_000015 - PubMed: Tumienė 2018 - - Germline - - - 0 - DNA SEQ-NG - WES ? 29286531-Pat13 PubMed: Tumienė 2018 - - - (Slovenia) - - 0 - - 1 Johan den Dunnen
./. - c.586C>T - r.(?) p.(Arg196*) Maternal (inferred) g.48760017C>T - PQBP1 R196* - PQBP1_000018 - PubMed: Hu 2016 - - Germline - - - 0 - DNA SEQ, SEQ-NG - WES-X chromosome MRX;IDX 25644381-FamAU72 PubMed: Hu 2016 family, 1 affected, 1 unaffected heterozygous carrier female M - - - - 0 - - 1 Johan den Dunnen
./. - c.719del - r.(?) p.(Phe240Serfs*36) Maternal (confirmed) g.48760282del - PQBP1 F240Sfs*26 - PQBP1_000019 - PubMed: Hu 2016 - - Germline yes - - 0 - DNA SEQ, SEQ-NG - WES-X chromosome MRX;IDX 25644381-FamP57 PubMed: Hu 2016 family, 5 affected, 3 unaffected heterozygous carrier females M - - - - 0 - - 5 Johan den Dunnen
Legend