All variants in the RMRP gene

Information The variants shown are described using the NR_003051.3 transcript reference sequence.

137 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+?/+? - n.*6T>C r.*6u>c - - likely pathogenic g.35657742A>G g.35657745A>G *5T>C - RMRP_000017 1 CHH family (com-het) with undetermined ethnicity Variant Error [EREF/0]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message. PubMed: Kavadas et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-10_-4delCTGAGGAins28 r.? - - likely pathogenic g.35658019_35658025delins28 - -11_-5delCTGAGGAins28bp - RMRP_000024 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+/+ - n.-10_-9insTACTCTGTGAAGTACTCTGTGAAGCTGA r.0 - - pathogenic g.35658024_35658025insTCAGCTTCACAGAGTACTTCACAGAGTA g.35658027_35658028insTCAGCTTCACAGAGTACTTCACAGAGTA insertion TACTCTGTGAAGTACTCTGTGAAGCTGA at -10 (including 2 times duplication) - RMRP_000003 1 CHH patient PubMed: Roifman et al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+/+ - n.-13_-12insATCTGTG r.0 - - pathogenic g.35658027_35658028insCACAGAT g.35658030_35658031insCACAGAT insertion ATCTGTG at -13 - RMRP_000013 1 CHH patient with undetermined ethnicity (com-het) PubMed: Roifman et al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-13_-2dupAAGCTGAGGACG r.? - - likely pathogenic g.35658018_35658029dup g.35658021_35658032dup dup(aagctgaggacg) at -2; g.-14_-3dupAAGCTGAGGACG - RMRP_000028 1 Swiss and 1 Swiss-Danish CHH family (both com-het) PubMed: Bonafe et al. 2002, PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/60 CON - - - Anne Polvi
+?/+? - n.-13_-6dupAAGCTGAG r.? - - likely pathogenic g.35658022_35658029dup g.35658025_35658032dup dup AAGCTGAG at -6 - RMRP_000020 1 Mexican CHH family (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-13_1dupAAGCTGAGGACGTG r.? - - likely pathogenic g.35658018_35658031dup g.35658021_35658034dup dup AAGCTGAGGACGTG at 1 - RMRP_000036 1 American CHH family (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.-14_3dupGAAGCTGAGGACGTGGT r.? - - likely pathogenic g.35658015_35658031dup g.35658018_35658034dup 17-bp duplication (GAAGCTGAGGACGTGGT) at +3; 17-bp dup at +3 - RMRP_000039 6 Japanese CHH families (com-het) PubMed: Nakashima et al. 2003, PubMed: Hirose et al. 2006 - - SUMMARY record yes 0/65 JAP CON - - - Anne Polvi
+?/+? - n.-15_-6dupTGAAGCTGAG r.? - - likely pathogenic g.35658022_35658031dup g.35658025_35658034dup dup TGAAGCTGAG at -6 - RMRP_000032 1 French CHH family (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-15_1dupTGAAGCTGAGGACGTG r.? - - likely pathogenic g.35658017_35658032dup g.35658020_35658035dup 16-bp dup at +1 - RMRP_000035 1 Japanese CHH family (com-het) PubMed: Hirose et al. 2006 - - SUMMARY record yes 0/65 JAP CON - - - Anne Polvi
+?/+? - n.-18_-17insCTCACTACTC r.? - - likely pathogenic g.35658039_35658040insGAGGAGTAGT g.35658042_35658043insGAGGAGTAGT M29916.1: g.726_727insCTCACTACTC - RMRP_000103 1 patient with CHH (com-het); 10-nucleotide insertion at position -18 in the promoter region of the RMRP gene PubMed: Crahes et al. 2013 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-19_-13dupTCTGTGA r.? - - likely pathogenic g.35658028_35658034dup g.35658031_35658037dup dup TCTGTGA at -13; g.-20_-14dupTCTGTGA; -14_-20dupTCTGTGA; -20-14dup - RMRP_000011 2 American CHH families, 1 American CHH patient and 1 CHH family with undetermined ethnicity (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006, PubMed: Kavadas et al. 2008 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.-19_-3dupTCTGTGAAGCTGAGGAC r.? - - likely pathogenic g.35658020_35658036dup g.35658023_35658039dup dupTCTGTGAAGCTGAGGAC at g.-3; -20_-4dupTCTGTGAAGCTGAGGAC - RMRP_000026 1 English and 1 Swiss CHH family (both com-het) PubMed: Ridanpää et al. 2001, PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.-20_-13CTCTGTGA[3] r.? - - likely pathogenic g.35658028_35658035[3] - -21_-14trip - RMRP_000021 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+/+ - n.-20_-19insTCTGTGAAGCTGGGGAC r.0 - - pathogenic g.35658036_35658037insCCCCAGCTTCACAGAGT g.35658039_35658040insCCCCAGCTTCACAGAGT n.-21_-20insTCTGTGAAGCTGGGGAC - RMRP_000001 2 Japanese CHH families (com-het) PubMed: Nakashima et al. 2003, PubMed: Hirose et al. 2006 - - SUMMARY record yes 0/65 JAP CON - - - Anne Polvi
+?/+? - n.-20_1dupCTCTGTGAAGCTGAGGACGTG r.? - - likely pathogenic g.35658015_35658035dup g.35658018_35658038dup -1_-21dupCTCTGTGAAGCTGAGGACGTG - RMRP_000034 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-21_-9dupACTCTGTGAAGCT r.? - - VUS g.35658026_35658038dup g.35658029_35658041dup g.-22_-10dupACTCTGTGAAGCT - RMRP_000015 1 French CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.-22-6dupTACTCTGTGAAGCTGAG r.? - - likely pathogenic g.35658021_35658037dup g.35658024_35658040dup -23-8dupTACTCTGTGAAGCTGAG - RMRP_000016 1 CHH patient (com-het) with undetermined ethnicity PubMed: Fuente et al. 2011 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-22_-13dupTACTCTGTGA r.? - - likely pathogenic g.35658028_35658037dup g.35658031_35658040dup dupTACTCTGTGA at -13; g.-23_-14dupTACTCTGTGA - RMRP_000004 2 Finnish CHH families (com-het) and 1 French CHH family (com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.-22_-14dupTACTCTGTG r.? - - likely pathogenic g.35658029_35658037dup g.35658032_35658040dup g.-23_-15dupTACTCTGTG - RMRP_000010 1 French CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.-22_-3dupTACTCTGTGAAGCTGAGGAC r.? - - likely pathogenic g.35658020_35658039dup g.35658023_35658042dup 20 bp duplication (TACTCTGTGAAGCTGAGGAC) at nt -3; n.-4_-23dupTACTCTGTGAAGCTGAGGAC - RMRP_000025 1 Japanese CHH family and 1 German CHH patient (all com-het) PubMed: Harada et al. 2005, PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-23_-14dupCTACTCTGTG r.? - - likely pathogenic g.35658029_35658038dup g.35658032_35658041dup -15_-24dupCTACTCTGTG - RMRP_000009 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+/+ - n.-24_-10ACTACTCTGTGAAGC[3] r.0 - - pathogenic g.35658025_35658039[3] - Two times dupACTACTCTGTGAAGC at -10 - RMRP_000030 1 Swiss CHH family (com-het) PubMed: Ridanpää et al. 2001, PubMed: Ridanpää et al. 2002 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-24_-10dupACTACTCTGTGAAGC r.? - - likely pathogenic g.35658025_35658039dup g.35658028_35658042dup g.-25_-11 dupACTACTCTGTGAAGC; -25_-11dup; -11_-25dupACTACTCTGTGAAGC - RMRP_000014 1 German and 1 Spanish CHH patient and 1 CHH family with undetermined ethnicity (all com-het) PubMed: Hermanns el al. 2006, PubMed: Munoz-Robles et al. 2006, PubMed: Kavadas et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-24_-12dup r.? - - likely pathogenic g.35658027_35658039dup g.35658030_35658042dup -25_-13dup - RMRP_000012 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-24_-18dupACTACTC r.? - - likely pathogenic g.35658033_35658039dup g.35658036_35658042dup g.-19_-25 dupACTACTC - RMRP_000002 1 Thai CHH patient (hom) PubMed: Vatanavicharn et al. 2010 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-24_-4dupACTACTCTGTGAAGCTGAGGA r.? - - likely pathogenic g.35658019_35658039dup g.35658022_35658042dup g.-25_-5dupACTACTCTGTGAAGCTGAGGA; -25_-5dup; 6_-25dupACTACTCTGTGAAGCTGAGA - RMRP_000023 1 German CHH family and 2 Belgian siblings, 1 CHH family with undetermined ethnicity (all com-het) PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006, PubMed: Kavadas et al. 2008 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.-24_-9ACTACTCTGTGAAGCT[3] r.? - - likely pathogenic g.35658024_35658039[3] - g.-25_-10tripACTACTCTGTGAAGCT - RMRP_000031 1 Italian CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.-25_-4dupTACTACTCTGTGAAGCTGAGGA r.? - - likely pathogenic g.35658020_35658041dup g.35658023_35658044dup -5_-26dupTACTACTCTGTGAAGCTGAGAA - RMRP_000022 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-3_1dupCGTG r.? - - likely pathogenic g.35658015_35658018dup g.35658018_35658021dup -4_-1dup - RMRP_000038 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.-4_-3insGGACGTGGTT r.? - - likely pathogenic g.35658018_35658019insAACCACGTCC g.35658021_35658022insAACCACGTCC ins GGACGTGGTT at -4 - RMRP_000027 1 French CHH family (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+/+ - n.-6_-5insCCTGAG r.0 - - pathogenic g.35658025_35658026insGCTCAG g.35658028_35658029insGCTCAG insCCTGAG at -6 - RMRP_000033 1 German CHH family (com-het) PubMed: Ridanpää et al. 2001, PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.-6_4dupGGACGTGGTT r.? - - likely pathogenic g.35658012_35658021dup g.35658015_35658024dup dup GGACGTGGTT at 4 - RMRP_000040 1 Brazilian CHH family (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.-7_1dupAGGACGTG r.? - - likely pathogenic g.35658017_35658024dup g.35658020_35658027dup g.-8_-1dupAGGACGTG - RMRP_000037 1 Canadian CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.-8_-1dupGAGGACGT r.? - - likely pathogenic g.35658017_35658024dup g.35658020_35658027dup -9_-2dup - RMRP_000029 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.5C>T r.5c>u - - likely pathogenic g.35658011G>A g.35658014G>A 4T; g.4C>T; 4C>T - RMRP_000018 1 Australian, 1 Dutch, 1 English, 1 German, 1 Spanish, 1 Swiss and 1 Italian CHH family, 1 German CHH patient and 2 CHH patients and 1 CHH family with undetermined ethnicity (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe 2005, PubMed: Roifman 2006, PubMed: Hermanns 2006, PubMed: Munoz-Robles 2006 and PubMed: Kavadas 2008, PubMed: Bacchetta 2009 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.10T>C r.10u>c - - likely pathogenic g.35658006A>G g.35658009A>G 9T>C - RMRP_000019 1 German CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
?/? - n.12A>G r.12a>g - - VUS g.35658004T>C g.35658007T>C g.11A>G reported previously as polymorphisms - RMRP_000041 - PubMed: Kwan et al. 2012 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.15G>T r.15g>u - - likely pathogenic g.35658001C>A g.35658004C>A 14G>T - RMRP_000042 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.19G>C r.19g>c - - likely pathogenic g.35657997C>G g.35658000C>G g.G18>C - RMRP_000043 1 CHH patient (com-het) with undetermined ethnicity PubMed: Fuente et al. 2011 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.28G>A r.28g>a - - likely pathogenic g.35657988C>T g.35657991C>T g.G27>A - RMRP_000044 1 CHH patient (hom) with undetermined ethnicity PubMed: Fuente et al. 2011 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.36C>T r.36c>u - - likely pathogenic g.35657980G>A g.35657983G>A g.35C>T - RMRP_000045 1 French CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.41G>A r.41g>a - - likely pathogenic g.35657975C>T g.35657978C>T g.40G>A - RMRP_000046 1 Dutch CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.46_54dupTGTTCCTCC r.46_54dupuguuccucc - - likely pathogenic g.35657962_35657970dup g.35657965_35657973dupGGAGGAACA g.45_53dupTGTTCCTCC - RMRP_000047 1 Dutch CHH family (com-het) Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
?/. - n.47G>A r.(?) - - VUS g.35657969C>T g.35657972C>T RMRP(NR_003051.3):n.47G>A - CA9_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - n.54C>T r.(?) - - likely benign g.35657962G>A g.35657965G>A RMRP(NR_003051.3):n.54C>T - CA9_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - n.54C>T r.(?) - - likely benign g.35657962G>A - RMRP(NR_003051.3):n.54C>T - CA9_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - n.54C>T r.(?) - - likely benign g.35657962G>A - RMRP(NR_003051.3):n.54C>T - CA9_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/+? - n.57_58insTTCCGCCT r.57_58insuuccgccu - - likely pathogenic g.35657958_35657959insAGGCGGAA g.35657961_35657962insAGGCGGAA ins TTCCGCCT at 57 - RMRP_000048 1 French CHH family (com-het) Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
?/. - n.58_59insA r.(?) - - VUS g.35657957_35657958insT g.35657960_35657961insT RMRP(NR_003051.3):n.58_59insA - CA9_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/+? - n.62G>A r.62g>a - - likely pathogenic g.35657954C>T g.35657957C>T g.G61>A - RMRP_000049 1 CHH patient (com-het) with undetermined ethnicity PubMed: Fuente et al. 2011 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.64C>T r.64c>u - - likely pathogenic g.35657952G>A g.35657955G>A 63T; g.63C>T - RMRP_000050 4 Dutch and 2 Australian CHH families, 1 French and 1 Caucasian-Afrikan-American CHH family (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Kuijpers et al. 2003 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+/. - n.64C>T r.(?) - - pathogenic g.35657952G>A g.35657955G>A RMRP(NR_003051.3):n.64C>T - RMRP_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - n.64C>T r.(?) - - pathogenic g.35657952G>A g.35657955G>A RMRP(NR_003051.3):n.64C>T - RMRP_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/+? - n.65T>C r.65u>c - - likely pathogenic g.35657951A>G g.35657954A>G g.64T>C - RMRP_000051 1 Italian CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
?/. - n.69G>T r.(?) - - VUS g.35657947C>A g.35657950C>A RMRP(NR_003051.3):n.69G>T - CA9_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/+? - n.69_70delinsTT r.69_70delinsuu - - likely pathogenic g.35657946_35657947delinsAA g.35657949_35657950delinsAA g.68_69delinsTT - RMRP_000052 1 CHH patient (com-het) with undetermined ethnicity PubMed: Horn et al. 2010 - - SUMMARY record yes - - - - Anne Polvi
?/. - n.70G>T r.(?) - - VUS g.35657946C>A g.35657949C>A RMRP(NR_003051.3):n.70G>T - CA9_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+ - n.71A>G r.71a>g - - pathogenic g.35657945T>C g.35657948T>C 70A>G - RMRP_000005 Finnish Major CHH mutation, (90> Finnish CHH families; most homozygous), and also the most common mutation (~48%) in other countries: Observed in American (also Amish), Australian, Austrian, Belgian, Brazilian, Canadian, Dutch, English, French, German, Turkish, Irish and Mexican CHH patients PubMed: Ridanpää et al. 2001&PubMed: 2002, PubMed: Bonafe et al. 2002&PubMed: 2005 and others PubMed: 2006, PubMed: 2008, PubMed: 2011, PubMed: 2012, PubMed: 2013 - - SUMMARY record yes 10/845 FIN CON - - - Anne Polvi
+/. - n.71A>G r.(?) - - pathogenic g.35657945T>C g.35657948T>C RMRP(NR_003051.3):n.71A>G - RMRP_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - n.71A>G r.(?) p.0 - likely pathogenic g.35657945T>C g.35657948T>C RMPR c.71A>G (RNA gene - no protein produced) - RMRP_000005 homozygous PubMed: Alabdullatif 2017 - - Germline yes - - - - LOVD
+/. - n.71A>G r.(?) - - pathogenic g.35657945T>C - RMRP(NR_003051.3):n.71A>G - RMRP_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/+? - n.77C>T r.77c>u - - likely pathogenic g.35657939G>A g.35657942G>A g.76C>T - RMRP_000053 1 CHH patient (com-het) with undetermined ethnicity PubMed: Horn et al. 2010 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.78C>T r.78c>u - - likely pathogenic g.35657938G>A g.35657941G>A g.77C>T - RMRP_000054 1 CHH patient (com-het) with undetermined ethnicity PubMed: Bacchetta et al. 2009 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.80G>A r.80g>a - - likely pathogenic g.35657936C>T g.35657939C>T 79A - RMRP_000055 1 American CHH family (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.81G>A r.81g>a - - likely pathogenic g.35657935C>T g.35657938C>T 80G>A - RMRP_000056 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.90C>G r.90c>g - - likely pathogenic g.35657926G>C g.35657929G>C 89C>G - RMRP_000057 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.92G>A r.92g>a - - likely pathogenic g.35657924C>T g.35657927C>T 91G>A - RMRP_000058 1 Belgian CHH patient (com-het); Variants n.91G>A and n.101C>T are in same haplotype and it is unclear which of them is (or both are) causative PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.93dupA r.93dupa - - likely pathogenic g.35657923dup g.35657926dupT g.92_93insA - RMRP_000059 1 Turkish CHH family (com-het) Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.94G>C r.94g>c - - likely pathogenic g.35657922C>G g.35657925C>G g.93G>C - RMRP_000060 1 Dutch CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.95_96delAG r.95_96delag - - likely pathogenic g.35657920_35657921delCT g.35657923_35657924delCT del AG at 94 - RMRP_000061 1 English CHH family (com-het) Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
?/. - n.96G>T r.(?) - - VUS g.35657920C>A g.35657923C>A RMRP(NR_003051.3):n.96G>T - CA9_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/+? - n.97_98dupTG r.97_98dupug - - likely pathogenic g.35657918_35657919dup g.35657921_35657922dupCA 98dupTG; dup TG at 98; g.96_97dupTG - RMRP_000063 2 Canadian and 2 Swiss CHH families (all com-het), 1 Turkish CHH family (hom) Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Ridanpää et al. 2002, PubMed: Ridanpää et al. 2001, PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.98G>A r.98g>a - - likely pathogenic g.35657918C>T g.35657921C>T g.97G>A - RMRP_000062 1 German CHH family and 1 American CHH patient (all com-het) PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/. - n.100C>T r.(?) - - likely pathogenic g.35657916G>A - RMRP(NR_003051.3):n.100C>T - RMRP_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/+? - n.102C>T r.102c>u - - likely pathogenic g.35657914G>A g.35657917G>A 101C>T - RMRP_000102 1 Belgian CHH patient (com-het); Variants n.91G>A and n.101C>T are in same haplotype and it is unclear which of them is (or both are) causative PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+/. - n.102C>T r.(?) - - pathogenic g.35657914G>A - - - RMRP_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - n.110C>T r.(?) - - VUS g.35657906G>A - RMRP(NR_003051.3):n.110C>T - RMRP_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/+? - n.117A>G r.117a>g - - likely pathogenic g.35657899T>C g.35657902T>C 116A>G - RMRP_000064 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.119A>G r.119a>g - - likely pathogenic g.35657897T>C g.35657900T>C 118G - RMRP_000065 1 German CHH patient (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.125C>T r.125c>u - - likely pathogenic g.35657891G>A g.35657894G>A 124C>T - RMRP_000066 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.127C>T r.127c>u - - likely pathogenic g.35657889G>A g.35657892G>A 126T; g126C>T - RMRP_000067 1 Arabian CHH family (hom), 1 Italian and 1 Turkish CHH family (both com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+/. - n.127C>T r.(?) - - pathogenic g.35657889G>A - - - RMRP_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/+? - n.128G>A r.128g>a - - likely pathogenic g.35657888C>T g.35657891C>T g.127G>A - RMRP_000068 1 Italian and 1 Canadian CHH family (both com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
?/? - n.128G>C r.128g>c - - VUS g.35657888C>G g.35657891C>G 127G>C - RMRP_000069 1 American CHH patient (het) PubMed: Hermanns el al. 2006 - - SUMMARY record yes 0/200 CON - - - Anne Polvi
-?/. - n.128G>C r.(?) - - likely benign g.35657888C>G g.35657891C>G RMRP(NR_003051.3):n.128G>C - RMRP_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - n.146C>T r.(?) - - VUS g.35657870G>A - RMRP(NR_003051.3):n.146C>T - RMRP_000108 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/+? - n.147G>A r.147g>a - - likely pathogenic g.35657869C>T g.35657872C>T 146A; g.146G>A - RMRP_000070 1 Chinese CHH family (hom), 1 French CHH family (com-het) and 2 CHH families (com-het) with undetermined ethnicity PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Kavadas et al. 2008 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+/. - n.147G>A r.(?) - - pathogenic g.35657869C>T - RMRP(NR_003051.3):n.147G>A - RMRP_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/+? - n.147G>C r.147g>c - - likely pathogenic g.35657869C>G g.35657872C>G g.146G>C - RMRP_000071 1 Italian CHH family (com-het) PubMed: Bonafe et al. 2005 - - SUMMARY record yes 0/100 CAU CON - - - Anne Polvi
+?/+? - n.153A>G r.153a>g - - likely pathogenic g.35657863T>C g.35657866T>C 152G - RMRP_000072 1 Canadian CHH family (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
+?/+? - n.155G>C r.155g>c - - likely pathogenic g.35657861C>G g.35657864C>G 154G>C - RMRP_000073 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+?/+? - n.155G>T r.155g>u - - likely pathogenic g.35657861C>A g.35657864C>A 154T - RMRP_000006 1 Finnish CHH family (com-het) PubMed: Ridanpää et al. 2002 - - SUMMARY record yes 0/280 CON - - - Anne Polvi
-/. - n.157G>C r.(?) - - benign g.35657859C>G g.35657862C>G RMRP(NR_003051.3):n.157G>C - CA9_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - n.157G>C r.(?) - - likely benign g.35657859C>G g.35657862C>G RMRP(NR_003051.3):n.157G>C - CA9_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - n.157G>C r.(?) - - benign g.35657859C>G - RMRP(NR_003051.3):n.157G>C - CA9_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - n.159A>G r.(?) - - VUS g.35657857T>C g.35657860T>C RMRP(NR_003051.3):n.159A>G - CA9_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/+? - n.169G>A r.169g>a - - likely pathogenic g.35657847C>T g.35657850C>T 168G>A - RMRP_000075 1 Japanese CHH family (com-het) PubMed: Hirose et al. 2006 - - SUMMARY record yes 0/65 JAP CON - - - Anne Polvi
?/. - n.176G>A r.(?) - - VUS g.35657840C>T - RMRP(NR_003051.3):n.176G>A - RMRP_000107 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - n.178C>T r.(?) - - benign g.35657838G>A g.35657841G>A RMRP(NR_003051.3):n.178C>T - CA9_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Gene encodes RNA component of mitochondrial RNA processing endoribonuclease, no protein of this gene is produced


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.